|
|
| (40 intermediate revisions by 5 users not shown) |
| Line 49: |
Line 49: |
| | </td> | | </td> |
| | <td id="myContent" width="20%" valign=top align=center> | | <td id="myContent" width="20%" valign=top align=center> |
| | + | <a href="#-"> |
| | + | <div class="popup" id="OH_PCR_Experiment_Popup"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png"> |
| | + | </div></a> |
| | + | <a href="#-"> |
| | + | <div class="popup" id="TEV_SEC_Popup"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png"> |
| | + | </div></a> |
| | + | <a href="#-"> |
| | + | <div class="popup" id="TEV_Activity_Popup"> |
| | + | <img src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"> |
| | + | </div></a> |
| | <br> | | <br> |
| | <!-- Head End --> | | <!-- Head End --> |
| | <!-- Content Begin --> | | <!-- Content Begin --> |
| − | <img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/b/be/T--Munich--FrontPagePictures_Attributions.jpg"> | + | <img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/c/cd/T--Munich--FrontPagePictures_ImprovedPart.jpg"> |
| | <table width="960" border=0 cellspacing=0 cellpadding=10> | | <table width="960" border=0 cellspacing=0 cellpadding=10> |
| | <tr> | | <tr> |
| Line 63: |
Line 75: |
| | </tr> | | </tr> |
| | <tr><td colspan=6 align=left valign=center> | | <tr><td colspan=6 align=left valign=center> |
| − | <font size=7><b style="color: #51a7f9">Improved part:</b></font> | + | <font size=7><b style="color: #51a7f9">Improved part</b></font> |
| | </td> | | </td> |
| | </tr> | | </tr> |
| Line 70: |
Line 82: |
| | <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3> | | <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3> |
| | <p> | | <p> |
| − | The (+)-strand RNA genomes are often translated by the host to polyprotein precursors , which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>. | + | The (+)-strand viral RNA genomes are often translated by the host to polyprotein . Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>. |
| | </p> | | </p> |
| | <p> | | <p> |
| − | or scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a 6x His-tag, which made it possible to purify this protease. | + | For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. <b>We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a His <sub>6</sub>-tag, which made it possible to purify this protease . </b> We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: <a class="myLink" href="http://parts.igem.org/Part:BBa_K2323002">BBa_K2323002</a>. |
| | </p> | | </p> |
| | | | |
| Line 83: |
Line 95: |
| | <h3>TEV protease cloning</h3> | | <h3>TEV protease cloning</h3> |
| | <p> | | <p> |
| − | The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.</p> | + | The His<sub>6</sub>-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. </p> |
| | <div class="captionPicture"> | | <div class="captionPicture"> |
| | <table class="anActualTable"> | | <table class="anActualTable"> |
| − | <tr><td>p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr> | + | <tr><td>5'-3' p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr> |
| − | <tr><td>p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr> | + | <tr><td>5'-3' p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr> |
| | </table> | | </table> |
| − | <p>
| + | |
| − | 5'-3' primers sequences
| + | |
| − | </p>
| + | |
| | </div> | | </div> |
| | <div class="captionPicture"> | | <div class="captionPicture"> |
| | <img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg"> | | <img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg"> |
| − | <p> | + | <p><b>Figure 1:</b>The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> |
| − | The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS. | + | |
| − | </p> | + | |
| | </div> | | </div> |
| | </td> | | </td> |
| Line 103: |
Line 111: |
| | | | |
| | | | |
| − | <tr><td align=center valign=center colspan=6> | + | <tr><td class="verticalColumn" align=center valign=center colspan=3> |
| | <p> | | <p> |
| − | After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5&alpha for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>. | + | After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5α for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>. |
| | </p> | | </p> |
| − | <img width=400 src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png">
| |
| − | </td>
| |
| − | </tr>
| |
| − |
| |
| − | <tr><td align=center valign=center colspan=6>
| |
| | <div class="captionPicture"> | | <div class="captionPicture"> |
| − | <img height=400 src="https://static.igem.org/mediawiki/2017/b/b1/T--Munich--Improve_His_TEV.svg"> | + | <a href="#TEV_SEC_Popup"><img height= 300 src="https://static.igem.org/mediawiki/2017/ f/ f1/T--Munich-- Improve_TEV_SEC_SDS. png" ></a> |
| − | <p> | + | <p><b>Figure 2:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> |
| − | Affinity purification of His-TEV using the Äkta protein purification system.
| + | |
| − | </p> | + | |
| | </div> | | </div> |
| | </td> | | </td> |
| − | </tr> | + | <td colspan=3 align=center valign=center> |
| | | | |
| − | <tr><td align=center valign=center colspan=6>
| |
| | <div class="captionPicture"> | | <div class="captionPicture"> |
| − | <img width=400 src="https://static.igem.org/mediawiki/2017/a/a1/T--Munich--Improve_His_TEV_gel_1.png"> | + | < a href=" #OH_PCR_Experiment_Popup"><img width= 300 src="https://static.igem.org/mediawiki/2017/ 1/ 1b/T--Munich-- Improve_TEV_OH_PCR.png" ></a> |
| − | <img width=400 src="https://static.igem.org/mediawiki/2017/d/d4/T--Munich--Improve_His_TEV_gel_2.png"> | + | <p><b>Figure 3:</b> PCR overhang for TEV His-tag</p> |
| − | <p> | + | |
| − | 10 % SDS-PAGE of affinity purification of the His-TEV protease.
| + | |
| − | </p> | + | |
| | </div> | | </div> |
| | + | |
| | </td> | | </td> |
| − | </tr> | + | </tr> |
| | | | |
| − | <tr><td align=center valign=center colspan=3> | + | <tr><td align=center valign=center colspan=6> |
| | <div class="captionPicture"> | | <div class="captionPicture"> |
| − | <img width=300 src="https://static.igem.org/mediawiki/2017/a/a1/T--Munich--Improve_His_TEV_gel_1.png"> | + | <img height=600 src="https://static.igem.org/mediawiki/2017/c/c1/T--Munich--Improve_TEV_SEC.svg"> |
| − | <p> | + | <p><b>Figure 4:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> |
| − | 10 % SDS-PAGE of affinity purification of the His-TEV protease.
| + | |
| − | </p> | + | |
| | </div> | | </div> |
| | </td> | | </td> |
| − | <td align=center valign=center colspan=3>
| + | </tr> |
| − | <div class="captionPicture">
| + | <tr><td align=center valign=center colspan=6> |
| − | <img width=300 src="https://static.igem.org/mediawiki/2017/a/a1/T--Munich--Improve_His_TEV_gel_1.png">
| + | <p> |
| − | <p>
| + | The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C. |
| − | 10 % SDS-PAGE of affinity purification of the His-TEV protease.
| + | |
| − | </p>
| + | |
| − | </div>
| + | |
| − | </td>
| + | |
| − | </tr> | + | |
| − | | + | |
| − |
| + | |
| − | | + | |
| − | | + | |
| − | <tr><td colspan=3 align=center valign=center> | + | |
| − | <p>
| + | |
| − | <b>AeBlue</b>: The RNA strand in a specially designed RNA/DNA dimer is cut by Cas13a's collateral
| + | |
| − | activity. After digestion, the interaction between the two strands is too weak to hold the dimer and it
| + | |
| − | decays. We can then use the DNA-strand as template to translate the chromoprotein <a href="http://parts.igem.org/Part:BBa_K864401">aeBlue</a>.
| + | |
| − | </p>
| + | |
| − | </td>
| + | |
| − | <td colspan=3 align=center valign=center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2017/9/90/T--Munich--Description_aeBlue.svg" width=360>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | | + | |
| − | <tr>
| + | |
| − | <td colspan=3 align=center valign=center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2017/6/64/T--Munich--Description_Intein_Extein.svg" width=360>
| + | |
| − | </td>
| + | |
| − | <td colspan=3 align=center valign=center>
| + | |
| − | <p> | + | |
| − | <b>Intein-Extein</b>: By binding TEV-protease with a RNA-linker we can use Cas13a's collateral activity
| + | |
| − | to regulate the protease's diffusion and use it to cleave a TEV tag separating the intein regions of a
| + | |
| − | modified chromophore. After the first cleavage, the intein segment excises itself<sup><a class="myLink" href="#ref_13">13</a></sup>, bringing together the
| + | |
| − | halves of the chromophore. Only then is the chromophore functional and produces the colorimetric
| + | |
| − | read-out.
| + | |
| − | </p>
| + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | | + | |
| − | <tr class="lastRow"><td colspan=3 align=center valign=center>
| + | |
| − | <p>
| + | |
| − | <b>Gold nanoparticles</b>: Other than in the other two colorimetric readouts, aeB lue and Intein-Extein, the only protein involved in the gold nanoparticle (AuNP)-readout is Cas13a, like in our RNase Alert readout. This reduces the necessary fine tuning of the biochemical circuit to a minimum, favoring high robustness of the readout. Due to the phenomenon of Localized Surface Plasmon Resonance, AuNPs appear in a distinct color, ranging from intense red to blue, black and colorless. This property depends on particle size, shape, the immediate environment, and -most critical for our purpose- aggregation state<sup><a class="myLink" href="#ref_14">14</a></sup>.
| + | |
| − | </p>
| + | |
| − | <p> . In our project we use AuNPs with a diameter of roughly 10 nm, giving them a bright red color in solution. Their small size and therefore high surface-to-volume ratio makes them ideal for functionalization with thiolated compounds, forming covalent Au-S bonds. The first step of our concept is to use these properties to functionalize AuNPs with either 5’- or 3’- thiolated DNA and, through addition of linker- RNA which hybridizes with both thiolated DNA strands, form aggregates, changing the color from red to blue. The design of the linker-RNA includes an uracil-rich, single-stranded segment between the DNA-complementary termini, making it prone to Cas13a-mediated promiscuous cleavage. .
| + | |
| − | </p>
| + | |
| − | <p>
| + | |
| − | It has been shown that, for purely DNA-based hybridization, AuNP aggregates can be spotted on filter paper, dried and severed by addition of a nuclease-containing solution, visible through diffusion of red AuNPs on the paper. Thus, the second part of our concept is to spot RNA-linked AuNPs on paper, dry them alongside the Cas13a mixture and detect specific target RNAs and resulting Cas13a activity with a simple change from blue to red.
| + | |
| − | </p>
| + | |
| − | </td>
| + | |
| − | <td colspan=3 align=center valign=center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2017/b/b3/T--Munich--Description_Goldnanoparticles.svg" width=360>
| + | |
| − | | + | |
| − | </td>
| + | |
| − | </tr>
| + | |
| − | | + | |
| − | <tr><td colspan=6 align=center valign=center>
| + | |
| − | <h3>Software</h3>
| + | |
| − | <p>
| + | |
| − | To help facilitate the design of crRNA, the sequences that give CascAID its specificity, we developed a
| + | |
| − | software tool that checks crRNA for unwanted secondary structures. This gives valuable insight on
| + | |
| − | whether the sequence is suited to use with Cas13a or whether some modifications are needed.
| + | |
| − | Together with Team Delft's software tool which designs the corresponding crRNA based on the target,
| + | |
| − | we collaborated to develop a powerful tool that suggests crRNA sequences and checks their usability
| + | |
| | </p> | | </p> |
| | </td> | | </td> |
| | </tr> | | </tr> |
| | | | |
| − | <tr><td colspan=6 align=center valign=center> | + | <tr><td align=center valign=center colspan=6> |
| − | <h3>References</h3>
| + | |
| | <p> | | <p> |
| − | <ol style="text-align: left">
| + | For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh. |
| − | <li id="ref_1">Cohen, Limor, and David R. Walt. "Single-Molecule Arrays for Protein and Nucleic Acid Analysis." Annual Review of Analytical Chemistry 0 (2017).</li>
| + | |
| − | <li id="ref_2">Nakano, Michihiko, et al. "Single-molecule PCR using water-in-oil emulsion." Journal of biotechnology 102.2 (2003): 117-124.</li>
| + | |
| − | <li id="ref_3">Taniguchi, Yuichi, et al. "Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells." science 329.5991 (2010): 533-538.</li>
| + | |
| − | <li id="ref_4">Rissin, David M., et al. "Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations." Nature biotechnology 28.6 (2010): 595-599.</li>
| + | |
| − | <li id="ref_5">Pardee, Keith, et al. "Rapid, low-cost detection of Zika virus using programmable biomolecular components." Cell 165.5 (2016): 1255-1266.</li>
| + | |
| − | <li id="ref_6">Slomovic, Shimyn, Keith Pardee, and James J. Collins. "Synthetic biology devices for in vitro and in vivo diagnostics." Proceedings of the National Academy of Sciences 112.47 (2015): 14429-14435.</li>
| + | |
| − | <li id="ref_7">Tang, Ruihua, et al. "A fully disposable and integrated paper-based device for nucleic acid extraction, amplification and detection." Lab on a Chip 17.7 (2017): 1270-1279.</li>
| + | |
| − | <li id="ref_8">Vashist, Sandeep Kumar, et al. "Emerging technologies for next-generation point-of-care testing." Trends in biotechnology 33.11 (2015): 692-705.</li>
| + | |
| − | <li id="ref_9">Gubala, Vladimir, et al. "Point of care diagnostics: status and future." Analytical chemistry 84.2 (2011): 487-515.</li>
| + | |
| − | <li id="ref_10">Abudayyeh, Omar O., et al. "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector." Science 353.6299 (2016): aaf5573.</li>
| + | |
| − | <li id="ref_11">Gootenberg, Jonathan S., et al. "Nucleic acid detection with CRISPR-Cas13a/C2c2." Science (2017): eaam9321.</li>
| + | |
| − | <li id="ref_12">https://www.idtdna.com/pages/docs/technical-reports/in_vitro_nuclease_detectionD325FDB69855.pdf (retrieved: 13.10.17)</li>
| + | |
| − | <li id="ref_13"> Anraku, Yasuhiro, Ryuta Mizutani, and Yoshinori Satow. "Protein splicing: its discovery and structural insight into novel chemical mechanisms." IUBMB life 57.8 (2005): 563-574.</li>
| + | |
| − | <li id="ref_14">Link, Stephan, and Mostafa A. El-Sayed. "Size and temperature dependence of the plasmon absorption of colloidal gold nanoparticles." The Journal of Physical Chemistry B 103.21 (1999): 4212-4217.</li>
| + | |
| − | <li id="ref_15">Zhao, W., Ali, M.M., Aguirre, S.D., Brook, M.A., and Li, Y. (2008). "Paper-based bioassays using gold nanoparticle colorimetric probes." Analytical Chemistry 80, 8431–8437.</li>
| + | |
| − | </ol>
| + | |
| | </p> | | </p> |
| − | </td> | + | <div class="captionPicture"> |
| | + | <a href="#TEV_Activity_Popup"><img width=600 src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"></a> |
| | + | <p><b> Figure 5:</b> The SDS-PAGE showing the cleavage of our substrate after respective incubation time</p> |
| | + | </div> |
| | + | <p>Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results. However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.</p> |
| | </tr> | | </tr> |
| − |
| |
| − |
| |
| | | | |
| | | | |
