RobStrasser (Talk | contribs) |
|||
(31 intermediate revisions by 5 users not shown) | |||
Line 49: | Line 49: | ||
</td> | </td> | ||
<td id="myContent" width="20%" valign=top align=center> | <td id="myContent" width="20%" valign=top align=center> | ||
+ | <a href="#-"> | ||
+ | <div class="popup" id="OH_PCR_Experiment_Popup"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png"> | ||
+ | </div></a> | ||
+ | <a href="#-"> | ||
+ | <div class="popup" id="TEV_SEC_Popup"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png"> | ||
+ | </div></a> | ||
+ | <a href="#-"> | ||
+ | <div class="popup" id="TEV_Activity_Popup"> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"> | ||
+ | </div></a> | ||
<br> | <br> | ||
<!-- Head End --> | <!-- Head End --> | ||
<!-- Content Begin --> | <!-- Content Begin --> | ||
− | <img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/ | + | <img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/c/cd/T--Munich--FrontPagePictures_ImprovedPart.jpg"> |
<table width="960" border=0 cellspacing=0 cellpadding=10> | <table width="960" border=0 cellspacing=0 cellpadding=10> | ||
<tr> | <tr> | ||
Line 63: | Line 75: | ||
</tr> | </tr> | ||
<tr><td colspan=6 align=left valign=center> | <tr><td colspan=6 align=left valign=center> | ||
− | <font size=7><b style="color: #51a7f9">Improved part | + | <font size=7><b style="color: #51a7f9">Improved part</b></font> |
</td> | </td> | ||
</tr> | </tr> | ||
Line 70: | Line 82: | ||
<h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3> | <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3> | ||
<p> | <p> | ||
− | The (+)-strand RNA genomes are often translated by the host to polyprotein precursors | + | The (+)-strand viral RNA genomes are often translated by the host to polyprotein. Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>. |
</p> | </p> | ||
<p> | <p> | ||
− | + | For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. <b>We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a His<sub>6</sub>-tag, which made it possible to purify this protease. </b> We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: <a class="myLink" href="http://parts.igem.org/Part:BBa_K2323002">BBa_K2323002</a>. | |
</p> | </p> | ||
Line 83: | Line 95: | ||
<h3>TEV protease cloning</h3> | <h3>TEV protease cloning</h3> | ||
<p> | <p> | ||
− | The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.</p> | + | The His<sub>6</sub>-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. </p> |
<div class="captionPicture"> | <div class="captionPicture"> | ||
<table class="anActualTable"> | <table class="anActualTable"> | ||
− | <tr><td>p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr> | + | <tr><td>5'-3' p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr> |
− | <tr><td>p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr> | + | <tr><td>5'-3' p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr> |
</table> | </table> | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
<div class="captionPicture"> | <div class="captionPicture"> | ||
<img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg"> | <img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg"> | ||
− | <p> | + | <p><b>Figure 1:</b>The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> |
− | The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS | + | |
− | </p> | + | |
</div> | </div> | ||
</td> | </td> | ||
Line 103: | Line 111: | ||
− | <tr><td align=center valign=center colspan= | + | <tr><td class="verticalColumn" align=center valign=center colspan=3> |
<p> | <p> | ||
− | After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> | + | After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5α for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>. |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</p> | </p> | ||
+ | <div class="captionPicture"> | ||
+ | <a href="#TEV_SEC_Popup"><img height=300 src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png"></a> | ||
+ | <p><b>Figure 2:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> | ||
+ | </div> | ||
</td> | </td> | ||
<td colspan=3 align=center valign=center> | <td colspan=3 align=center valign=center> | ||
− | |||
− | |||
− | |||
− | < | + | <div class="captionPicture"> |
− | < | + | <a href="#OH_PCR_Experiment_Popup"><img width=300 src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png"></a> |
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <p><b>Figure 3:</b> PCR overhang for TEV His-tag</p> |
− | </ | + | </div> |
− | + | ||
− | <p> | + | |
− | <b> | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | </p> | + | |
− | </ | + | |
− | + | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
</td> | </td> | ||
− | < | + | </tr> |
− | + | ||
+ | <tr><td align=center valign=center colspan=6> | ||
+ | <div class="captionPicture"> | ||
+ | <img height=600 src="https://static.igem.org/mediawiki/2017/c/c1/T--Munich--Improve_TEV_SEC.svg"> | ||
+ | <p><b>Figure 4:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p> | ||
+ | </div> | ||
</td> | </td> | ||
− | </tr> | + | </tr> |
− | + | <tr><td align=center valign=center colspan=6> | |
− | <tr><td | + | <p> |
− | + | The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C. | |
− | <p> | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</p> | </p> | ||
</td> | </td> | ||
</tr> | </tr> | ||
− | <tr><td | + | <tr><td align=center valign=center colspan=6> |
− | + | ||
<p> | <p> | ||
− | + | For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh. | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</p> | </p> | ||
− | </ | + | <div class="captionPicture"> |
+ | <a href="#TEV_Activity_Popup"><img width=600 src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"></a> | ||
+ | <p><b> Figure 5:</b> The SDS-PAGE showing the cleavage of our substrate after respective incubation time</p> | ||
+ | </div> | ||
+ | <p>Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results. However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.</p> | ||
</tr> | </tr> | ||
− | |||
− | |||
Latest revision as of 03:26, 2 November 2017
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|