Difference between revisions of "Team:Munich/Improve"

(Prototype team page)
 
 
(89 intermediate revisions by 5 users not shown)
Line 1: Line 1:
−
{{Munich}}
+
<!-- #919191 Grau1 -->
 +
<!-- #787878 Grau2 -->
 +
<!-- #51A7f9 Blau1 -->
 +
<!-- #3c7cb9 Blau2 -->
 +
<!-- #ffffff weiss -->
 
<html>
 
<html>
 +
<link rel="stylesheet" type="text/css"
 +
href="https://2017.igem.org/Template:Munich/CSS?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css"
 +
href="https://2017.igem.org/Template:Munich/Header?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css"
 +
href="https://2017.igem.org/Template:Munich/Filter?action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css"
 +
href="https://2017.igem.org/Template:Munich/Body?action=raw&ctype=text/css" />
 +
<head>
 +
<style>
 +
#HQ_page h3{
 +
text-align: left;
 +
margin-bottom: 10px;
 +
}
  
 +
#HQ_page h3{
 +
color: #51a7f9;
 +
}
 +
 +
 +
#myContent *{
 +
color: #444444;
 +
}
 +
 +
#myContent tr p{
 +
margin-bottom: 10px;
 +
}
 +
 +
#HQ_page .anActualTable{
 +
border: 1px solid #919191;
 +
}
 +
</style>
 +
</head></html>
 +
{{Munich/Menu}}
 +
<html>
 +
<body>
 +
<table width=100% height=100% cellpadding=0 cellspacing=0 border=0>
 +
<!-- Content -->
 +
<tr><td width="100%" colspan=4>
 +
<table width=100% height=100% cellpadding=0 cellspacing=0 border=0>
 +
<tr>
 +
<td width="40%">
 +
</td>
 +
<td id="myContent" width="20%" valign=top align=center>
 +
<a href="#-">
 +
<div class="popup" id="OH_PCR_Experiment_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png">
 +
</div></a>
 +
<a href="#-">
 +
<div class="popup" id="TEV_SEC_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png">
 +
</div></a>
 +
<a href="#-">
 +
<div class="popup" id="TEV_Activity_Popup">
 +
<img  src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png">
 +
</div></a>
 +
<br>
 +
<!-- Head End -->
 +
<!-- Content Begin -->
 +
<img id="TopPicture" width="960" src="https://static.igem.org/mediawiki/2017/c/cd/T--Munich--FrontPagePictures_ImprovedPart.jpg">
 +
<table width="960" border=0 cellspacing=0 cellpadding=10>
 +
<tr>
 +
<td width=160></td>
 +
<td width=160></td>
 +
<td width=160></td>
 +
<td width=160></td>
 +
<td width=160></td>
 +
<td width=160></td>
 +
</tr>
 +
<tr><td colspan=6 align=left valign=center>
 +
<font size=7><b style="color: #51a7f9">Improved part</b></font>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td  colspan = 6 align="left">
 +
        <h3 class="introduction">The Tobacco Etch Virus (TEV) protease with 6x His-tag</h3>
 +
<p>
 +
The (+)-strand viral RNA genomes are often translated by the host to polyprotein. Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)<sup><a class="myLink" href="#ref_1">1</a></sup>.
 +
                </p>
 +
<p>
 +
For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. <b>We improved the BioBrick <a class="myLink" href="http://parts.igem.org/Part:BBa_K1319008">BBa_K1319008</a> by adding a His<sub>6</sub>-tag, which made it possible to purify this protease. </b> We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: <a class="myLink" href="http://parts.igem.org/Part:BBa_K2323002">BBa_K2323002</a>.
 +
                </p>
 +
 +
</td>
 +
</tr>
 +
 +
 +
<tr><td align=center valign=center colspan=6>
 +
<h3>TEV protease cloning</h3>
 +
<p> 
 +
The His<sub>6</sub>-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. </p>
 +
<div class="captionPicture">
 +
<table class="anActualTable">
 +
    <tr><td>5'-3' p-TEV-His-fwd:</td><td>catcatcaccatcaccacgccggcggcgaaagc</td></tr>
 +
    <tr><td>5'-3' p-TEV-His-rev:</td><td>catctagtatttctcctctttctctagtatctccc</td></tr>
 +
</table>
  
−
<div class="column full_size judges-will-not-evaluate">
 
−
<h3>★  ALERT! </h3>
 
−
<p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a> or <a href="https://2017.igem.org/Judging/Awards"> award listed above</a>. </p>
 
−
<p> Delete this box in order to be evaluated for this medal criterion and/or award. See more information at <a href="https://2017.igem.org/Judging/Pages_for_Awards"> Instructions for Pages for awards</a>.</p>
 
 
</div>
 
</div>
−
<div class="clear"></div>
+
<div class="captionPicture">
 +
<img height=400 src="https://static.igem.org/mediawiki/2017/3/36/T--Munich--Improve_Plasmid_Map.svg">
 +
<p><b>Figure 1:</b>The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
 +
</div>
 +
</td>
 +
</tr>  
  
−
<div class="column full_size">
 
−
<h1>Improve</h1>
 
−
<p>For teams seeking to improve upon a previous part or project, you should document all of your work on this page. Please remember to include all part measurement and characterization data on the part page on the Regisrty. Please include a link to your improved part on this page.</p>
 
  
−
<h3>Gold Medal Criterion #2</h3>
+
<tr><td class="verticalColumn" align=center valign=center colspan=3>
−
<p><b>Standard Tracks:</b> Improve the function of an existing BioBrick Part. The original part must NOT be from your 2017 part number range. If you change the original part sequence, you must submit a new part. In addition, both the new and original part pages must reference each other. This working part must be different from the part documented in bronze #4 and silver #1.
+
<p> 
 +
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5α for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via <a class="myLink" href="/Team:Munich/Protocols">affinity and size exclusion chromatography</a>.
 +
</p>
 +
<div class="captionPicture">
 +
<a href="#TEV_SEC_Popup"><img height=300 src="https://static.igem.org/mediawiki/2017/f/f1/T--Munich--Improve_TEV_SEC_SDS.png"></a>
 +
<p><b>Figure 2:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
 +
</div>
 +
</td>
 +
<td colspan=3 align=center valign=center>
  
−
<br><br>
+
<div class="captionPicture">
−
<b>Special Tracks:</b> Improve the function of an existing iGEM project (that your current team did not originally create) and display your achievement on your wiki.</p>
+
<a href="#OH_PCR_Experiment_Popup"><img width=300  src="https://static.igem.org/mediawiki/2017/1/1b/T--Munich--Improve_TEV_OH_PCR.png"></a>
 +
<p><b>Figure 3:</b> PCR overhang for TEV His-tag</p>
 +
</div>
  
 +
</td>
 +
</tr>
  
 +
<tr><td align=center valign=center colspan=6>
 +
<div class="captionPicture">
 +
<img height=600 src="https://static.igem.org/mediawiki/2017/c/c1/T--Munich--Improve_TEV_SEC.svg">
 +
<p><b>Figure 4:</b> The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS</p>
 
</div>
 
</div>
 +
</td>
 +
</tr>
 +
<tr><td align=center valign=center colspan=6>
 +
<p>
 +
The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C.
 +
</p>
 +
</td>
 +
</tr>
  
 +
<tr><td align=center valign=center colspan=6>
 +
<p>
 +
For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.
 +
</p>
 +
<div class="captionPicture">
 +
<a href="#TEV_Activity_Popup"><img width=600  src="https://static.igem.org/mediawiki/2017/6/6b/T--Munich--Improve_TEV_Cleavage_final.png"></a>
 +
<p><b> Figure 5:</b> The SDS-PAGE showing the cleavage of our substrate after respective incubation time</p>
 +
</div>
 +
<p>Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results.  However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.</p>
 +
</tr>
  
  
 +
<tr><td class="no-padding" colspan=6 align=right valign=center height=10>
 +
<br><br><br><center><hr></center>
 +
</td></tr>
 +
</table>
 +
<!-- Content End -->
 
</html>
 
</html>
 +
{{Munich/Footer}}

Latest revision as of 03:26, 2 November 2017

Description

Design

Demonstrate

Measurement

Applied Design

Final Results

Achievements

Protocols

Notebook

Safety

Parts

Improved Part

Part Collection

InterLab

Model

Software

Collaboration

Detector

Quake Valve

Paperstrips

Sample Processing

Silver

Gold

Engagement

Collaborations

Team members

Sponsors

Attributions

Gallery

Improved part

The Tobacco Etch Virus (TEV) protease with 6x His-tag

The (+)-strand viral RNA genomes are often translated by the host to polyprotein. Then the virus provides protease to cleave these precursors into mature proteins co-translationally. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)1.

For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the BioBrick BBa_K1319008 by adding a His6-tag, which made it possible to purify this protease. We show here the characterization of our improved BioBrick, but the completed details are available in the Registry page: BBa_K2323002.

TEV protease cloning

The His6-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

5'-3' p-TEV-His-fwd:catcatcaccatcaccacgccggcggcgaaagc
5'-3' p-TEV-His-rev:catctagtatttctcctctttctctagtatctccc

Figure 1:The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.

Figure 2: The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

Figure 3: PCR overhang for TEV His-tag

Figure 4: The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS

The gel images show the purity of the TEV protease. We stored the sample in TEV storage buffer at -80 °C.

For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.

Figure 5: The SDS-PAGE showing the cleavage of our substrate after respective incubation time

Next, the activity should be analyzed between 0 and 1 h to correctly evaluate the results. However, we highly purified our His-TEV protease and also used it successfully to process our Cas13a proteins. Here, we provide a BioBrick, which could be useful for all future iGEM teams.