Lukas Adam (Talk | contribs) |
Lukas Adam (Talk | contribs) |
||
(14 intermediate revisions by the same user not shown) | |||
Line 15: | Line 15: | ||
Gibson_Overlaps.g0_reverse = "TTATCCACTGGCGAGCTCTGTAACGAAACGTA"; | Gibson_Overlaps.g0_reverse = "TTATCCACTGGCGAGCTCTGTAACGAAACGTA"; | ||
− | + | var lookupObj = {"p15": | |
+ | {"id": "BBa_K2398013", | ||
+ | },"pBR322": | ||
+ | {"id": "BBa_K2398014", | ||
+ | }, "pSC101": | ||
+ | {"id":"BBa_K2398015", | ||
+ | }, "sd2_GIII": | ||
+ | {"id":"BBa_K2398005", | ||
+ | }, "sd5_GIII": | ||
+ | {"id":"BBa_K2398018", | ||
+ | },"sd6_GIII": | ||
+ | {"id":"BBa_K2398020", | ||
+ | },"SD4_GIII": | ||
+ | {"id":"BBa_K2398007", | ||
+ | },"sd8_GIII": | ||
+ | {"id":"BBa_K2398006", | ||
+ | },"SD8_GIII": | ||
+ | {"id":"BBa_K2398008", | ||
+ | },"TheophyllineRS": | ||
+ | {"id":"BBa_K2398019", | ||
+ | },"luxab": | ||
+ | {"id":"BBa_K2398012", | ||
+ | },"pam_promoter": | ||
+ | {"id":"BBa_K2398003", | ||
+ | },"pBLind": | ||
+ | {"id":"BBa_K2398002", | ||
+ | },"psp_tet": | ||
+ | {"id":"BBa_K2398024", | ||
+ | },"t7_promoter": | ||
+ | {"id":"BBa_K2398001", | ||
+ | },"psp-el222": | ||
+ | {"id":"BBa_K2398004", | ||
+ | },"Nonsense sequence": | ||
+ | {"id":"BBa_K808003", | ||
+ | }}; | ||
+ | |||
//load instructions text | //load instructions text | ||
var spec_mapping = ["ori","rbs","mrk","pro","add"]; | var spec_mapping = ["ori","rbs","mrk","pro","add"]; | ||
Line 121: | Line 156: | ||
//Process | //Process | ||
− | function | + | function registerProtocol(opts, partdict) { |
+ | try { | ||
+ | var staticfwd = ""; | ||
+ | var staticrev = ""; | ||
var originname = opts["origin"]; | var originname = opts["origin"]; | ||
+ | console.log(opts); | ||
+ | console.log(partdict); | ||
var getOri = "Get the part containing the origin (" + originname + ") "; | var getOri = "Get the part containing the origin (" + originname + ") "; | ||
− | getOri += "with ID " + partdict[originname] + "."; | + | getOri += "with ID " + partdict[originname].id + "."; |
var promotername = opts["promotor"]; | var promotername = opts["promotor"]; | ||
var getPromoter = "Get the part containing the promoter (" + promotername + ") "; | var getPromoter = "Get the part containing the promoter (" + promotername + ") "; | ||
− | getPromoter += "with ID " + partdict[promotername] + "."; | + | getPromoter += "with ID " + partdict[promotername].id + "."; |
var rbsname = opts["rbs"]; | var rbsname = opts["rbs"]; | ||
var getRbs = "Get the part containing the RBS (" + rbsname + ") "; | var getRbs = "Get the part containing the RBS (" + rbsname + ") "; | ||
− | getRbs += "with ID " + partdict[rbsname] + "."; | + | getRbs += "with ID " + partdict[rbsname].id + "."; |
var markername = opts["marker"]; | var markername = opts["marker"]; | ||
var getMarker = "Get the part containing the marker (" + markername + ") "; | var getMarker = "Get the part containing the marker (" + markername + ") "; | ||
− | getMarker += "with ID " + partdict[markername] | + | getMarker += "with ID " + partdict[markername].id + "."; |
− | + | ||
− | + | ||
− | + | ||
var getMessage = [getOri, getPromoter, getRbs, | var getMessage = [getOri, getPromoter, getRbs, | ||
− | getMarker | + | getMarker].join(" "); |
− | var clonify = "Transform all of the above into | + | var clonify = "Transform all of the above into E. coli. "; |
clonify += "Extract and purify the resulting plasmids. "; | clonify += "Extract and purify the resulting plasmids. "; | ||
clonify += "Digest with BglII and extract the correct fragment from an agarose gel."; | clonify += "Digest with BglII and extract the correct fragment from an agarose gel."; | ||
− | + | var design = "Design primers with Gibson overhangs for your construct."; | |
+ | design += "PCR with the designed primers and check fragment length on "; | ||
+ | design += "agarose gel."; | ||
+ | var referTo = "Refer to our Methods for more information."; | ||
+ | var completeMessage = [getMessage, clonify, design, referTo].join(" "); | ||
+ | $("#instructions").text(completeMessage);} catch (err) { | ||
+ | $("#instructions").text("You are using custom parts, so no simple instructions can be issued. Please consult our methods and our RFC for more information."); | ||
+ | }; | ||
Line 165: | Line 209: | ||
seqs["marker"] = library_data[opts["marker"]]; | seqs["marker"] = library_data[opts["marker"]]; | ||
− | registerProtocol(opts); | + | registerProtocol(opts, lookupObj); |
//Promotor | //Promotor | ||
Line 356: | Line 400: | ||
}); | }); | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
download('plasmid.fa', ">"+ops_name.join(separator="|")+"|custom plasmid designed using the Heidelberg iGEM 2017 team toolbox\n"+Concat_Ops); | download('plasmid.fa', ">"+ops_name.join(separator="|")+"|custom plasmid designed using the Heidelberg iGEM 2017 team toolbox\n"+Concat_Ops); |
Latest revision as of 03:43, 2 November 2017
//Gibson Overlaps var Gibson_Overlaps = {}; Gibson_Overlaps.g0_forward = "TGAAATTCTGGGCCCTGCATTACGAGAACTGA"; Gibson_Overlaps.g1_reverse = "TACTGCACCTGTAGGTCGACGATGATCTGATA"; Gibson_Overlaps.g1_forward = "TATCAGATCATCGTCGACCTACAGGTGCAGTA"; Gibson_Overlaps.g2_reverse = "TTAGTACTACTCGAGTTGATAGGCACCGACCA"; Gibson_Overlaps.g2_forward = "TGGTCGGTGCCTATCAACTCGAGTAGTACTAA"; Gibson_Overlaps.g3_reverse = "TGGTACTTCAAATGCGGCTTGGCTCCAGACAA"; Gibson_Overlaps.g3_forward = "TTGTCTGGAGCCAAGCCGCATTTGAAGTACCA"; Gibson_Overlaps.g4_reverse = "TGAAATTCTGGGCCCTGCATTACGAGAACTGA"; Gibson_Overlaps.g4_forward = "TCAGTTCTCGTAATGCAGGGCCCAGAATTTCA"; Gibson_Overlaps.g0_reverse = "TTATCCACTGGCGAGCTCTGTAACGAAACGTA"; var lookupObj = {"p15":
{"id": "BBa_K2398013", },"pBR322": {"id": "BBa_K2398014", }, "pSC101": {"id":"BBa_K2398015", }, "sd2_GIII": {"id":"BBa_K2398005", }, "sd5_GIII": {"id":"BBa_K2398018", },"sd6_GIII": {"id":"BBa_K2398020", },"SD4_GIII": {"id":"BBa_K2398007", },"sd8_GIII": {"id":"BBa_K2398006", },"SD8_GIII": {"id":"BBa_K2398008", },"TheophyllineRS": {"id":"BBa_K2398019", },"luxab": {"id":"BBa_K2398012", },"pam_promoter": {"id":"BBa_K2398003", },"pBLind": {"id":"BBa_K2398002", },"psp_tet": {"id":"BBa_K2398024", },"t7_promoter": {"id":"BBa_K2398001", },"psp-el222": {"id":"BBa_K2398004", },"Nonsense sequence": {"id":"BBa_K808003", }};
//load instructions text var spec_mapping = ["ori","rbs","mrk","pro","add"]; var toolbox_instructions = ""; $.ajax({ url: "rsrc/toolbox_instructions.txt",}) .done(function(file_content) { toolbox_instructions = file_content.replace(/[\n\r]+/g,""); } );
String.prototype.specFormat = function() { var s = this, i = arguments.length; while (i--) { s = s.replace(new RegExp('\\{' + spec_mapping[i] + '\\}', 'gm'), arguments[i]); } return s; };
//populate resistance gene list var library; var library_data = {}; $.getJSON('https://2017.igem.org/Team:Heidelberg/Toolbox_JSON?action=raw', function (responseJSON) { library = responseJSON;
//populate resistance genes (w/ groups) for (var group in library.resistance) { var $select = $("#input_origin_select"); var optgroup = $('<optgroup label="' + group + '">\n'); for (var item in library.resistance[group]) { var opt = document.createElement("option"); opt.value = item; opt.text = library.resistance[group][item].name; optgroup.append(opt); getSeqFromDatabase(library.resistance[group][item].file, item); }
$select.append(optgroup); }
//populate rbs genes for (var item in library.rbs) { var $select = $("#input_rbs_select"); var opt = document.createElement("option"); opt.value = item; opt.text = library.rbs[item].name; $select.append(opt); getSeqFromDatabase(library.rbs[item].file, item); }
//populate marker genes for (var item in library.marker) { var $select = $("#input_marker_select"); var opt = document.createElement("option"); opt.value = item; opt.text = library.marker[item].name; $select.append(opt); getSeqFromDatabase(library.marker[item].file, item); }
//populate promotor genes for (var item in library.promotor) { var $select = $("#input_promotor_select"); var opt = document.createElement("option"); opt.value = item; opt.text = library.promotor[item].name; $select.append(opt); getSeqFromDatabase(library.promotor[item].file, item); }
$("#input_promotor_select").append( '<option value="upload">Upload sequence file...</option>'); $("#input_promotor_select").append( '<option value="paste">Paste raw sequence...</option>');
//populate additional genes for (var item in library.additional) { var $select = $("#input_additional_select"); var opt = document.createElement("option"); opt.value = item; opt.text = library.additional[item].name; $select.append(opt); getSeqFromDatabase(library.additional[item].file, item); }
$("#input_additional_select").append( '<option value="upload">Upload sequence file...</option>'); $("#input_additional_select").append( '<option value="paste">Paste raw sequence...</option>');
});
var upload_data = []; var databasePath = "data"; var seqs = {}; var opts = {}; var mapping_order = ["origin", "promotor", "rbs", "marker", "additional"]; var html = ""; var y = 0; var angularLoaded=false;
//Process function registerProtocol(opts, partdict) { try { var staticfwd = ""; var staticrev = ""; var originname = opts["origin"]; console.log(opts); console.log(partdict); var getOri = "Get the part containing the origin (" + originname + ") "; getOri += "with ID " + partdict[originname].id + "."; var promotername = opts["promotor"]; var getPromoter = "Get the part containing the promoter (" + promotername + ") "; getPromoter += "with ID " + partdict[promotername].id + "."; var rbsname = opts["rbs"]; var getRbs = "Get the part containing the RBS (" + rbsname + ") "; getRbs += "with ID " + partdict[rbsname].id + "."; var markername = opts["marker"]; var getMarker = "Get the part containing the marker (" + markername + ") "; getMarker += "with ID " + partdict[markername].id + "."; var getMessage = [getOri, getPromoter, getRbs, getMarker].join(" "); var clonify = "Transform all of the above into E. coli. "; clonify += "Extract and purify the resulting plasmids. "; clonify += "Digest with BglII and extract the correct fragment from an agarose gel."; var design = "Design primers with Gibson overhangs for your construct."; design += "PCR with the designed primers and check fragment length on "; design += "agarose gel."; var referTo = "Refer to our Methods for more information."; var completeMessage = [getMessage, clonify, design, referTo].join(" "); $("#instructions").text(completeMessage);} catch (err) { $("#instructions").text("You are using custom parts, so no simple instructions can be issued. Please consult our methods and our RFC for more information."); };
}
function submit_p1() { //remove old plasmid image
upload_data = []; seqs = {}; opts = {}; html = ""; y = 0; opts["origin"] = document.getElementById("input_origin_select").value; opts["promotor"] = document.getElementById("input_promotor_select").value; opts["rbs"] = document.getElementById("input_rbs_select").value; opts["marker"] = document.getElementById("input_marker_select").value; opts["additional"] = document.getElementById("input_additional_select").value;
seqs["origin"] = library_data[opts["origin"]]; seqs["rbs"] = library_data[opts["rbs"]]; seqs["marker"] = library_data[opts["marker"]];
registerProtocol(opts, lookupObj);
//Promotor if (opts.promotor == 'upload') { Initialize($('#input_promotor_file')); $('#input_promotor_file').trigger('submit'); setTimeout(function () { if ($('#input_overlaps_promotor_upload').is(':checked')) { seqs["promotor"] = upload_data[0].replace(/(>.*)/,"").replace(/[\n\r]+/g,""); } else { seqs["promotor"] = upload_data[0].replace(/(>.*)/,"").replace(/[\n\r]+/g,"") .concat(Gibson_Overlaps['g4_forward']); } submit_p2(); }, 1000); } else if ($("#input_promotor_select").val() == 'paste') { if ($('#input_overlaps_promotor_paste').is(':checked')) { seqs["promotor"] = $("#input_promotor_paste_text") .val() .replace(/(>.*)/,"").replace(/[\n\r]+/g,""); submit_p2(); } else { seqs["promotor"] = $("#input_promotor_paste_text") .val() .replace(/(>.*)/,"").replace(/[\n\r]+/g,"") .concat(Gibson_Overlaps['g4_forward']); submit_p2(); } } else { //sequence from list seqs["promotor"] = library_data[opts["promotor"]].concat(Gibson_Overlaps['g0_forward']); setTimeout(submit_p2(), 250); } }
function submit_p2(){ //Additional sequence if (opts.additional == 'upload') { Initialize($('#input_additional_file')); $('#input_additional_file').trigger('submit'); setTimeout(function () { var ind = 0; if(opts.promotor == 'upload'){ ind = 1; } if ($('#input_overlaps_additional_upload').is(':checked')) { seqs["additional"] = upload_data[ind].replace(/(>.*)/,"").replace(/[\n\r]+/g,""); } else { seqs["additional"] = upload_data[ind].replace(/(>.*)/,"").replace(/[\n\r]+/g,"") .concat(Gibson_Overlaps['g4_forward']); } setTimeout(Mapper(seqs, opts),100); }, 500); } else if ($("#input_additional_select").val() == 'paste') { setTimeout(function () { if ($('#input_overlaps_additional_paste').is(':checked')) { seqs["additional"] = $("#input_additional_paste_text") .val() .replace(/(>.*)/,"").replace(/[\n\r]+/g,""); } else { seqs["additional"] = $("#input_additional_paste_text") .val() .replace(/(>.*)/,"").replace(/[\n\r]+/g,"") .concat(Gibson_Overlaps['g4_forward']); } setTimeout(Mapper(seqs, opts),100); }, 250); } else { //sequence from list seqs["additional"] = library_data[opts["additional"]].concat(Gibson_Overlaps['g0_forward']); } setTimeout(Mapper(seqs, opts), 100); }
var getSeqFromDatabase = function(file_content, item){ library_data[item] = file_content.split(" ")[file_content.split(" ").length-1]; }
function Initialize(element) { if (isAPIAvailable()) { element.on('submit', handleFileSelect);
} };
function isAPIAvailable() { // Check for the various File API support. if (window.File && window.FileReader && window.FileList && window.Blob) { // Great success! All the File APIs are supported.
return true; } else { // source: File API availability - http://caniuse.com/#feat=fileapi // source: <output> availability - http://html5doctor.com/the-output-element/ document.writeln( 'The HTML5 APIs used in this form are only available in the following browsers:
' ); // 6.0 File API & 13.0 <output> document.writeln(' - Google Chrome: 13.0 or later
'); // 3.6 File API & 6.0 <output> document.writeln(' - Mozilla Firefox: 6.0 or later
'); // 10.0 File API & 10.0 <output> document.writeln( ' - Internet Explorer: Not supported (partial support expected in 10.0)
' ); // ? File API & 5.1 <output> document.writeln(' - Safari: Not supported
'); // ? File API & 9.2 <output> document.writeln(' - Opera: Not supported'); return false; } }
function handleFileSelect(evt) { var files = evt.target.files; // FileList object file = files[0]; printTable(file); }
function printTable(file_input) { var reader = new FileReader(); reader.readAsText(file_input); reader.onload = function (event) { if (y == 0) { upload_data[0] = event.target.result; clearTimeout(y); } else { upload_data.push(event.target.result); clearTimeout(y); } y += 1; } }
function Mapper(seqs, opts) { var ops = []; var ops_name = [];
mapping_order.forEach(function(seq){ ops.push(seqs[seq]); if (opts[seq] == "paste" || opts[seq] == "upload"){ ops_name.push("custom "+seq); } else { ops_name.push(opts[seq]); } });
var data_length = ops[4].length; if(angularLoaded==false){ $.getScript("https://2017.igem.org/Template:Heidelberg/angularplasmidmin/JS?action=raw&ctype=text/javascript"); angularLoaded = true; } var a = 0; for (var k = 0; k < 5; k++) { window['Standard' + k] = ops[k].length; }; var array_inserts = [0, Standard0, Standard0, Standard0 + Standard1, Standard0 + Standard1, Standard0 + Standard1 + Standard2, Standard0 + Standard1 + Standard2, Standard0 + Standard1 + Standard2 + Standard3, Standard0 + Standard1 + Standard2 + Standard3, Standard0 + Standard1 + Standard2 + Standard3 + Standard4 ];
for (var i = 0; i < 5; i++) { window['marker' + i] = ops_name[i]; for (var j = 0; j < 2; j++) { window['track' + i + j] = array_inserts[a]; a += 1; } } // concatenate strings var Concat_Ops = ""; for (var l = 0; l < 5; l++) { Concat_Ops += ops[l];
}
var inst_names = {}; mapping_order.forEach(function(seq){ if (opts[seq] == "paste" || opts[seq] == "paste"){ inst_names[seq] = "your custom "+seq+" sequence"; } else { inst_names[seq] = opts[seq]; } });
download('plasmid.fa', ">"+ops_name.join(separator="|")+"|custom plasmid designed using the Heidelberg iGEM 2017 team toolbox\n"+Concat_Ops);
var sequencelength = ops[0].length + ops[1].length + ops[2].length + ops[3].length + ops[4].length; var tracklabel_up = 'Your circuit'; var tracklabel_down = sequencelength.toString();
html = '<plasmid sequencelength="' + sequencelength + '" plasmidheight="600" plasmidwidth="600" id="plasmid_svg">' + '<plasmidtrack trackstyle="fill:#ccc" width="5" radius="220"></plasmidtrack>' + '<plasmidtrack trackstyle="fill:rgba(225,225,225,0.5)" radius="210">' + '<tracklabel text="' + tracklabel_up + '" labelstyle="font-size:40px;font-weight:400;" id="tracklabel_up"></tracklabel>' + '<tracklabel text="' + tracklabel_down + ' bp" labelstyle="font-size:20px;" vadjust="20" id="tracklabel_down"></tracklabel>' +
+ '<trackmarker start="' + track00 + '" end="' + track01 + '" markerstyle="fill:#ffd700" arrowendlength="3" arrowstartlength="-3">' + '<markerlabel type="path" class="mdlabel white" text="' + marker0 + '"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track10 + '" end="' + track11 + '" markerstyle="fill:#fbb74b" arrowendlength="3" arrowstartlength="-3">' + '<markerlabel type="path" class="mdlabel white" text="' + marker1 + '"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track20 + '" end="' + track21 + '" markerstyle="fill:#bb5651" arrowendlength="3" arrowstartlength="-3">' + '<markerlabel type="path" class="mdlabel white" text="' + marker2 + '"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track30 + '" end="' + track31 + '" markerstyle="fill:#66BDBE" arrowendlength="3" arrowstartlength="-3">' + '<markerlabel type="path" class="mdlabel white" text="' + marker3 + '"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track40 + '" end="' + track41 + '" markerstyle="fill:#6698BE" arrowendlength="3" arrowstartlength="-3">' + '<markerlabel type="path" class="mdlabel white" text="' + marker4 + '"></markerlabel>' + '</trackmarker>' +
+ '<trackmarker start="' + track00 + '" wadjust="20" id="track00">' + '<markerlabel class="smlabel gold" text="' + track00 + 'bp" vadjust="30" id="marker00"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track01 + '" wadjust="20" id="track10">' +
'</trackmarker>' + '<trackmarker start="' + track10 + '" wadjust="20" id="track01">' + '<markerlabel class="smlabel purple" text="' + track10 + 'bp" vadjust="40" id="marker01"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track11 + '" wadjust="20" id="track11">' +
'</trackmarker>' + '<trackmarker start="' + track20 + '" class="boundary" wadjust="20" id="track02">' + '<markerlabel class="smlabel blue" text="' + track20 + 'bp" vadjust="50" id="marker02"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track21 + '" wadjust="20" id="track12">' +
'</trackmarker>' + '<trackmarker start="' + track30 + '" wadjust="20" id="track03">' + '<markerlabel class="smlabel blue" text="' + track30 + 'bp" vadjust="40" id="marker03"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track31 + '" wadjust="20" id="track13">' +
'</trackmarker>' + '<trackmarker start="' + track40 + '" wadjust="20" id="track04">' + '<markerlabel class="smlabel gold" text="' + track40 + 'bp" vadjust="40" id="marker04"></markerlabel>' + '</trackmarker>' + '<trackmarker start="' + track41 + '" wadjust="20" id="track14">' +
'</trackmarker>' +
+ '<trackscale interval="100" style="stroke:#999" direction="in" ticksize="3"></trackscale>' + '<trackscale interval="100" style="stroke:#999" ticksize="3"></trackscale>' + '<trackscale interval="400" style="stroke:#393939" direction="in" showlabels="1" labelstyle="fill:#999;stroke:none;text-anchor:middle;alignment-baseline:middle;font-size:10px"></trackscale>' + '</plasmidtrack>' + '</plasmid>'; $("#plasmid_container").append(html); $("#results_area").slideDown(); }
function download(filename, text) { var element = document.createElement('a'); element.setAttribute('href', 'data:text/plain;charset=utf-8,' + encodeURIComponent(text)); element.setAttribute('download', filename);
element.style.display = 'none'; document.body.appendChild(element);
element.click();
document.body.removeChild(element); }