Cas9 & Cpf1 secretion
and activity
(50 intermediate revisions by the same user not shown) | |||
Line 130: | Line 130: | ||
margin-bottom: 30px; | margin-bottom: 30px; | ||
} | } | ||
+ | |||
+ | .slick-slide { opacity: 0.6; } | ||
+ | .slick-current { opacity: 1; z-index: 10; } | ||
.slick-dots | .slick-dots | ||
Line 215: | Line 218: | ||
} | } | ||
− | .dx-popover-wrapper { z-index: 1 !important; } | + | /*.dx-popover-wrapper { z-index: 1 !important; }*/ |
</style> | </style> | ||
Line 238: | Line 241: | ||
-webkit-tap-highlight-color: transparent; | -webkit-tap-highlight-color: transparent; | ||
} | } | ||
+ | |||
+ | .slick-slider .slick-slide { transition: opacity 0.5s !important; } | ||
.slick-list | .slick-list | ||
Line 463: | Line 468: | ||
background: #0096ff; | background: #0096ff; | ||
overflow: hidden; | overflow: hidden; | ||
− | z-index: | + | z-index: 2500; |
line-height: 100%; | line-height: 100%; | ||
} | } | ||
Line 678: | Line 683: | ||
</div> | </div> | ||
<div class="section" data-url="interlab-study"> | <div class="section" data-url="interlab-study"> | ||
− | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/ | + | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/e/ec/Uu_interlab.png"></div> |
<div class="text">InterLab study participation</div> | <div class="text">InterLab study participation</div> | ||
<div class="desc">Results and details of our measurements for the iGEM 2017 InterLab Study.</div> | <div class="desc">Results and details of our measurements for the iGEM 2017 InterLab Study.</div> | ||
Line 724: | Line 729: | ||
</div> | </div> | ||
<div class="section" data-url="achievements"> | <div class="section" data-url="achievements"> | ||
− | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/ | + | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/a/a5/Uuachievements_bestest.png"></div> |
<div class="text">Achievements</div> | <div class="text">Achievements</div> | ||
<div class="desc">A short description of all that we have achieved during our participation in the iGEM.</div> | <div class="desc">A short description of all that we have achieved during our participation in the iGEM.</div> | ||
</div> | </div> | ||
<div class="section" data-url="attributions"> | <div class="section" data-url="attributions"> | ||
− | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/ | + | <div class="thumb"><img height="100" src="https://static.igem.org/mediawiki/2017/2/28/Uucollab1_attributions.png"></div> |
<div class="text">Attributions</div> | <div class="text">Attributions</div> | ||
<div class="desc">A thank-you for everyone that assited us, both in and outside the lab.</div> | <div class="desc">A thank-you for everyone that assited us, both in and outside the lab.</div> | ||
Line 757: | Line 762: | ||
<script id="page-home" type="text/template"><!-- | <script id="page-home" type="text/template"><!-- | ||
+ | <div style="position: absolute;top: 0;right: -250px;width: 200px;text-align: center;border: 1px solid gold;padding: 10px;border-radius: 10px;box-sizing: border-box;background: #ffedb8;"> | ||
+ | <div style=" | ||
+ | font-weight: bold; | ||
+ | font-size: 20px; | ||
+ | color: #c48b00; | ||
+ | border-bottom: 1px solid #ffd700; | ||
+ | padding-bottom: 15px; | ||
+ | margin-bottom: 15px; | ||
+ | ">Awards</div> | ||
+ | <img width="100" src="https://static.igem.org/mediawiki/2017/thumb/a/a2/UU_gold_medal.png/240px-UU_gold_medal.png"><br><div style="font-size: 15px;color: #c48b00; border-bottom: 1px solid #ffd700; padding-bottom: 15px; margin-top: 5px;">Gold medal</div> | ||
+ | <div style="margin-top: 15px; margin-bottom: 10px; font-size: 15px;color: #c48b00;"><b>Nominated</b><br />Best integrated human practices</div> | ||
+ | </div> | ||
+ | |||
<div class="page-heading">The OUTCASST two-component system</div> | <div class="page-heading">The OUTCASST two-component system</div> | ||
− | This year | + | This year is the debut year for the Utrecht University iGEM team. Our team has developed an easy to use and cheap DNA detection kit for disease diagnosis in areas of the world where advanced diagnostic technologies are not available. We call our system ‘OUTCASST’, which stands for ‘Out-of-cell Crispr-Activated Sequence-specific Signal Transducer’. |
− | + | ||
− | + | ||
<br /> | <br /> | ||
<br /> | <br /> | ||
+ | <video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/7/7c/UU_outcasst_movie_poster.png" controls> | ||
+ | <source src="https://static.igem.org/mediawiki/2017/3/33/UU-iGEM_anim_final_1.mp4" type='video/mp4'/> | ||
+ | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
+ | </video> | ||
+ | |||
+ | <br><br> | ||
+ | |||
<h2 class="subhead" id="subhead-2">The problem</h2> | <h2 class="subhead" id="subhead-2">The problem</h2> | ||
Disease diagnosis is of great importance for healthcare. | Disease diagnosis is of great importance for healthcare. | ||
− | In developing countries, diagnoses are often based on limited information, even though accurate disease determination based on pathogen specific DNA is possible through sequencing technologies. These technologies, however, require specialised equipment and expertise that simply is not available | + | In developing countries, diagnoses are often based on limited information, even though accurate disease determination based on pathogen specific DNA is possible through sequencing technologies. These technologies, however, require specialised equipment and expertise that simply is not available in developing parts of the world. |
− | + | The OUTCASST two-component system and detection kit was designed to alleviate this problem. | |
<center> | <center> | ||
Line 777: | Line 800: | ||
<div id="popover-1" style="display: none;"> | <div id="popover-1" style="display: none;"> | ||
− | + | First, guide RNA (gRNA) needs to be added, which is complementary to the DNA sequence you want to detect. | |
<br> | <br> | ||
<br> | <br> | ||
Line 784: | Line 807: | ||
<div id="popover-2" style="display: none;"> | <div id="popover-2" style="display: none;"> | ||
− | + | dCas9 and dCpf1 will bind their corresponding gRNA. | |
<br> | <br> | ||
<br> | <br> | ||
Line 791: | Line 814: | ||
<div id="popover-3" style="display: none;"> | <div id="popover-3" style="display: none;"> | ||
− | + | DNA from the sample that matches the gRNA will first bind to one of the proteins. | |
<br> | <br> | ||
<br> | <br> | ||
Line 798: | Line 821: | ||
<div id="popover-4" style="display: none;"> | <div id="popover-4" style="display: none;"> | ||
− | + | Once the DNA fragment binds the other protein, the system will co-localize. This allows the protease to release the transcription factor from the complex, resulting in an intracellular signal. | |
<br> | <br> | ||
<br> | <br> | ||
Line 821: | Line 844: | ||
<h2 class="subhead" id="subhead-3">The system</h2> | <h2 class="subhead" id="subhead-3">The system</h2> | ||
− | The OUTCASST two-component system consists of two | + | The OUTCASST two-component system consists of two synthetic receptors that span the membrane. |
One of the proteins has a Cas9 protein attached as an extracellular domain, the other has a Cpf1 protein attached. | One of the proteins has a Cas9 protein attached as an extracellular domain, the other has a Cpf1 protein attached. | ||
Both proteins can be given a guide RNA that makes them bind to a specific, user-chosen, complementary sequence. | Both proteins can be given a guide RNA that makes them bind to a specific, user-chosen, complementary sequence. | ||
− | When both proteins bind a single DNA fragment from a sample, possibly containing pathogen DNA, they co-localize, so that a protease releases a transcription factor which then induces an intracellular reporter mechanism | + | When both proteins bind a single DNA fragment from a sample, possibly containing pathogen DNA, they co-localize, so that a protease releases a transcription factor which then induces an intracellular reporter mechanism such as a luminescent or fluorescent signal. |
+ | <br><br> | ||
+ | A final product would include the use of so-called anhydrobiotic insect <i>Polypedilum vanderplanki</i> cells, which can be air-dried, allowing them to be stored for prolonged periods of time at room temperature. The OUTCASST system is cheap to produce, store and ship, and requires nothing more then a simple microscope as a readout. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
<script type="text/javascript" language="JavaScript"> | <script type="text/javascript" language="JavaScript"> | ||
function tut_goto(step) | function tut_goto(step) | ||
Line 836: | Line 873: | ||
{ | { | ||
jQuery("#link-" + i).removeClass("selected"); | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#link-" + i).removeClass("pulsing"); | ||
jQuery("#popover-" + i).dxPopover("hide"); | jQuery("#popover-" + i).dxPopover("hide"); | ||
jQuery("#figure-" + i).fadeOut("5"); | jQuery("#figure-" + i).fadeOut("5"); | ||
Line 857: | Line 895: | ||
{ | { | ||
jQuery("#link-" + i).removeClass("selected"); | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#link-" + i).removeClass("pulsing"); | ||
jQuery("#popover-" + i).dxPopover("hide"); | jQuery("#popover-" + i).dxPopover("hide"); | ||
jQuery("#figure-" + i).fadeOut("5"); | jQuery("#figure-" + i).fadeOut("5"); | ||
Line 886: | Line 925: | ||
var title; | var title; | ||
− | if(i == 1) | + | /*if(i == 1) |
title = "Guide RNA"; | title = "Guide RNA"; | ||
else if(i == 2) | else if(i == 2) | ||
Line 892: | Line 931: | ||
else if(i == 3) | else if(i == 3) | ||
title = "Signal transduction"; | title = "Signal transduction"; | ||
+ | else if(i == 4) | ||
+ | title = "Signal transduction";*/ | ||
+ | |||
+ | if(i == 1) | ||
+ | title = "Start"; | ||
+ | else if(i == 2) | ||
+ | title = "gRNA binding"; | ||
+ | else if(i == 3) | ||
+ | title = "DNA binding"; | ||
else if(i == 4) | else if(i == 4) | ||
title = "Signal transduction"; | title = "Signal transduction"; | ||
Line 959: | Line 1,007: | ||
<script id="page-secretion" type="text/template"> | <script id="page-secretion" type="text/template"> | ||
<div class="page-heading">Secreting functional Cas9 and Cpf1</div> | <div class="page-heading">Secreting functional Cas9 and Cpf1</div> | ||
− | In | + | |
+ | In the OUTCASST system, our two DNA-sensing elements (dCas9 and dCpf1) are extracellularly fused to transmembrane proteins (see <a onclick="return change_page('outcasst', 1)" href="outcasst">OUTCASST system production</a>). | ||
+ | However, for proteins to reach the cell membrane, they have to pass through the Endoplasmic Reticulum and the Golgi apparatus <i class="ref" data-id="1">1</i>. The chemical environment inside these organelles differs greatly from that of the cytosol. This includes the possibility of glycosylation and disulfide bond formation to occur. For a functional OUTCASST, dCas9 and dCpf1 need to be able to pass through the secretion pathway, and still be able to bind gRNA complementary DNA afterwards. | ||
<br><br> | <br><br> | ||
<h2 class="subhead" id="subhead-2">Introduction</h2> | <h2 class="subhead" id="subhead-2">Introduction</h2> | ||
− | + | With these experiment, we aim to make HEK293t cells secrete Cas9 and Cpf1 into their growth medium. Subsequently, we will purify these secreted proteins and attempt to verify that they are still functional by performing an endonuclease assay. The proteins have maintained their DNA binding and cleaving capabilities if the proteins are still able to cut DNA strands in the correct place. If this is so, the catalytically inactive versions that form OUTCASST’s extracellular domains can be used in the final system, for we can then be sure that the secretory pathway does not disturb its DNA binding properties. | |
<br><br> | <br><br> | ||
− | |||
− | + | To get the proteins into the ER, an N-terminal signal peptide sequence needs to be introduced to the protein coding sequence. For this, the Ig lambda-2 chain V region signal sequence will be used, which is also used by Daringer et al. in their Modular Extracellular Sensor Architecture <i class="ref" data-id="2">2</i>. | |
+ | <br><br><b>LINK (head) to MESA</b> | ||
+ | |||
<br><br> | <br><br> | ||
− | + | ||
+ | To be able to purify the secreted proteins from growth medium, a C-terminal His-tag with glycine linker (GGGHHHHHH) was added. Using this, it would be possible to purify the proteins using Ni-NTA affinity chromatography. Cas9 and Cpf1 containing the signal sequence and His-tag will henceforth be referred to as sCas9 and sCpf1, respectively. | ||
+ | |||
<br><br> | <br><br> | ||
− | < | + | <h2 class="subhead" id="subhead-3">Methods</h2> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
+ | <b>Secretion, glycosylation and disulfide bond prediction</b> | ||
<br> | <br> | ||
+ | The signal sequence and His-tag were attached to Cas9 and Cpf1 in silico. The amino acid sequences were entered into the SignalP 4.1 server <i class="ref" data-id="3">3</i> to predict where the signal sequence would be cleaved off. | ||
− | < | + | <br><br> |
− | < | + | |
− | < | + | The amino acids sequences were also entered in the NetNGlyc 1.0 Server <i class="ref" data-id="4">4</i>, which predicts N-glycosylation sites based on the known motif (Asn-X-Ser/Thr-Ser/Thr), and also on the DiANNA 1.1 web server <i class="ref" data-id="5">5</i>, to highlight the cysteines and their likelihood to form disulfide bonds. |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | </ | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<br><br> | <br><br> | ||
− | + | The predicted N-glycosylation sites were marked on crystal structures of both Cas9 and Cpf1 using PyMol <i class="ref" data-id="6">6</i> to get a clear image of where these sites would be and to clarify the likelihood that glycosylation would disturb protein functionality. | |
− | + | ||
− | + | ||
<br><br> | <br><br> | ||
− | + | ||
− | + | <b>Creating the DNA constructs</b> | |
+ | <br> | ||
+ | DNA sequences coding for Cas9 and Cpf1 were modified to contain an N-terminal signal sequence (removing the first methionine from Cas9 and Cpf1) and a C-terminal His-tag. A kozak sequence was placed in front of the protein coding region, to help initiate the translation process in mammalian cells. This was then placed in a backbone plasmid (pCAGGS). These plasmids were subsequently amplified in <i>E. coli</i>. See the supplementary information for cloning procedures and plasmid sequences. | ||
<br><br> | <br><br> | ||
− | + | <b>HEK293t transfection</b> | |
− | + | <br> | |
− | + | HEK293t cells were cultured according to our cell culture protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/2e/UU_Cell_culture_protocol.pdf" class="pdf pdf-inline"></a>. | |
− | + | The cells were transfected with plasmids according to the Lipofectamine 2000 transfection protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/17/UU_-_Lipofectamine_2000_transfection_protocol.pdf" class="pdf pdf-inline"></a>. | |
<br><br> | <br><br> | ||
− | + | ||
− | + | <b>Verifying the presence of secreted proteins</b> | |
− | + | <br> | |
+ | Medium and cells were harvested three days after transfection. | ||
+ | Protein from the medium and cell lysates were purified under denaturing conditions using Ni-bead purification, | ||
+ | according to a purification protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/41/Purification_of_cells_and_medium_secreted_cpf1_and_cas9.pdf" class="pdf pdf-inline"></a>. | ||
+ | In a duplicate experiment, protein from medium and cell lysate was purified under native conditions according to a | ||
+ | different purification protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/cc/UU_-_purifying_under_native_conditions.pdf" class="pdf pdf-inline"></a>. | ||
<br><br> | <br><br> | ||
− | + | The presence of sCas9 and sCpf1 in medium, cell lysate and after purification steps was verified with SDS-PAGE and Western Blots. | |
− | + | Proteins were separated using SDS-PAGE using a standard SDS-PAGE and blotting protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/a/ab/General_Protocol_SDS-PAGE_Western_Blot.pdf" class="pdf pdf-inline"></a>. | |
+ | Polyacrylamide running and stacking gels were made according to standard recipes <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b1/Preparing_SDS-PAGE_gels.pdf" class="pdf pdf-inline"></a>. | ||
+ | Western Blots were carried out according to the same procedure as SDS-PAGE. | ||
+ | <br><br> | ||
+ | Subsequently, the blotting membranes were incubated with anti-his antibodies originating from a mouse at 1:2000 dilution or with anti-Cas9 and anti-Cpf1 antibodies, | ||
+ | both originating from rabbit, also at 1:2000 dilution. | ||
+ | Secondary antibodies containing a horseradish peroxidase (HRP) conjugate (1:10 000 dilution) were used to verify the presence of | ||
+ | secreted proteins by the detection of chemiluminescence. | ||
+ | <br><br> | ||
+ | Additionally, together with team Wageningen_UR a final experiment was done to verify that the protein in the medium was indeed secreted instead of due to involuntary cell lysis (see <a onclick="return change_page('collaborations', 1)" href="collaborations">Collaborations</a>). | ||
+ | This experiment was done in duplo, by members from both team Wageningen_UR and team Utrecht, individually, to provide independent verification of the result. This final experiment was done according to a collaboration protocol that was shared with the Wageningen_UR team <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/40/UuProtocolCollaborationWageningen.pdf" class="pdf pdf-inline"></a>. | ||
+ | <br><br> | ||
+ | <b>Endonuclease activity assay</b> | ||
+ | <br> | ||
+ | An in vitro endonuclease activity assay was performed twice; first using purified Cas9 and Cpf1 (supplied to us by Geijsen lab), | ||
+ | to test which gRNA concentrations are optimal for the assay. The second endonuclease activity assay was performed using purified sCas9 and sCpf1, as well as Cas9 and Cpf1. | ||
+ | <br><br> | ||
+ | Cas9 gRNA was prepared from DNA oligos according to a gRNA production protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/8/8d/UU_-_Nuclease_activity_assay_-_Cas9_gRNA_production.pdf" class="pdf pdf-inline"></a>. | ||
+ | Cpf1 gRNA was ordered from IDT, as it proved too short for synthesis according to the aforementioned protocol. A linearized plasmid of approximately 800 base pairs was used as template, with sRNAs complementary to roughly the same region of the linearized plasmid. This would result in two cut fragments of ~260 base pair and ~560 base pair lengths for both Cas9 and Cpf1 cleavage. | ||
+ | <br><br> | ||
+ | The first assay was performed according to protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/12/Nuclease_activity_assay_-_assay_UU.pdf" class="pdf pdf-inline"></a>. An adjusted protocol was used for the second assay, due to low concentrations of purified sCas9 and sCpf1 <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/13/UU_-_Nuclease_activity_assay_-_assay2.pdf" class="pdf pdf-inline"></a>. See the supplementary information for cloning procedures and sequences. | ||
<br><br> | <br><br> | ||
<h2 class="subhead" id="subhead-4">Results</h2> | <h2 class="subhead" id="subhead-4">Results</h2> | ||
− | + | <b>Secretion, glycosylation and disulfide bond prediction</b> | |
− | + | ||
<br> | <br> | ||
− | + | SignalP 4.1 predicted cleavage right after the signal sequence for both sCas9 and sCpf1. The results of the prediction can be found here <a target=_BLANK href="https://static.igem.org/mediawiki/2017/9/97/UU_-_SignalP_results.pdf" class="pdf pdf-inline"></a>. | |
− | < | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<br><br> | <br><br> | ||
+ | Six N-glycosylation motifs were detected in Cas9, of which five had a high probability of being N-glycosylated. In Cpf1, four motifs were detected, three of which had a high glycosylation probability. | ||
+ | <br><br> | ||
+ | <center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/4/4a/UU_fig1_-_Glycosylation_sites.PNG"></center> | ||
+ | <span class="text-figure"><b>Figure 1. Glycosylations sites in Cas9 and Cpf1.</b> Predicted N-glycosylation sites are marked red in the crystal structures of Cas9 (PDB: 4OO8) and Cpf1 (PDB: 5B43). N-terminus is marked purple, C-terminus is marked yellow, gRNA is shown in orange and the bound DNA is shown in green. | ||
+ | </span> | ||
− | + | <br><br> | |
− | + | Two cysteines were marked as having a high chance of forming disulfide bonds in Cas9, while eight such cysteines were found in Cpf1. Details can be found in the supplementary information. | |
+ | <br><br> | ||
+ | <b>Creating the DNA constructs</b><br> | ||
+ | All constructs were verified by sequencing. | ||
+ | <br><br> | ||
+ | <b>Verifying the presence of secreted proteins</b><br> | ||
+ | <center><img style="margin-top: 10px; width: 400px;" src="https://static.igem.org/mediawiki/2017/c/cf/UU_fig2_-_western_under_denaturing_conditions.png"></center> | ||
+ | <span class="text-figure"><b>Figure 2. Western Blot using protein purified under denaturing conditions.</b> A band at the correct height is present in the lanes containing purified sCas9 and sCpf1 from the medium, indicating presence of sCas9 and sCpf1 in the medium. | ||
+ | </span> | ||
+ | <br><br> | ||
+ | Figure 2 shows the presence of sCas9 and sCpf1 in the medium, which indicated the proteins are secreted and that the experiment could be redone under native conditions but only small quantities of protein could be purified (~0,5 ng/uL in 0,5 mL for both sCas9 and sCpf1). | ||
+ | <br><br> | ||
+ | <center><img style="margin-top: 10px; width: 450px;" src="https://static.igem.org/mediawiki/2017/d/de/UU_fig3_-_western_under_native_conditions.png"></center> | ||
+ | <span class="text-figure"><b>Figure 3. Western Blot using protein purified under native conditions.</b> The left image shows samples from cells transfected with a sCas9 containing plasmid, incubated with Anti-Cas9. The right image shows samples transfected with a sCpf1 containing plasmid, incubated with a Cpf1 antibody.The images suggest that sCas9 and sCpf1 are indeed secreted into the medium, though it cannot be excluded that part of the protein in the media is due to cell lysis. | ||
+ | </span> | ||
+ | <br><br> | ||
+ | After newly expressing sCas9 and sCpf1 in HEK293t cells, blots of the Cpf1 protein (figure 4) displayed the presence of secreted Cpf1 in both medium and cell lysate. In the medium, two bands are shown, one with a lower mass than Cpf1 is supposed to have. This lower band is, ostensibly, a degradation product. In the cell lysate, we see a second band as well, this time of higher mass. We suspect that this band corresponds to glycosylation product that accumulates in the cells and cannot be secreted. The results from the Wageningen_UR team confirm the presence of sCpf1 in both cell lysate and medium, as expected, again showing a lower mass band for the protein in the medium. | ||
+ | <br><br> | ||
+ | <center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/0/0e/UU-secretion-fig4.png"></center> | ||
+ | <span class="text-figure"><b>Figure 4. Secretion products of Cpf1.</b> The left image displays the blotting results of Utrecht’s team. The right image displays the blotting results of our Wageningen_UR collaborators. sCpf1 is shown on both blots, displaying two bands. Cell lysates of sCpf1 producing cells display sCpf1 as well. | ||
+ | </span> | ||
− | + | <br><br> | |
− | <br> | + | <b>Endonuclease activity assay</b><br> |
− | <img src="https://static.igem.org/mediawiki/2017/ | + | The first endonuclease activity assay was used to determine the optimal concentration of gRNA for the assay with the secreted proteins. The concentrations used were all functional for the Cpf1 protein (Figure 5, left pane). Cas9 however, showed no cleavage of the targeted DNA at all. This may be due to low quality gRNA. In the second assay, which contained sCas9 and sCpf1 purified from medium, there was no cleavage visible at all, even for the controls with Cas9 and Cpf1, as shown in figure 5 (right pane). |
− | < | + | <center><img style="margin-top: 25px;" src="https://static.igem.org/mediawiki/2017/f/fc/UU_secretion_fig5.png"></center> |
− | Figure | + | <span class="text-figure"> |
+ | <b>Figure 5.</b> Left - DNA gel electrophoresis of a linearized 800 base pair length plasmid. Concentrations of Cas9 and Cpf1 used in the assay were 0,05 uM and 0,15 uM, respectively. Right - DNA gel electrophoresis of the linearized 800bp plasmid. 2,5 nM Cas9 or Cpf1 protein was used and 10 nM gRNA. | ||
+ | </span> | ||
<br><br> | <br><br> | ||
− | + | <h2 class="subhead" id="subhead-5">Discussion</h2> | |
− | + | The goal of this experiment was to create secretable Cas9 and Cpf1 and test the functionality of these proteins. We have a clear indication that we achieved in obtaining secretion product, demonstrated by figures 2,3 and the collaboration results. Even if cell death has contributed to the protein concentrations in the media at all, it seems unlikely that it could account for a majority of the product. This, in addition to the lack of cell debris in the culturing plates, leads us to believe that the proteins can indeed be secreted. | |
− | + | <br><br> | |
− | <br> | + | As of yet, we have not been able to demonstrate nuclease activity for either sCas9 or sCpf1. In our nuclease assay with the secreted proteins, the substrate was not cleaved. Even the control proteins did not show cleavage, suggesting that something went wrong with the assay. This lack of cleavage could be due to the low concentrations of protein purification product. In this assay, the incubation time was increased in comparison to standard endonuclease assay protocols to compensate for the low purification yields. Poor quality gRNA could also have caused the lack of cleavage. For future research, we suggest gRNA verification is performed before the assay is attempted. Based on our predictions for glycosylation, it seems likely that sCas9 and sCpf1 are still enzymatically active, even though some optimization might be required to gain satisfactory cleavage efficiency. |
− | + | <br><br> | |
+ | Versions of Cas9 and Cpf1 that can pass through the secretion pathway and maintain their DNA binding capabilities are essential for the OUTCASST system. The secretable sCas9 and sCpf1 proteins have merit on their own as well. A system where Cas9 and Cpf1 are made and secreted by mammalian cells could be useful for production of clinically usable endonucleases. Bacterial production may, at first glance, seem more straightforward but poses problems of clinical purity as bacterial endotoxins can easily contaminate the protein. Production of these proteins in mammalian cells could circumvent this problem. | ||
+ | |||
<br><br> | <br><br> | ||
− | + | <h2 class="subhead" id="subhead-6">References</h2> | |
− | < | + | |
− | < | + | <ol class="references"> |
− | < | + | <li data-title="Molecular Cell Biology." data-author="Lodish H, Berk A, Zipursky SL, et al. Molecular Cell Biology." data-link="https://www.ncbi.nlm.nih.gov/books/NBK21471/" /> Lodish H, Berk A, Zipursky SL, et al. Molecular Cell Biology. 4th edition. New York: W. H. Freeman; 2000. Section 17.3, Overview of the Secretory Pathway. <a target=_BLANK href="https://www.ncbi.nlm.nih.gov/books/NBK21471/" class="url_external"></a> |
− | + | <li data-title="Modular Extracellular sensor architecture for engineering mammalian cell-based devices." data-author="Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N." data-link="https://doi.org/10.1021/sb400128g" /> Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N. (2014). Modular Extracellular sensor architecture for engineering mammalian cell-based devices. ACS Synthetic Biology, 3(12), 892–902. <a target=_BLANK href="https://doi.org/10.1021/sb400128g" class="url_external"></a> | |
− | < | + | <li data-title="SignalP 4.0: discriminating signal peptides from transmembrane regions." data-author="Petersen, T.N., Brunak, S., Von Heijne, G. & Nielsen, H." data-link="http://www.cbs.dtu.dk/services/SignalP/" /> Petersen, T.N., Brunak, S., Von Heijne, G. & Nielsen, H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods, 8:785-786, 2011. <a target=_BLANK href="http://www.cbs.dtu.dk/services/SignalP/" class="url_external"></a> |
− | < | + | <li data-title="Prediction of N-glycosylation sites in human proteins." data-author="Gupta, R., Jung, E. and Brunak, S." data-link="http://www.cbs.dtu.dk/services/NetOGlyc/" /> Gupta, R., Jung, E. and Brunak, S. Prediction of N-glycosylation sites in human proteins. In preparation, 2004. <a target=_BLANK href="http://www.cbs.dtu.dk/services/NetOGlyc/" class="url_external"></a> |
− | < | + | <li data-title="DiANNA 1.1: an extension of the DiANNA web server for ternary cysteine classification." data-author="Ferre, F. & Clote, P." data-link="http://clavius.bc.edu/~clotelab/DiANNA/" /> Ferre, F. & Clote, P. DiANNA 1.1: an extension of the DiANNA web server for ternary cysteine classification. Accepted for publication in Nucleic Acids Res. - Web Servers 2006 special issue. <a target=_BLANK href="http://clavius.bc.edu/~clotelab/DiANNA/" class="url_external"></a> |
− | < | + | <li data-title="The PyMOL Molecular Graphics System." data-author="Schrödinger, LLC." data-link="https://pymol.org/2/" /> The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC. <a target=_BLANK href="https://pymol.org/2/" class="url_external"></a> |
− | + | </ol> | |
+ | |||
+ | <span id="tooltip-1"></span> | ||
+ | <span id="tooltip-2"></span> | ||
+ | <span id="tooltip-3"></span> | ||
+ | <span id="tooltip-4"></span> | ||
+ | <span id="tooltip-5"></span> | ||
+ | <span id="tooltip-6"></span> | ||
+ | |||
<br><br> | <br><br> | ||
− | <h2 class="subhead" id="subhead- | + | <h2 class="subhead" id="subhead-7">Supplementary</h2> |
− | + | ||
+ | <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/c2/UU_-_Supplementary_info_-_Secreting_functional_Cas9_and_Cpf1.pdf" class="pdf">Supplementary information - Secreting functional Cas9 and Cpf1.</a> | ||
+ | |||
</script> | </script> | ||
Line 1,111: | Line 1,169: | ||
<div class="page-heading">MESA construct replication</div> | <div class="page-heading">MESA construct replication</div> | ||
− | The architecture we use for OUTCASST is inspired by the Modular Extracellular Sensor Architecture (MESA) | + | The architecture we use for OUTCASST is inspired by the Modular Extracellular Sensor Architecture (MESA) <i class="ref" data-id="1">1</i> <i class="ref" data-id="2">2</i>. Because of this, MESA first needed to be replicated to verify whether the final product could work as intended. |
A successful replication is required for OUTCASST to work, and to provide data that we can use to compare and correct models of the system. | A successful replication is required for OUTCASST to work, and to provide data that we can use to compare and correct models of the system. | ||
<br> | <br> | ||
Line 1,124: | Line 1,182: | ||
It can be used as a sensor as it has two different protein chains with, on the extracellular region, an element to cause dimerization and, on the intracellular region, a combination of a protease on one chain and a transcription factor on the other. The transcription factor can be cleaved off by the protease when the two chains dimerize, either through a ligand or randomly. Subsequently, the transcription factor travels to the nucleus where it induces transcription of a reporter (Figure 1). | It can be used as a sensor as it has two different protein chains with, on the extracellular region, an element to cause dimerization and, on the intracellular region, a combination of a protease on one chain and a transcription factor on the other. The transcription factor can be cleaved off by the protease when the two chains dimerize, either through a ligand or randomly. Subsequently, the transcription factor travels to the nucleus where it induces transcription of a reporter (Figure 1). | ||
<br> | <br> | ||
− | <img src="https://static.igem.org/mediawiki/2017/6/69/Uumesa_figure1.png"> | + | <center><img style="margin-top: 25px;" src="https://static.igem.org/mediawiki/2017/6/69/Uumesa_figure1.png"></center> |
<br> | <br> | ||
− | <b>Figure 1. | + | <span class="text-figure"> |
+ | <b>Figure 1. The MESA signalling pathway.</b> The MESA cell signalling pathway consists of a target chain (TC), a protease chain (PC) and a ligand which can bind both the extracellular domains. The TC has a transcription factor on the intracellular part of the protein, while the PC has a protease which can cleave off the aforementioned transcription factor. The ligand, in this case VEGF, binds both chains, which allows the protease to be close enough to do this. The released transcription factor subsequently travels to the nucleus to induce a reporter gene. | ||
+ | Image modified from <i class="ref" data-id="3">1</i>. | ||
+ | </span> | ||
<br><br> | <br><br> | ||
The MESA constructs that form the basis of OUTCASST, and therefore need to be verified, are V2-MESA-35F-M-tTA and V2-MESA-35F-TEV. | The MESA constructs that form the basis of OUTCASST, and therefore need to be verified, are V2-MESA-35F-M-tTA and V2-MESA-35F-TEV. | ||
Line 1,139: | Line 1,200: | ||
<h2 class="subhead" id="subhead-3">Materials</h2> | <h2 class="subhead" id="subhead-3">Materials</h2> | ||
<ul> | <ul> | ||
− | <li />V2-MESA-35F-M-tTA | + | <li />V2-MESA-35F-M-tTA <a target=_BLANK href="https://www.addgene.org/84502/" class="url_external"></a> |
− | <li />V2-MESA-35F-TEV | + | <li />V2-MESA-35F-TEV <a target=_BLANK href="https://www.addgene.org/84503/" class="url_external"></a> |
− | <li />pL3-TRE-LucGFP-2L | + | <li />pL3-TRE-LucGFP-2L <a target=_BLANK href="https://www.addgene.org/11685/" class="url_external"></a> |
− | <li />Cre reporter | + | <li />Cre reporter <a target=_BLANK href="https://www.addgene.org/62732/" class="url_external"></a> |
− | <li />pBI-MCS-EYFP | + | <li />pBI-MCS-EYFP <a target=_BLANK href="http://www.addgene.org/58855/" class="url_external"></a> |
<li />pSLQ-Set1-BFP (not on addgene) | <li />pSLQ-Set1-BFP (not on addgene) | ||
− | <li />VEGF-164 | + | <li />VEGF-164 (cat.: 583102, biolegend) |
</ul> | </ul> | ||
Line 1,161: | Line 1,222: | ||
The results of the flow cytometry analysis are shown in table 1. The GFP and YFP reporter plasmid concentrations for transfection were varied between 250 ng and 350 ng per well. After adding VEGF, GFP signal increased in all samples except for the sample containing 250 ng GFP, which showed a decrease. The cells that were transfected with a GFP concentration of 350 ng showed the greatest increase in GFP activity (9.2%). In figure 2 the FACS plots for 350 ng GFP are shown. | The results of the flow cytometry analysis are shown in table 1. The GFP and YFP reporter plasmid concentrations for transfection were varied between 250 ng and 350 ng per well. After adding VEGF, GFP signal increased in all samples except for the sample containing 250 ng GFP, which showed a decrease. The cells that were transfected with a GFP concentration of 350 ng showed the greatest increase in GFP activity (9.2%). In figure 2 the FACS plots for 350 ng GFP are shown. | ||
<br><br> | <br><br> | ||
− | <b>Table 1. | + | <span class="text-figure"> |
+ | <b>Table 1. Heatmap of the flow cytometry data.</b> The percentages shown is the relative difference of fluorescence compared to control. The colour scale has been set with a minimum of -19.4%, a midpoint of 0% and maximum of 27.1%. Overall, signal induction appears to be more efficient with the YFP plasmid, but the data is inconsistent. | ||
+ | </span> | ||
<br> | <br> | ||
− | <img width="600" src="https://static.igem.org/mediawiki/2017/7/70/Uufacsheatmap.png"> | + | <center><img style="margin-top: 10px;" width="600" src="https://static.igem.org/mediawiki/2017/7/70/Uufacsheatmap.png"></center> |
<br> | <br> | ||
<br> | <br> | ||
Line 1,171: | Line 1,234: | ||
<br><br> | <br><br> | ||
− | <img | + | <center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/0/0d/Uumesafig2_merge.png"></center> |
− | < | + | <span class="text-figure"> |
− | <b>Figure 2. | + | <b>Figure 2. FACS results for treatment with 350 ng GFP plasmid.</b> (Left) Plot before adding VEGF. (Right) Plot after adding VEGF. [GFP] is GFP activity. |
+ | </span> | ||
<br> | <br> | ||
<br> | <br> | ||
− | <img | + | <center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/5/5c/Uumesafig3_merged.png"></center> |
− | < | + | <span class="text-figure"> |
− | <b>Figure 3. | + | <b>Figure 3. FACS results for treatment with 300 ng YFP plasmid, before VEGF was added.</b> (Left) Plot before adding VEGF. (Right) Plot after adding VEGF. [Q2] is YFP activity. |
+ | </span> | ||
<br><br> | <br><br> | ||
Line 1,191: | Line 1,256: | ||
<br><br> | <br><br> | ||
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <center><img src="https://static.igem.org/mediawiki/2017/8/8c/Uumesafig4_merged.png"></center> |
− | < | + | <span class="text-figure"> |
− | <b>Figure 4. | + | <b>Figure 4. FACS results for treatment after VEGF addition.</b> (Left) with protease chain. (Right) without protease chain. [Q2] is YFP activity. |
+ | </span> | ||
<br> | <br> | ||
<br> | <br> | ||
− | <img src="https://static.igem.org/mediawiki/2017/ | + | <center><img src="https://static.igem.org/mediawiki/2017/8/8e/Uumesafig5_merged.png"></center> |
− | < | + | <span class="text-figure"> |
− | <b>Figure 5.</b> | + | <b>Figure 5. 350 ng GFP.</b> (Left) with protease chain. (Right) without protease chain. [GFP] is GFP activity. |
+ | </span> | ||
<br><br> | <br><br> | ||
Line 1,221: | Line 1,288: | ||
<br><br> | <br><br> | ||
− | <h2 class="subhead" id="subhead-7">Supplementary</h2> | + | <h2 class="subhead" id="subhead-7">References</h2> |
+ | |||
+ | <ol class="references"> | ||
+ | <li data-title="Modular extracellular sensor architecture for engineering mammalian cell-based devices." data-author="Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N." data-link="http://pubs.acs.org/doi/abs/10.1021/sb400128g" />Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N., 2014: Modular extracellular sensor architecture for engineering mammalian cell-based devices. ACS synthetic biology, 3(12), 892-902. <a target=_BLANK href="http://pubs.acs.org/doi/abs/10.1021/sb400128g" class="url_external"></a> | ||
+ | <li data-title="Rewiring human cellular input-output using modular extracellular sensors." data-author="Schwarz, K. A., Daringer, N. M., Dolberg, T. B., & Leonard, J. N." data-link="http://www.nature.com/nchembio/journal/v13/n2/abs/nchembio.2253.html?foxtrotcallback=true" />Schwarz, K. A., Daringer, N. M., Dolberg, T. B., & Leonard, J. N. 2017: Rewiring human cellular input-output using modular extracellular sensors. Nature chemical biology, 13(2), 202-209. <a target=_BLANK href="http://www.nature.com/nchembio/journal/v13/n2/abs/nchembio.2253.html?foxtrotcallback=true" class="url_external"></a> | ||
+ | </ol> | ||
+ | |||
+ | <span id="tooltip-1"></span> | ||
+ | <span id="tooltip-2"></span> | ||
+ | <span id="tooltip-3"></span> | ||
+ | |||
+ | <br><br> | ||
+ | <h2 class="subhead" id="subhead-8">Supplementary</h2> | ||
+ | |||
+ | Full schemes of sample contents and their output can be downloaded here: <a target=_BLANK href="https://static.igem.org/mediawiki/2017/7/7a/UU_MESA-replication-supplementary.pdf" class="pdf pdf-inline"></a>. | ||
</script> | </script> | ||
Line 1,248: | Line 1,329: | ||
<pre> | <pre> | ||
dCAS9 D10A fw 5’-3’: tacagcatcggcctggcaatcggcaccaactctg | dCAS9 D10A fw 5’-3’: tacagcatcggcctggcaatcggcaccaactctg | ||
− | dCAS9 D10A rv 5’-3’: | + | dCAS9 D10A rv 5’-3’: cagagttggtgccgattgccaggccgatgctgta |
dCAS9 H840A fw 5’-3’: cgactacgatgtggacgctatcgtgcctcagagc | dCAS9 H840A fw 5’-3’: cgactacgatgtggacgctatcgtgcctcagagc | ||
− | dCAs9 H840A rv 5’-3’: | + | dCAs9 H840A rv 5’-3’: gctctgaggcacgatagcgtccacatcgtagtcg |
− | dCpf1 D908A fw 5’-3’: | + | dCpf1 D908A fw 5’-3’: ctatcatcggcatcgctcggggcgagagaaa |
− | dCpf1 D908A rv 5’-3’: | + | dCpf1 D908A rv 5’-3’: tttctctcgccccgagcgatgccgatgatag |
</pre> | </pre> | ||
<br><br> | <br><br> | ||
Line 1,283: | Line 1,364: | ||
<b>Cas9 Mutagenesis</b> | <b>Cas9 Mutagenesis</b> | ||
<br> | <br> | ||
− | The miniprepped sample sent for sequencing and the results of the sequencing showed that the D10A mutation was successfully introduced to Cas9. The sequenced sample was used as a template to create the second mutation. Transformation for this product failed several times. Even with successful transformation, the concentration after miniprep was too low to send for sequencing. For the sake of time, we was decided that the DNA sequence for dCas9 would be ordered from addgene as a whole. The following plasmid, including the mutations of our design, was ordered: https://www.addgene.org/46911/. | + | The miniprepped sample sent for sequencing and the results of the sequencing showed that the D10A mutation was successfully introduced to Cas9. The sequenced sample was used as a template to create the second mutation. Transformation for this product failed several times. Even with successful transformation, the concentration after miniprep was too low to send for sequencing. For the sake of time, we was decided that the DNA sequence for dCas9 would be ordered from addgene as a whole. |
+ | The following plasmid, including the mutations of our design, was ordered: <a target=_BLANK href="https://www.addgene.org/46911/" class="url_external">https://www.addgene.org/46911/</a>. | ||
<br><br> | <br><br> | ||
Line 1,289: | Line 1,371: | ||
<br> | <br> | ||
+ | <div style="float: right; width: 200px; margin-left: 50px;"> | ||
+ | <img style="width: 100%;" src="https://static.igem.org/mediawiki/2017/thumb/7/72/Restriction_digest_dCpf1-tTa_clone_8.png/325px-Restriction_digest_dCpf1-tTa_clone_8.png"> | ||
+ | <br> | ||
+ | <span class="text-figure" style="display: inline-block; line-height: 20px;"> | ||
+ | <b>Figure 1. restriction digest of dCpf1-tTa clone 8 using BamHI and XhoI.</b> Two fragments were expected to be the result of the restriction digest, one fragment of 6635 bp and one of 4792 bp. Only one fragment of approximately 11.000 bp appeared, leading to the conclusion that the clone was not correct. | ||
+ | </span> | ||
+ | </div> | ||
After InFusion and transformation, plasmids were miniprepped and clone 2, 3, 4, 5 and 8 were sent for sequencing. Unfortunately, the sequence data looked chaotic and none of the clones were completely correct. It could have been that the DNA quality was not good enough for sequencing. Of these results, clone 8 looked the most promising and so this one was re-transformed, maxiprepped and examined with restriction digestion. | After InFusion and transformation, plasmids were miniprepped and clone 2, 3, 4, 5 and 8 were sent for sequencing. Unfortunately, the sequence data looked chaotic and none of the clones were completely correct. It could have been that the DNA quality was not good enough for sequencing. Of these results, clone 8 looked the most promising and so this one was re-transformed, maxiprepped and examined with restriction digestion. | ||
Line 1,298: | Line 1,387: | ||
Sequencing results showed that there was likely to be a mistake in the backbones of these clones that could be fixed through a PCR treatment for the backbone section with the error. This fragment could then be replaced in the construct through restriction and InFusion. | Sequencing results showed that there was likely to be a mistake in the backbones of these clones that could be fixed through a PCR treatment for the backbone section with the error. This fragment could then be replaced in the construct through restriction and InFusion. | ||
+ | |||
+ | <center><img style="margin-top: 10px;" width="600" src="https://static.igem.org/mediawiki/2017/thumb/8/80/Restriction_digest_dCpf1-tTa_attempt_2.png/800px-Restriction_digest_dCpf1-tTa_attempt_2.png"></center> | ||
+ | <span class="text-figure"> | ||
+ | <b>Figure 2. restriction digest of dCpf1-tTa clone 2, 3, 4 and 8 using BamHI and NcoI.</b> Again, none of the samples were correct. | ||
+ | </span> | ||
<br><br> | <br><br> | ||
Line 1,314: | Line 1,408: | ||
<h2 class="subhead" id="subhead-6">Supplementary</h2> | <h2 class="subhead" id="subhead-6">Supplementary</h2> | ||
− | Plasmid nanodrop results can be | + | Plasmid nanodrop results can be downloaded here: <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b1/UU_-_Assembly_supplementary.pdf" class="pdf pdf-inline"></a>. |
</script> | </script> | ||
Line 1,320: | Line 1,414: | ||
<div class="page-heading">Modeling and Mathematics</div> | <div class="page-heading">Modeling and Mathematics</div> | ||
− | The first | + | The first step we took to get a good overview of the system dynamics was to try and graphically represent the molecular interactions of the OUTCASST system in a small reaction network. |
+ | From this network we could already point out two characteristics of the OUTCASST system that are most likely to hamper sensitivity. Fortunately, we were able to find possible solutions for those problems through analysis of the network and mathematical modeling. | ||
+ | <br><br> | ||
+ | For an introduction of the OUTCASST network model, check out the video below! | ||
+ | |||
+ | <br> | ||
+ | |||
+ | <video onclick="this.paused?this.play():this.pause();" style="margin-top: 10px; width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/d/d1/UU-modelingvideo-poster.png" controls> | ||
+ | <source src="https://static.igem.org/mediawiki/2017/d/da/UuModelingVidBecauseWeDid.mp4" type='video/mp4'/> | ||
+ | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
+ | </video> | ||
<br><br> | <br><br> | ||
− | <h2 class="subhead" id="subhead-2">Optimization of the protease cleavage rate</ | + | <h2 class="subhead" id="subhead-2">False positive reduction</h2> |
− | + | ||
+ | <b>Optimization of the protease cleavage rate</b><br> | ||
+ | |||
+ | In the case of detecting pathogen DNA, the concentration of DNA or RNA will be exceedingly low and thus the number of interaction events due to substrate binding will also be small. It would be ideal if each substrate binding event would lead to cleavage while transient meetings, in the absence of substrate, between the two chains only rarely lead to cleavage. This would reduce the chance of false positive signals. Considering the great binding affinities of both Cas9 and Cpf1 for gRNA complementary DNA, binding events are much longer in duration than transient meetings of the two proteins. | ||
<br><br> | <br><br> | ||
− | In the image to the side, you can see a | + | <div style="float: left; margin-right: 35px; width: 305px;"> |
− | + | <img style="width: 100%;" src="https://static.igem.org/mediawiki/2017/2/21/UU-model-fig1.png"> | |
− | + | <br> | |
− | + | <span class="text-figure" style="display: inline-block; line-height: 20px;"> | |
− | In the real system, these values will be much | + | <b>Figure 1.</b> Fraction of remaining complex for (orange) substrate mediated binding events and (blue) transient binding events. |
+ | </span> | ||
+ | |||
+ | <br> | ||
+ | |||
+ | <img style="width: 100%; margin-top: 40px;" src="https://static.igem.org/mediawiki/2017/7/7f/UU-model-fig2.png"> | ||
+ | <br> | ||
+ | <span class="text-figure" style="display: inline-block; line-height: 20px;"> | ||
+ | <b>Figure 2.</b> Probability of cleavage occurring over time for a (orange) fast and (blue) slow cleaver. | ||
+ | </span> | ||
+ | <br> | ||
+ | <br> | ||
+ | </div> | ||
+ | In the image to the side, you can see a graphical illustration of the difference in half-life of the complex formed by transient and substrate-mediated interaction. For clarity, we have taken the half-life of transient complex as 5 arbitrary time units and that of the substrate-mediated complex is set to 100. In the real system, these values will be much further apart as the duration of DNA binding for catalytically inactive Cas9 and Cpf1 is rather long. | ||
<br><br> | <br><br> | ||
Consider two different versions of our system: one with a fast-cleaving protease and the second with a slow-cleaving protease. In the image to the left, we plotted the probability distribution of cleavage occurring over time for these two versions of our Protease Chain protein. Note that the probability that it will cleave over time will always be 1, the timespan wherein this happens simply differs. | Consider two different versions of our system: one with a fast-cleaving protease and the second with a slow-cleaving protease. In the image to the left, we plotted the probability distribution of cleavage occurring over time for these two versions of our Protease Chain protein. Note that the probability that it will cleave over time will always be 1, the timespan wherein this happens simply differs. | ||
+ | <br><br> | ||
For the mathematicians amongst those who are reading this: These plots are simple lognormal distributions, for the distribution cannot take negative values as it is impossible to cleave before the complex has been formed. | For the mathematicians amongst those who are reading this: These plots are simple lognormal distributions, for the distribution cannot take negative values as it is impossible to cleave before the complex has been formed. | ||
<br><br> | <br><br> | ||
− | + | By comparing the two figures, we can now see that the probability of cleavage for the slow cleaver is much smaller than that of the fast cleaver in the timespan that the transient complex persists. Of course, the concentration of the substrate-mediated complex decreases over time, so the total cleavage decreases when it cleaves later. To investigate how much the transient and substrate-mediated complex contribute to signal development for both Protease Chain variants, we define: | |
+ | |||
+ | <center><img height="75" src="https://static.igem.org/mediawiki/2017/b/b5/UuModelingEquation1.png"></center> | ||
+ | |||
+ | Wherein S’ is the increase in signal, given by the probability of cleavage (p<sub>c</sub>) for the remaining uncleaved complex. The remaining uncleaved complex is given by the remaining complex fraction (C) and how likely it is that it has not already been cleaved (one minus the integral of p<sub>c</sub> from 0 until that timepoint). | ||
<br><br> | <br><br> | ||
− | <b> | + | <div style="float: left; margin-right: 35px; width: 350px;"> |
+ | <img style="width: 100%;" src="https://static.igem.org/mediawiki/2017/a/a2/UU-model-fig3.png"> | ||
+ | <br> | ||
+ | <span class="text-figure" style="display: inline-block; line-height: 20px;"> | ||
+ | <b>Figure 3.</b> Signal accumulation of the slow cleaver for (orange) substrate mediated binding events and (blue) transient binding events. Note that the transient binding signal is very small. For clarity, it is displayed in the inset graph. | ||
+ | </span> | ||
+ | |||
+ | <br> | ||
+ | |||
+ | <img style="width: 100%; margin-top: 25px;" src="https://static.igem.org/mediawiki/2017/5/51/UU-model-fig4.png"> | ||
+ | <br> | ||
+ | <span class="text-figure" style="display: inline-block; line-height: 20px;"> | ||
+ | <b>Figure 4.</b> Signal accumulation of the fast cleaver for (orange) substrate mediated binding events and (blue) transient binding events. | ||
+ | </span> | ||
+ | </div> | ||
+ | When we solve this for each Protease Chain version and for both the transient and substrate-mediated complex, we end up with time-plots of the signal contribution of a single binding event. In these plots, we see that the resulting substrate-mediated complex signal for the slow cleaver (top) is about half as strong as the signal for the fast cleaver (bottom). In theory, this is not a problem since the signal can be amplified by the cells. | ||
<br><br> | <br><br> | ||
− | + | For the fast cleaver, we see a much bigger issue. The signal contribution of the transient complex, i.e. the false positive, is only about ten-fold smaller than the signal contribution of the substrate-mediated complex. Considering that transient encounters will be a lot more frequent than substrate-binding events, the false positive signal can be multiplied many times, making it a lot stronger than the substrate-mediated signal can ever be. | |
<br><br> | <br><br> | ||
− | + | This is not the case for the slower cleaver, where the transient complex signal contribution is much smaller. | |
<br><br> | <br><br> | ||
− | + | Using the contributions of a single transient binding event and a single substrate-mediated binding event, we can calculate a proxy for precision by dividing the contribution of the true signal (substrate-mediated) by the contribution of the false signal (transient). For the slow rate, the contribution of a single substrate-mediated event is almost 48,000 times that of the transient occurrence. For the fast cleavage rate, this is only 17 times. | |
<br><br> | <br><br> | ||
− | + | If we assume that the transient interaction occurs 100 times more frequently than the substrate-binding event, a modest estimate, ‘true’ signal strength would only be 0.17 times that of the background for the fast cleaver whereas it would still be 480 times stronger than the background for the slow cleaving protease. | |
<br><br> | <br><br> | ||
− | + | In conclusion, a protease with a slower cleavage rate results in a much higher signal-to-noise ratio than a fast cleaving protease results in. Thus, for increased precision and minimization of false positive results, the cleavage rate should be such that it result in a cleavage duration near the half-life of the complex between target-chain, protease-chain and substrate. | |
<br><br> | <br><br> | ||
− | + | The affinity of the protease can be altered in two ways. Firstly, the protease binding affinity itself can be tweaked by amino-acid substitution but this requires careful experimentation and has a low chance of success. Much more easily, the cleavage site can be positioned on the linker such that it is partially obstructed or harder to reach by the protease, thereby reducing the effective cleavage rate. | |
<br><br> | <br><br> | ||
− | A full work-out of this demonstration in mathematica notebook can be found <a target=_BLANK href="https:// | + | A full work-out of this demonstration in mathematica notebook format can be found <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/2f/UuModelingProteaseOptimization.txt" class="url_external">here</a>. |
<br><br> | <br><br> | ||
− | <h2 class="subhead" id="subhead-3">Optimization of protein production rates</h2> | + | <h2 class="subhead" id="subhead-3">Substrate trapping reduction</h2> |
− | + | ||
+ | <b>Optimizing DNA affinity of Target Chain and Protease Chain</b><br> | ||
+ | |||
+ | Cleavage of the target chain is required for signal output. Unfortunately, the truncated target chain potentially traps the DNA molecule and thereby reduces the concentration of accessible substrate. The trapped state is visualized in the network model (Fig. 5) as the top node. | ||
+ | <br> | ||
+ | <center><img style="margin-top: 25px; width: 350px;" src="https://static.igem.org/mediawiki/2017/thumb/1/17/UU-model-fig5.png/681px-UU-model-fig5.png"></center> | ||
+ | <span class="text-figure"> | ||
+ | <b>Figure 5.</b> Snapshot of the OUTCASST network model assuming identical binding affinities for target and protease chain, as indicated by arrow thickness. | ||
+ | </span> | ||
+ | |||
+ | <br><br> | ||
+ | From figure 5, we can already see that the likeliness of this trapped state (Fig. 5, state 8) depends on the rates with which the cut complex (Fig. 5, state 6) goes into either of the two subsequent states (Fig. 5, state 7 & 8). In order to optimize the accessibility of substrate, and thereby signal per substrate, we have to ensure that more of the cut complex turns into state 7. From state 7, the DNA-bound protease chain can encounter new transcription-factor containing target chain and further contribute to signal. This could be achieved by increasing the substrate affinity of the protease chain or conversely, lower the substrate affinity of the target chain, as indicated by the difference in arrow thickness in figure 6. | ||
+ | |||
+ | <br> | ||
+ | <center><img style="margin-top: 25px; width: 350px;" src="https://static.igem.org/mediawiki/2017/thumb/7/76/UU-model-fig6.png/681px-UU-model-fig6.png"></center> | ||
+ | <span class="text-figure"> | ||
+ | <b>Figure 6.</b> Proposed solution to substrate trapping in the target chain. Increased binding affinity of the protease chain towards the DNA substrate would shift the equilibrium between state 7 and 8 towards the desired state 7. | ||
+ | </span> | ||
+ | <br><br> | ||
+ | Substrate affinity is a measure of how strongly the chain will bind the substrate. Ideally, we want the affinity of both to be high because then small amounts of substrate can result in signal producing events. On the other hand, the affinity of the protease chain needs to be higher than that of the target chain as we want the substrate to dissociate from the target chain more, so that there is a higher turnover of target chain. | ||
+ | <br><br> | ||
+ | Fortunately, the two different Cas-like proteins OUTCASST uses as DNA-binding domains already differ in DNA binding affinity; Cas9 binds DNA more strongly than Cpf1. In addition, the used guide RNA can be used to further tune the binding affinities <i class="ref" data-id="1">1</i> <i class="ref" data-id="2">2</i>. | ||
+ | <br><br> | ||
+ | Hence, the proposed optimization could be achieved by using Cpf1 for the target chain and Cas9 for the protease chain. In addition, the affinities also largely depend on the used guide RNA, and choosing appropriate guide RNA can thus be used to modulate this affinity further. | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | <b>Optimization of relative protein concentrations</b><br> | ||
+ | |||
+ | This trapping problem could also be tackled by regulating the concentration of target chain that is available. There are two considerations that are important here. First, we want a high amount of target chain to get a high potential for signal. On the other hand, we want a low amount of target chain so there will also be little cleaved target chain to trap the DNA substrate. Thus, there must be an optimum where these two considerations are balanced. | ||
+ | <br><br> | ||
+ | To demonstrate this, we first need to express the behaviour of the system in equations. First off, we assume that the false positive signal has been minimized by optimization of the used protease and thus the mathematical model described here does not contain the false positive signal mechanism. | ||
+ | <br><br> | ||
+ | In this system of ordinary differential equations, the increase or decrease of the state concentrations are given. Here, we consider association and dissociation of complexes and production and decay of the protein chains. The equations below assume a well-mixed system. The flow from state to state can be characterized with the following equations: | ||
+ | <br><br> | ||
+ | |||
+ | <center> | ||
+ | <img src="https://static.igem.org/mediawiki/2017/b/bc/UuModelingQuationTable.png"> | ||
+ | </center> | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | There are eight important parameters in these equations. The k<sub>1</sub> and k<sub>2</sub> rates are the association and dissociation rates between DNA and the target chain. The k<sub>3</sub> and k<sub>4</sub> are the association and dissociation rates of the protease chain and DNA. k<sub>5</sub> gives the effective cleavage rate. pP and pT are the production rates of the protease and target chain and d gives the decay-rate for proteins in general. | ||
+ | <br><br> | ||
+ | The concentration of each state is given by the name of the state in square brackets, such that T stands for target chain, S stands for substrate (DNA), P stands for protease chain, F stands for effector molecule and T<sub>c</sub> stands for cleaved target chain. Binding is indicated by ‘:’ between two components. | ||
+ | <br><br> | ||
+ | The first thing we did was to check whether this system of equations behaves the way we expect it to, on short timescales. At first, we were only interested in the system equilibria. At the time-scale of state transitions, protein production and decay per time-unit are negligible and so the values for d, p<sub>T</sub> and p<sub>P</sub> were initially set to zero. | ||
+ | <br><br> | ||
+ | Using the association and dissociation constants from Richardson et al. <i class="ref" data-id="3">3</i>, we set the parameters k<sub>3</sub> and k<sub>4</sub> to 4 * 10<sup>4</sup> and 5 * 10<sup>-5</sup> respectively. Fonfara et al. <i class="ref" data-id="4">4</i> found a range of Cpf1 affinities in the same order of magnitude as Richardson et al. and so we chose to perform several runs with a variety of Cpf1 parameters going from .9 to 1.1 times the rates of Cas9. All runs resulted in similar equilibria where all target chain would be processed and cleaved. | ||
+ | <br><br> | ||
+ | This result is expected from a well-mixed system but, considering the membrane-bound nature of our proteins, the dynamics might not be accurate. Diffusion in the membrane is limited and thus might limit the interactions of the molecules. We made an attempt to illustrate this, too, using a molecular dynamics model but this will be described later on. | ||
+ | <br><br> | ||
+ | We tried to generate bifurcation diagrams for the equilibrium state of our system, using the above set of equations but this was not possible. The numerical bifurcation analysis toolbox we used, a matlab package called <a target=_BLANK href="https://sourceforge.net/projects/matcont/" class="url_external">matcont</a>, would not attain equilibrium convergence. After checking the eigenvectors of the system using <a target=_BLANK href="http://theory.bio.uu.nl/rdb/grind.html" class="url_external">GRIND</a> we determined that the matcont continuation algorithm would indeed not be able to handle this system, as the majority of the system eigenvectors were in the direction of a single variable. To continue, we had to simplify the system of equations. | ||
+ | <br><br> | ||
+ | From these relations, it is already clear that there can only be a stable signal potential, i.e. a stable fraction of the target chains remains uncleaved, when the production of target chain outweighs the decay and cleavage of it, whilst the acquisition of cleaved target chain is balanced by its decay, such that the following conditions apply: | ||
+ | <center><img height="50" src="https://static.igem.org/mediawiki/2017/9/91/UuModelingEquation2.png"></center> | ||
+ | <center><img height="45" src="https://static.igem.org/mediawiki/2017/e/e0/UuModelingEquation3.png"></center> | ||
+ | Which together forms: | ||
+ | <br> | ||
+ | <center><img height="45" src="https://static.igem.org/mediawiki/2017/9/90/UuModelingEquation4.png"></center> | ||
+ | <br> | ||
+ | However, the concentrations of the intermediary complexes is dependent on the concentration and hence production of protease chain P. We know that, at equilibrium concentrations, the following must hold: | ||
+ | <br><br> | ||
+ | <center><img height="45" src="https://static.igem.org/mediawiki/2017/4/4b/UuModelingEquation5.png"></center> | ||
+ | <br> | ||
+ | By combining these equations, we can get an expression for T depending on the production, decay and complex concentrations: | ||
+ | <br><br> | ||
+ | <center><img height="50" src="https://static.igem.org/mediawiki/2017/b/b9/UuModelingEquation6.png"></center> | ||
+ | <br> | ||
+ | By assuming that the DNA binding dynamics of the system occur at much faster timescales than protein production and decay, we can assume that the substrate binding of the protease and target chains is at steady state, yielding the following expressions: | ||
+ | <br><br> | ||
+ | <center><img height="75" src="https://static.igem.org/mediawiki/2017/0/0d/UuModelingEquation7.png"></center> | ||
+ | <center><img height="75" src="https://static.igem.org/mediawiki/2017/1/19/UuModelingEquation8.png"></center> | ||
+ | <center><img height="75" src="https://static.igem.org/mediawiki/2017/e/ee/UuModelingEquation9.png"></center> | ||
+ | <br> | ||
+ | We could then substitute these three concentrations for their expressions in the expression of the target chain concentration. Making further quasi steady state assumptions on the formation of the pre-cleavage and post-cleavage complexes reduces the expression by two more dependencies. This was done in mathematica notebook, found <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/21/UuModelingQSSAWorkouts.txt" class="url_external">here</a>. | ||
+ | <br><br> | ||
+ | |||
+ | The resulting expression shows that the concentration of target chain depends on: 1) The concentrations of its production relative to the production of the protease chain. 2) The concentration of protease chain. 3) The concentration of substrate. 4) How much cleaved target chain is available to trap said substrate. | ||
+ | <br><br> | ||
+ | The fraction of the total target chain that is cleaved is a saturation function that depends on substrate and protease chain concentrations with respect to how quickly the function's saturation point is attained. We can minimize the cleaved target chain fraction, and the occurrence of substrate trapping with it, by simply having a target chain amount that is much larger than that of the substrate. | ||
+ | <br><br> | ||
+ | In short, the more substrate there is available per target chain, the less signal per substrate molecule we can get as ineffectual target chain concentration increases. | ||
+ | <br><br> | ||
+ | The equations suggest that there is a theoretical optimum for the production rates of both chains, relative to the substrate concentration in the system. Due to time constraints, the expression for this optimum could not be given. The methods given in the mathematica script provided here should be able to reach this solution, given enough time. The meaning of such an optimum, however, is questionable. As the substrate concentrations in our toolkit may differ greatly depending on severity of infection and chance, optimization through growth-rates would need to be different per sample. In conclusion, the only effective optimization of protein productions is to make sure that the protein concentrations greatly exceed the sample concentration of DNA sequence we wish to detect. | ||
+ | |||
+ | <br><br> | ||
+ | <h2 class="subhead" id="subhead-4">Effects of diffusion in membrane</h2> | ||
+ | |||
+ | <b>Coarse-grained Molecular Modelling for optimization of linker lengths</b><br> | ||
+ | |||
+ | Apart from the systems approach to modeling OUTCASST, we sought to investigate the molecular properties of OUTCASST. The idea originated from our concerns about the linkers that connect the transmembrane domains and their respective intra- and extracellular domains. Our hypothesis was that longer linkers facilitate formation of the effective complex between target and protease chain but as discussed above, may also increase false positive rates since the reach of the protease is increased. We thought that there must be an optimum for all linker lengths to maximize the signal-to-noise ratio. | ||
+ | <br><br> | ||
+ | In order to test our hypothesis, we wrote a python script for a 2D coarse-grained Molecular Dynamics simulation of a target and a protease chain in a membrane, illustrating the limitations of diffusion in the membrane. We aimed to test the effect of different linker lengths on the false positive rate on the number of encounters between protease and transcription factor. | ||
+ | <br><br> | ||
+ | Unfortunately, we never we got to test our hypothesis because we had problems to realistically model the linker. In our current approach the linker is represented by a harmonic potential between the membrane domains and the intra- and extracellular domains but we believe that this does not allow for a realistic sampling of conformational space. Ideally, we would want to model the linker in the form of a polymer chain but we never pursued that idea since we put our focus more on a systems approach to OUTCASST. | ||
+ | <br><br> | ||
+ | |||
+ | <video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" controls> | ||
+ | <source src="https://static.igem.org/mediawiki/2017/9/99/UuModelingMDSimulationVid.mp4" type='video/mp4'/> | ||
+ | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
+ | </video> | ||
+ | <br> | ||
+ | |||
+ | <span class="text-figure"> | ||
+ | Video: This short video records a short molecular dynamics simulation run of our python code. | ||
+ | </span> | ||
+ | |||
+ | <br><br> | ||
+ | Nevertheless, we showed that our molecular dynamics simulation works conceptually and that the python code could be used as a basis for other teams to theoretically investigate their transmembrane systems. For people who are curious about the inner working of this simulation, have a look in the <a target=_BLANK href="https://static.igem.org/mediawiki/2017/0/06/UuModelingMDSimulationScript.txt" class="url_external">python code</a>. We tried to comment it as clearly as possible. It is also always possible to contact us via email or facebook. | ||
+ | <br><br> | ||
+ | |||
+ | <b>Spatial modelling of protein interactions</b><br> | ||
+ | |||
+ | To clarify the importance of membrane diffusion and as a short demonstration, a small cellular automaton model was written in C code, compiled for Ubuntu 16.04. They were made using the <a target=_BLANK href="http://theory.bio.uu.nl/rdb/software.htm" class="url_external">CASH framework</a>. Several editions were generated, each with different production rates for both protein chains. These are provided with a readme file as executable files in a zipped format <a target=_BLANK href="https://static.igem.org/mediawiki/2017/f/f3/UuModelingCAIllustrations.zip" class="url_external">here</a>. | ||
+ | <br><br> | ||
+ | The simulations display two fields. The first in black and white displays DNA objects diffusing in space. The second field in mustard displays the membrane of a cell. On this membrane, blue and red objects spawn that represent target and protease chains respectively. DNA diffuses | ||
+ | four times as fast as the membrane compounds. | ||
+ | <br><br> | ||
+ | When a chain in the membrane field meets a DNA object in a corresponding location in the sample field, they bind. The DNA object is removed and the state of the chain is updated to | ||
+ | a lighter colour to indicate its DNA bound state. DNA release from a chain that had it bound is also possible. | ||
+ | <br><br> | ||
+ | If this chain now encounters a chain of the other colour that is not bound, they can form an effective complex. The effective complex can decay in two ways. It can either fall apart into the two proteins that formed it, or it can result in a release of a protease chain and a cleaved target chain. Either of the release products remains bound to the DNA but not both. In addition, once the cleaved target chain release occurs, a counter is incremented to keep track of how much signal is produced. | ||
+ | <br><br> | ||
+ | In essence, these simulations do not provide much insight that was not already known beforehand but they do make for a nice illustration. | ||
+ | <br><br> | ||
+ | In the zipped folder, you can find five versions. The first number in its name gives the production rate of the protease chain, the second number gives the production rate of the target chain and the third number gives the decay rate of both proteins. All interactions were determined using pseudo-random number generation according to a preset function and prespecified seed. | ||
+ | |||
+ | <br><br> | ||
+ | <h2 class="subhead" id="subhead-5">References</h2> | ||
+ | |||
+ | <ol class="references"> | ||
+ | <li data-title="Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1." data-author="Singh, Mallon, Poddar, Wang, Tipanna, Yang, Bailey and Ha." data-link="http://dx.doi.org/10.1101/205575" /> Singh, Mallon, Poddar, Wang, Tipanna, Yang, Bailey and Ha, 2017: Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1. bioRxiv preprint. <a target=_BLANK href="http://dx.doi.org/10.1101/205575" class="url_external"></a> | ||
+ | <li data-title="Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage." data-author="Josephs, Kocak, Fitzgibbon, McMenemy, Gersbach and Marszalek." data-link="http://dx.doi.org/10.1093/nar/gkv892" /> Josephs, Kocak, Fitzgibbon, McMenemy, Gersbach and Marszalek, 2015: Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage. Nucleic Acids Research, volume 43, number 18, pages 8924-8941. DOI: 10.1093/nar/gkv892. <a target=_BLANK href="http://dx.doi.org/10.1093/nar/gkv892" class="url_external"></a> | ||
+ | <li data-title="Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA." data-author="Richardson, C.D., Ray, G.J., DeWitt, M.A., Curie, G.L. & Corn, J.E." data-link="http://dx.doi.org/10.1038/nbt.3481" /> Richardson, C.D., Ray, G.J., DeWitt, M.A., Curie, G.L. & Corn, J.E., 2016: Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology, volume 34, number 3. DOI: 10.1038/nbt.3481. <a target=_BLANK href="http://dx.doi.org/10.1038/nbt.3481" class="url_external"></a> | ||
+ | <li data-title="The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA." data-author="Fonfara, I., Richter, H., Bratovič, M., Rhun, A.L. & Charpentier, E." data-link="http://dx.doi.org/10.1038/nature17945" /> Fonfara, I., Richter, H., Bratovič, M., Rhun, A.L. & Charpentier, E., 2016: The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature, volume 532, pages 517-521, doi:10.1038/nature17945. <a target=_BLANK href="http://dx.doi.org/10.1038/nature17945" class="url_external"></a> | ||
+ | </ol> | ||
+ | |||
+ | <span id="tooltip-1"></span> | ||
+ | <span id="tooltip-2"></span> | ||
+ | <span id="tooltip-3"></span> | ||
+ | <span id="tooltip-4"></span> | ||
</script> | </script> | ||
Line 1,370: | Line 1,651: | ||
<h2 class="subhead" id="subhead-3">Materials</h2> | <h2 class="subhead" id="subhead-3">Materials</h2> | ||
<ul> | <ul> | ||
− | <li />InterLab Parts and Measurement Kit | + | <li />InterLab Parts and Measurement Kit <a target=_BLANK href="http://parts.igem.org/Help:2017_DNA_Distribution#Measurement_Kit" class="url_external"></a> |
<li />Plate reader: Biotek Synergy HT | <li />Plate reader: Biotek Synergy HT | ||
− | <li /><i>E. coli</i> | + | <li /><i>E. coli DH5-alpha</i> cells |
</ul> | </ul> | ||
Line 1,378: | Line 1,659: | ||
<h2 class="subhead" id="subhead-4">Methods</h2> | <h2 class="subhead" id="subhead-4">Methods</h2> | ||
<ul> | <ul> | ||
− | <li />Protocol for the transformation of competent <i>E. coli</i>: single tube transformation protocol | + | <li />Protocol for the transformation of competent <i>E. coli</i>: single tube transformation protocol <a target=_BLANK href="http://parts.igem.org/Help:Protocols/Transformation" class="url_external"></a> |
− | <li />Protocol for the plate reader | + | <li />Protocol for the plate reader <a target=_BLANK href="https://static.igem.org/mediawiki/2017/8/85/InterLab_2017_Plate_Reader_Protocol.pdf" class="pdf pdf-inline"></a> |
</ul> | </ul> | ||
<br> | <br> | ||
Line 1,394: | Line 1,675: | ||
<br> | <br> | ||
− | <img width="600" src="https://static.igem.org/mediawiki/2017/6/60/Uuinterlab_figure1.png"> | + | <center><img style="margin-top: 25px;" width="600" src="https://static.igem.org/mediawiki/2017/6/60/Uuinterlab_figure1.png"></center> |
− | < | + | <span class="text-figure"> |
<b>Figure 1.</b> The relative fluorescence per cell over time for the negative and the positive controls and the six test devices of the diluted cultures. | <b>Figure 1.</b> The relative fluorescence per cell over time for the negative and the positive controls and the six test devices of the diluted cultures. | ||
+ | </span> | ||
<br> | <br> | ||
<br> | <br> | ||
− | <img width="600" src="https://static.igem.org/mediawiki/2017/0/03/Uuinterlab_figure2.png"> | + | |
− | < | + | <center><img style="margin-top: 25px;" width="600" src="https://static.igem.org/mediawiki/2017/0/03/Uuinterlab_figure2.png"></center> |
+ | <span class="text-figure"> | ||
<b>Figure 2.</b> The relative fluorescence per cell over time for the negative and the positive controls and test device 2 till 6 of the diluted cultures. | <b>Figure 2.</b> The relative fluorescence per cell over time for the negative and the positive controls and test device 2 till 6 of the diluted cultures. | ||
+ | </span> | ||
<br><br> | <br><br> | ||
Line 1,412: | Line 1,696: | ||
<script id="page-stakeholders" type="text/template"> | <script id="page-stakeholders" type="text/template"> | ||
− | + | As OUTCASST is a system with a very broad application, we wanted to find the most suitable end users and focus our design on their needs and restrictions. To achieve this goal, we have interviewed multiple professionals from different backgrounds. In these conversations, we tried to discover strengths and weaknesses of our system and design with regard to existing techniques and whether the OUTCASST system would be useful in the professions of the interviewed individuals. If not, we tried to figure out in what direction it might prove more useful or what aspects needed to be improved. In addition, we also discussed safety issues and technical aspects of our toolkit design, of which the outcomes were compiled on their own respective pages: <a onclick="return change_page('safety', 1)" href="safety">Safety</a> and <a onclick="return change_page('product-design', 1)" href="product-design">Design & Integration</a>. | |
− | + | <br><br> | |
− | --> | + | In the short video below, we show a summary of the journey we made to get to our end users. Besides this summary, more elaborate descriptions of each interview can be found below. |
− | + | <br><br> | |
− | < | + | |
+ | <video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/8/8d/UU-stakeholders-video-poster.png" controls> | ||
+ | <source src="https://static.igem.org/mediawiki/2017/6/6f/UuHPEndUsersVid.mp4" type='video/mp4'/> | ||
+ | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
+ | </video> | ||
+ | |||
<div class="shuffle-container" style="position: relative; margin-top: 30px; margin-bottom: 50px; width: 900px; margin-left: -75px;"> | <div class="shuffle-container" style="position: relative; margin-top: 30px; margin-bottom: 50px; width: 900px; margin-left: -75px;"> | ||
<div style="position: absolute; top: 200px; left: 350px; z-index: 1;"> | <div style="position: absolute; top: 200px; left: 350px; z-index: 1;"> | ||
Line 1,422: | Line 1,711: | ||
</div> | </div> | ||
<div class="js-grid my-shuffle shuffle" style="height: 520.262px; transition: height 250ms cubic-bezier(0.4, 0, 0.2, 1);"> | <div class="js-grid my-shuffle shuffle" style="height: 520.262px; transition: height 250ms cubic-bezier(0.4, 0, 0.2, 1);"> | ||
− | <figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity; transform: translate(0px, 0px) scale(1);"> | + | <figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-doctors').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity; transform: translate(0px, 0px) scale(1);"> |
<div class="aspect aspect--32x9"> | <div class="aspect aspect--32x9"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fe/Marit_de_Wit.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fe/Marit_de_Wit.jpg"></div> | ||
− | |||
− | |||
− | |||
− | |||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-westerdijk').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--9x80"> | <div class="aspect aspect--9x80"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fc/Bert_Gerrits_van_den_Ende.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fc/Bert_Gerrits_van_den_Ende.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-cancer').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--9x80"> | <div class="aspect aspect--9x80"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/6/63/Hans_Bos.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/6/63/Hans_Bos.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-parasitology').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--16x9"> | <div class="aspect aspect--16x9"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/8/8e/Jaap_van_Hellemond.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/8/8e/Jaap_van_Hellemond.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-amca').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--32x9"> | <div class="aspect aspect--32x9"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/4/4b/Jet_and_Ruud.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/4/4b/Jet_and_Ruud.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-genomediagnostics').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--32x9"> | <div class="aspect aspect--32x9"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/c/cd/Patrick_en_Pieter-Jaap.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/c/cd/Patrick_en_Pieter-Jaap.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-cancer').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--9x80"> | <div class="aspect aspect--9x80"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/5/59/Hugo_Snippert_%282%29.jpg"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/5/59/Hugo_Snippert_%282%29.jpg"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
− | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | + | <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-nfi').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> |
<div class="aspect aspect--9x80"> | <div class="aspect aspect--9x80"> | ||
<div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/d/d0/Titia_Sijen.JPG"></div> | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/d/d0/Titia_Sijen.JPG"></div> | ||
+ | </div> | ||
+ | </figure> | ||
+ | <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;"> | ||
+ | <div class="aspect aspect--9x80" style="padding-bottom: 70%;"> | ||
+ | <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/1/10/Uu-hp-team-photo.png"></div> | ||
</div> | </div> | ||
</figure> | </figure> | ||
Line 1,472: | Line 1,762: | ||
<section class="timeline" style="width: 1000px; margin-left: -100px;"> | <section class="timeline" style="width: 1000px; margin-left: -100px;"> | ||
<div class="timeline-container" style="width: 100%;"> | <div class="timeline-container" style="width: 100%;"> | ||
− | <div class="timeline-item"> | + | <div id="item-westerdijk" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,485: | Line 1,775: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-genomediagnostics" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,504: | Line 1,794: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-amca" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,519: | Line 1,809: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-cancer" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,536: | Line 1,826: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-nfi" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,553: | Line 1,843: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-doctors" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,569: | Line 1,859: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-parasitology" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,585: | Line 1,875: | ||
</div> | </div> | ||
− | <div class="timeline-item"> | + | <div id="item-clinical" class="timeline-item"> |
<div class="timeline-img"></div> | <div class="timeline-img"></div> | ||
Line 1,612: | Line 1,902: | ||
<style type="text/css"> | <style type="text/css"> | ||
− | .page-container ul, .page-container ol { padding-left: 20px; } | + | .page-container ul, .page-container ol { padding-left: 20px; margin: 0; } |
.page-container ul, .page-container ol { text-align: left; } | .page-container ul, .page-container ol { text-align: left; } | ||
.timeline-content>p { font-size: 14px; } | .timeline-content>p { font-size: 14px; } | ||
+ | |||
+ | .text-figure { font-size: 11px; } | ||
+ | |||
+ | .url_external { background: url(https://static.igem.org/mediawiki/2017/0/0f/Uu_url_external.png) center right no-repeat !important; height: 13px !important; padding-right: 15px !important; } | ||
+ | |||
+ | sub { vertical-align: sub; font-size: smaller; } | ||
+ | sup { vertical-align: super; font-size: smaller; } | ||
+ | |||
+ | .uu-table { border: 0 !important; margin: 0 !important; } | ||
+ | .uu-table td { border: 0 !important; padding: 0 !important; } | ||
#modal-overlay | #modal-overlay | ||
Line 1,624: | Line 1,924: | ||
right: 0; | right: 0; | ||
bottom: 0; | bottom: 0; | ||
− | z-index: | + | z-index: 3000; |
background: #000000; | background: #000000; | ||
opacity: 0; | opacity: 0; | ||
Line 1,643: | Line 1,943: | ||
bottom: 0; | bottom: 0; | ||
width: 100%; | width: 100%; | ||
− | z-index: | + | z-index: 4000; |
overflow: auto; | overflow: auto; | ||
color: black; | color: black; | ||
Line 1,692: | Line 1,992: | ||
#modal-content>h2 { border-bottom: 1px solid #dedede; padding-bottom: 10px; } | #modal-content>h2 { border-bottom: 1px solid #dedede; padding-bottom: 10px; } | ||
− | . | + | .ref { |
+ | display: inline-block; | ||
+ | background: #0069b3; | ||
+ | color: white; | ||
+ | top: -5px; | ||
+ | position: relative; | ||
+ | border-radius: 50%; | ||
+ | font-size: 12px; | ||
+ | line-height: 17px; | ||
+ | font-weight: bold; | ||
+ | font-style: normal; | ||
+ | width: 17px; | ||
+ | text-align: center; | ||
+ | cursor: pointer; | ||
+ | } | ||
+ | |||
+ | .ref-close | ||
+ | { | ||
+ | font-size: 11px; | ||
+ | line-height: 20px; | ||
+ | cursor: pointer; | ||
+ | width: 120px; | ||
+ | height: 20px; | ||
+ | margin: 5px auto; | ||
+ | text-align: center; | ||
+ | background: #ececec; | ||
+ | color: #0069b3; | ||
+ | border-radius: 5px; | ||
+ | } | ||
+ | |||
+ | .ref-close:hover | ||
+ | { | ||
+ | background: #0069b3; | ||
+ | color: white; | ||
+ | } | ||
+ | |||
+ | .pdf { display: inline-block; font-size: 12px; margin: 10px 0 10px 0; padding-left: 30px; height: 24px; background: url(https://static.igem.org/mediawiki/2017/6/6a/Uupdf.png) top left no-repeat; vertical-align: bottom; } | ||
+ | .pdf { text-decoration: none; } | ||
+ | .pdf:hover { text-decoration: underline; } | ||
+ | .pdf-inline { margin: 0; padding-left: 24px; text-decoration: none !important; } | ||
+ | |||
+ | .zip { display: inline-block; font-size: 12px; margin: 10px 0 10px 0; padding-left: 30px; height: 24px; background: url(https://static.igem.org/mediawiki/2017/c/c3/UUSnapGene_Viewer_24.png) top left no-repeat; vertical-align: bottom; } | ||
+ | .zip { text-decoration: none; } | ||
+ | .zip:hover { text-decoration: underline; } | ||
+ | .zip-inline { margin: 0; padding-left: 24px; text-decoration: none !important; } | ||
</style> | </style> | ||
− | <script id="page-safety" type="text/template"> | + | <script id="page-safety" type="text/template"><!-- |
<div class="page-heading">OUTCASST Safety information</div> | <div class="page-heading">OUTCASST Safety information</div> | ||
− | + | <div style="width: 150px; float: right; margin-left: 50px;"> | |
+ | <img style="width: 100%; cursor: pointer;" onclick="openmodal('safetyposter')" src="https://static.igem.org/mediawiki/2017/6/65/Uu_resized_Safety-poster-RIVM-engels.png"> | ||
+ | <br> | ||
+ | <span class="text-figure"> | ||
+ | RIVM safety poster. <a href="javascript:void(0)" onclick="openmodal('safetyposter')" style="font-size: 11px;">Click for full size.</a> | ||
+ | </span> | ||
+ | </div> | ||
− | + | Since safety is a very important aspect in synthetic biology, we collaborated with the RIVM (the National Institute for Public Health and Environment of the Netherlands). They encouraged us to think about safety before we act. We came to the conclusion that safety has different meanings for different stakeholders. Here we describe the most important points for these stakeholders. Besides safety, we’ve also thought about the societal impact of our tool and the possible ethical issues involved. The information we gathered was summarized in an infographic, which we used to talk to the general public about synthetic biology and safety at an event organized by the RIVM. | |
− | + | ||
− | + | ||
<br><br> | <br><br> | ||
Line 1,713: | Line 2,061: | ||
<br><br> | <br><br> | ||
<b>User Safety</b><br><br> | <b>User Safety</b><br><br> | ||
− | Since we are going to use OUTCASST for the diagnosis of Chagas disease, our users will be caregivers and medical professionals in rural areas. Safety of our device is of great importance to them. During the interviews to find suitable end users (see the end-users section), we also discussed the safety of HEK293T cells to detect specific DNA regions. All interviewees were unanimous that these cell lines would not be a problem regarding safety issues and that potential risks would lie with the samples applied to the device. Since we are going to use blood from people that are potentially infected with parasites, it is important to point out the risk of contamination of the caregiver or other people. This risk is, however, no different from that of other simple diagnostic procedures. | + | Since we are going to use OUTCASST for the diagnosis of Chagas disease, our users will be caregivers and medical professionals in rural areas. |
+ | Safety of our device is of great importance to them. During the interviews to find suitable end users (<a onclick="return change_page('stakeholders', 1)" href="stakeholders">see the end-users section</a>), we also discussed the safety of HEK293T cells to detect specific DNA regions. All interviewees were unanimous that these cell lines would not be a problem regarding safety issues and that potential risks would lie with the samples applied to the device. Since we are going to use blood from people that are potentially infected with parasites, it is important to point out the risk of contamination of the caregiver or other people. This risk is, however, no different from that of other simple diagnostic procedures. | ||
<br><br> | <br><br> | ||
Since the HEK293T cells are too fragile to use in the device, we opt to use air-dried cells from the anhydrobiotic insect, <i>Polypedilum vanderplanki</i>. To make the use of these cells as safe as possible, the design of our tool is going to be a closed system, wherein everything is present and only the blood sample will be applied. There will also be several mechanisms and kill-switches incorporated in the detecting cells. This way, the cells are physically separated from both the user and patients and this minimizes the chance of survival of these cells outside of the system. | Since the HEK293T cells are too fragile to use in the device, we opt to use air-dried cells from the anhydrobiotic insect, <i>Polypedilum vanderplanki</i>. To make the use of these cells as safe as possible, the design of our tool is going to be a closed system, wherein everything is present and only the blood sample will be applied. There will also be several mechanisms and kill-switches incorporated in the detecting cells. This way, the cells are physically separated from both the user and patients and this minimizes the chance of survival of these cells outside of the system. | ||
Line 1,760: | Line 2,109: | ||
</script> | </script> | ||
− | <script id="page-product-design" type="text/template"> | + | <script id="page-product-design" type="text/template"><!-- |
<div class="page-heading">Integrated human practices: design of OUTCASST</div> | <div class="page-heading">Integrated human practices: design of OUTCASST</div> | ||
Altogether, we gathered information from many different fields and perspectives. All of these views helped us to optimize our design to use OUTCASST as a tool for diagnosing Chagas disease. Since we want our tool to be easy to use in the field and rural areas, there are different aspects that should be taken into account. Robustness and resistance of the toolkit to temperature fluctuations and humidity are chief among these. In addition, it is important not to rely on material and storage containers such as fridges or freezers (Marit de Wit, Doctors without borders). | Altogether, we gathered information from many different fields and perspectives. All of these views helped us to optimize our design to use OUTCASST as a tool for diagnosing Chagas disease. Since we want our tool to be easy to use in the field and rural areas, there are different aspects that should be taken into account. Robustness and resistance of the toolkit to temperature fluctuations and humidity are chief among these. In addition, it is important not to rely on material and storage containers such as fridges or freezers (Marit de Wit, Doctors without borders). | ||
<br><br> | <br><br> | ||
− | < | + | <style type="text/css"> |
+ | .tutorial-design .tutorial_button { width: 25px; height: 25px; | ||
+ | font-size: 1.2em; | ||
+ | line-height: 25px; | ||
+ | border: 3px solid #ffb252 | ||
+ | } | ||
− | <br><br> | + | .tutorial-design .container { background: transparent; z-index: 1; } |
+ | </style> | ||
+ | |||
+ | <div class="tutorial tutorial-design" style="position: relative; width: 100%; display: inline-block;"> | ||
+ | <img id="figure-1" style="position: absolute; top: 0; right: 25px; width: 600px;" src="https://static.igem.org/mediawiki/2017/9/97/UU-hp-0.png"> | ||
+ | <img id="figure-2" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/4a/UU-hp-1.png"> | ||
+ | <img id="figure-3" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/49/UU-hp-2.png"> | ||
+ | <img id="figure-4" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/6/61/UU-hp-3.png"> | ||
+ | <img id="figure-5" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/3/37/UU-hp-4.png"> | ||
+ | <img id="figure-6" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/5/56/UU-hp-5.png"> | ||
+ | <img id="figure-7" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/c/c8/UU-hp-6.png"> | ||
+ | <img id="figure-8" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/d/dd/UU-hp-7.png"> | ||
+ | <img id="figure-9" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/4d/UU-hp-8.png"> | ||
+ | |||
+ | <div style="clear: both;"></div> | ||
+ | |||
+ | <div id="popover-1" style="display: none;"> | ||
+ | The OUTCASST toolkit consists of dried cells in a closed off compartment, two medium compartments (green) and a lysis and reset buffer compartment (purple). | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-2" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-2" style="display: none;"> | ||
+ | First, the seal on one of the medium compartments is broken so medium goes onto the cells. The cells will now be rejuvenated and allowed to acclimatize in 12 hours. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-3" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-3" style="display: none;"> | ||
+ | After 12 hours, a patient's sample can be added to the test kit. The sample will enter the filtering compartment, which contains chemicals that bind all sorts of unwanted chemicals. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-4" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-4" style="display: none;"> | ||
+ | The seal on the lysis buffer compartment is broken. The lysis buffer causes any intact cells to burst, releasing their DNA and internal contents. Unwanted cell debris is bound by the filter molecules, coated to the inside of the filtering compartment. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-5" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-5" style="display: none;"> | ||
+ | The seal on the reset buffer compartment is broken. Reset buffer, sample and lysis buffer mingle, neutralizing each other and resulting in an isotonic mixture that will not harm the sensor cells. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-6" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-6" style="display: none;"> | ||
+ | The second medium pocket is used to resuspend the gRNA. We kept the gRNA dry until now to prevent degradation of this sensitive chemical. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-7" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-7" style="display: none;"> | ||
+ | The dissolved gRNA is released onto the sensor cells. The protein chains on the surface of these cells can now bind with the gRNA, making the sensor cells specific for DNA that is complementary to the gRNA they were provided with. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-8" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-8" style="display: none;"> | ||
+ | The seal to the waste compartment is broken. As this compartment was under a slight vacuum, a part of the medium is sucked away from the cells, making room for the sample. | ||
+ | <br> | ||
+ | <br> | ||
+ | <a href="javascript: void(0);" class="btn blue" id="goto-9" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a> | ||
+ | </div> | ||
+ | |||
+ | <div id="popover-9" style="display: none;"> | ||
+ | The seal to the waste compartment is closed again and so are the seals to the medium pockets. The lysed and filtered sample, containing the patient's DNA, is now brought to the cells. If the right DNA sequence is present, the cells will detect it and give an output signal. | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 20px; left: 20px; width: 40px; z-index: 2;"> | ||
+ | <span id="link-1" class="tutorial_button selected pulsing" style="font-size: 17px; width: 40px; height: 40px; line-height: 40px; border: 5px solid #ffb252;">Start</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 80px; left: 30px;"> | ||
+ | <span id="link-2" class="tutorial_button">2</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 120px; left: 30px;"> | ||
+ | <span id="link-3" class="tutorial_button">3</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 160px; left: 30px;"> | ||
+ | <span id="link-4" class="tutorial_button">4</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 200px; left: 30px;"> | ||
+ | <span id="link-5" class="tutorial_button">5</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 240px; left: 30px;"> | ||
+ | <span id="link-6" class="tutorial_button">6</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 280px; left: 30px;"> | ||
+ | <span id="link-7" class="tutorial_button">7</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 320px; left: 30px;"> | ||
+ | <span id="link-8" class="tutorial_button">8</span> | ||
+ | </div> | ||
+ | |||
+ | <div class="container" style="position: absolute; top: 360px; left: 30px;"> | ||
+ | <span id="link-9" class="tutorial_button">9</span> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <script type="text/javascript" language="JavaScript"> | ||
+ | function tut_goto(step) | ||
+ | { | ||
+ | if(step == 1) | ||
+ | { | ||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | if(i != step) | ||
+ | { | ||
+ | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#link-" + i).removeClass("pulsing"); | ||
+ | jQuery("#popover-" + i).dxPopover("hide"); | ||
+ | jQuery("#figure-" + i).fadeOut("5"); | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover("show"); | ||
+ | jQuery("#link-" + i).addClass("selected"); | ||
+ | jQuery("#link-" + i).removeClass("pulsing"); | ||
+ | jQuery("#figure-" + i).fadeIn("5"); | ||
+ | } | ||
+ | } | ||
+ | |||
+ | //jQuery('html, body').animate({scrollTop: jQuery('.tutorial').offset().top - 200}, 500); | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | if(i != step) | ||
+ | { | ||
+ | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#link-" + i).removeClass("pulsing"); | ||
+ | jQuery("#popover-" + i).dxPopover("hide"); | ||
+ | jQuery("#figure-" + i).fadeOut("5"); | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover("show"); | ||
+ | jQuery("#link-" + i).addClass("selected"); | ||
+ | jQuery("#figure-" + i).fadeIn("5"); | ||
+ | } | ||
+ | } | ||
+ | |||
+ | //jQuery('html, body').animate({scrollTop: jQuery('.tutorial').offset().top - 200}, 500); | ||
+ | } | ||
+ | } | ||
+ | |||
+ | jQuery(function(){ | ||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | var position = "left"; | ||
+ | var showEvent = ""; | ||
+ | |||
+ | var content = jQuery("#popover-" + i)[0].innerHTML; | ||
+ | |||
+ | jQuery("#popover-" + i).dxPopover({ | ||
+ | target: "#link-" + i, | ||
+ | showEvent: "", | ||
+ | hideEvent: "", | ||
+ | closeOnBackButton: false, | ||
+ | closeOnOutsideClick: false, | ||
+ | position: { | ||
+ | my: (position == "left" ? "right" : "left"), | ||
+ | at: position, | ||
+ | of: $("#link-" + i) | ||
+ | }, | ||
+ | width: 0, | ||
+ | height: 0, | ||
+ | showTitle: false, | ||
+ | visible: true, | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } }, | ||
+ | contentTemplate: "", | ||
+ | closeOnTargetScroll: function(){ | ||
+ | return true; | ||
+ | } | ||
+ | }).dxPopover("hide"); | ||
+ | |||
+ | jQuery("#popover-" + i).dxPopover({ | ||
+ | width: 300, | ||
+ | height: "auto", | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1 }, hide: { type: 'fade', to: 0 } }, | ||
+ | contentTemplate: content | ||
+ | }); | ||
+ | } | ||
+ | |||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | jQuery("#link-" + i).click(function() | ||
+ | { | ||
+ | tut_goto(this.id.split("-")[1]); | ||
+ | }); | ||
+ | } | ||
+ | |||
+ | jQuery('body').on('click', 'a', function(event) { | ||
+ | var id = event.target.id; | ||
+ | |||
+ | if(id.indexOf("goto-") > -1) | ||
+ | { | ||
+ | tut_goto(parseInt(id.split("-")[1])); | ||
+ | } | ||
+ | }); | ||
+ | }); | ||
+ | </script> | ||
+ | |||
+ | <div style="clear: both;"></div> | ||
The tool should be cheap to produce and easy to use. To achieve this goal, the tool needs to have a closed box design wherein only the blood sample has to be added and a simple protocol can be followed to perform the test (Jet Bliek and Ruud van den Bogaard, Academical Medical Center Amsterdam: clinical genetics). Disposal of the system also needs to be considered (collaboration RIVM National Insitute for Public Health and the Environment). | The tool should be cheap to produce and easy to use. To achieve this goal, the tool needs to have a closed box design wherein only the blood sample has to be added and a simple protocol can be followed to perform the test (Jet Bliek and Ruud van den Bogaard, Academical Medical Center Amsterdam: clinical genetics). Disposal of the system also needs to be considered (collaboration RIVM National Insitute for Public Health and the Environment). | ||
Line 1,783: | Line 2,355: | ||
The OUTCASST toolkit has a closed box design, wherein all the components to perform the test are present in distinct compartments, separated by seals. These seals can be broken by applying pressure on them. | The OUTCASST toolkit has a closed box design, wherein all the components to perform the test are present in distinct compartments, separated by seals. These seals can be broken by applying pressure on them. | ||
<br><br> | <br><br> | ||
− | As was stated earlier, a lot of variables need to be kept constant to keep the HEK293T cells alive. Because of this, it is not feasible to use these cells in our design. Instead, we opt to use air-dried cells from the anhydrobiotic insect, Polypelidum vanderplanki, which can be stored at room temperature for 251 days and can restart proliferating again after rehydration | + | As was stated earlier, a lot of variables need to be kept constant to keep the HEK293T cells alive. Because of this, it is not feasible to use these cells in our design. Instead, we opt to use air-dried cells from the anhydrobiotic insect, Polypelidum vanderplanki, which can be stored at room temperature for 251 days and can restart proliferating again after rehydration <i class="ref" data-id="1">1</i>. This way the shelf life of our tool can also be prolonged. To prevent the risk of our GMO getting out in the environment, several mechanisms and kill-switches will be incorporated in the cells, so they can only survive in our closed box system, in their resurgent state. |
This can be done by manipulating the metabolism, so that the cells can’t produce a crucial substance for survival, e.g. an amino acid, which will be added in the toolkit medium. In case the cells get out of the toolkit, they will die because of the absence of the crucial substance. | This can be done by manipulating the metabolism, so that the cells can’t produce a crucial substance for survival, e.g. an amino acid, which will be added in the toolkit medium. In case the cells get out of the toolkit, they will die because of the absence of the crucial substance. | ||
<br><br> | <br><br> | ||
Line 1,817: | Line 2,389: | ||
We want to take this information into account to design the target DNA. There are two possibilities from which we can choose. The first option would be to permit certain mutations in the target DNA, to prevent getting a false negative result in some cases. The second option would be to use a very conserved domain as target DNA and don’t allow any mismatches. From our perspective, we think the second option would be more suitable, since the specificity in our system is a very valuable aspect of the design. We have chosen to use the satellite DNA, which is present in the <i>T. cruzi</i> parasite as a 195 base pair repeat with about 100,000 copies (Aldert Bart, Academical Medical Center Amsterdam: Clinical molecular parasitologist). | We want to take this information into account to design the target DNA. There are two possibilities from which we can choose. The first option would be to permit certain mutations in the target DNA, to prevent getting a false negative result in some cases. The second option would be to use a very conserved domain as target DNA and don’t allow any mismatches. From our perspective, we think the second option would be more suitable, since the specificity in our system is a very valuable aspect of the design. We have chosen to use the satellite DNA, which is present in the <i>T. cruzi</i> parasite as a 195 base pair repeat with about 100,000 copies (Aldert Bart, Academical Medical Center Amsterdam: Clinical molecular parasitologist). | ||
− | </script> | + | <br><br> |
+ | <h2 class="subhead" id="subhead-4">References</h2> | ||
+ | |||
+ | <ol class="references"> | ||
+ | <li data-title="Air-dried cells from the anhydrobiotic insect, Polypedilum vanderplanki, can survive long term…" data-author="Watanabe K, Imanishi S, Akiduki G, Cornette R, Okuda T." data-link="https://doi.org/10.1016/j.cryobiol.2016.05.006" /> Watanabe K, Imanishi S, Akiduki G, Cornette R, Okuda T. Air-dried cells from the anhydrobiotic insect, Polypedilum vanderplanki, can survive long term preservation at room temperature and retain proliferation potential after rehydration. Cryobiology. 2016 Aug 31;73(1):93-8. <a target=_BLANK href="https://doi.org/10.1016/j.cryobiol.2016.05.006" class="url_external"></a> | ||
+ | </ol> | ||
+ | |||
+ | <span id="tooltip-1"></span> | ||
+ | |||
+ | --></script> | ||
<script id="page-outreach" type="text/template"> | <script id="page-outreach" type="text/template"> | ||
<div class="page-heading">Outreach</div> | <div class="page-heading">Outreach</div> | ||
− | Science | + | Science impacts the world in many ways. With our project, we are not only aiming to make a difference by creating a diagnostic tool, but also to reach out to the public to create awareness and make science accessible for everyone. We collaborated with ‘de Kennis van Nu’, a well-known national TV program and internet platform that brings different scientific themes to the general public in an understandable way. They aim to make science accessible to everyone, old and young, and encourage everyone to be curious and bring out the scientist in themselves! |
On their platform, we explain the formation of Utrecht’s very first team, our design and how we are trying to solve healthcare problems. | On their platform, we explain the formation of Utrecht’s very first team, our design and how we are trying to solve healthcare problems. | ||
− | Through our whole iGEM experience, they follow us from lab bench to Boston. | + | Through our whole iGEM experience, they follow us from lab bench to Boston. Their special about our team can be found <a target=_BLANK href="https://dekennisvannu.nl/site/special/iGEM-2017-studenten-ontwerpen-nieuw-leven/111#!/" class="url_external">here</a>. |
<br><br> | <br><br> | ||
Below, you can find the short movies, articles and infographics that were so far made in cooperation with Kennis van Nu to reach out to the public. | Below, you can find the short movies, articles and infographics that were so far made in cooperation with Kennis van Nu to reach out to the public. | ||
Line 1,834: | Line 2,415: | ||
<h2 class="subhead" id="subhead-2">iGEM Utrecht: an introduction</h2> | <h2 class="subhead" id="subhead-2">iGEM Utrecht: an introduction</h2> | ||
− | <video poster="" controls> | + | <video poster="https://static.igem.org/mediawiki/2017/2/2e/UU-poster-video1.png" controls> |
− | <source src=" | + | <source src="https://static.igem.org/mediawiki/2017/b/bb/UuHPOutreach1.mp4" type='video/mp4'/> |
− | + | ||
− | + | ||
− | + | ||
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
</video> | </video> | ||
+ | <div class="description">What does iGEM mean and what’s so fun about it? What are the biggest challenges faced during the experiments. In this movie we explain it all.</div> | ||
</div> | </div> | ||
<div class="outreach-video right"> | <div class="outreach-video right"> | ||
Line 1,847: | Line 2,426: | ||
<h2 class="subhead" id="subhead-2">Meet the team</h2> | <h2 class="subhead" id="subhead-2">Meet the team</h2> | ||
− | <video poster="" controls> | + | <video poster="https://static.igem.org/mediawiki/2017/6/6a/UU-poster-video2.png" controls> |
− | <source src=" | + | <source src="https://static.igem.org/mediawiki/2017/6/68/UuHPOutreach2.mp4" type='video/mp4'/> |
− | + | ||
− | + | ||
− | + | ||
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
</video> | </video> | ||
+ | |||
+ | <div class="description">During the formation of the team, a lot of attention is paid to diversity of the members and their background. In this movie some of the members introduce themselves and explain why they participate in this competition.</div> | ||
</div> | </div> | ||
Line 1,860: | Line 2,438: | ||
<h2 class="subhead" id="subhead-2">The problem; the detection of infectious disease has to be improved</h2> | <h2 class="subhead" id="subhead-2">The problem; the detection of infectious disease has to be improved</h2> | ||
− | <video poster="" controls> | + | <video poster="https://static.igem.org/mediawiki/2017/6/6c/Uu-outreach-video3-poster.png" controls> |
− | <source src=" | + | <source src="https://static.igem.org/mediawiki/2017/b/bb/UuHPOutreach3.mp4" type='video/mp4'/> |
− | + | ||
− | + | ||
− | + | ||
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
</video> | </video> | ||
+ | |||
+ | <div class="description">For which problem do we find a solution in our research? The concept of the problem is explained in this draw-my-life video.</div> | ||
</div> | </div> | ||
<div class="outreach-video right"> | <div class="outreach-video right"> | ||
− | <h2 class="subhead" id="subhead-2"> | + | <h2 class="subhead" id="subhead-2">Labsafety for Dummies</h2> |
− | <video poster="" controls> | + | <video poster="https://static.igem.org/mediawiki/2017/5/5b/UU-poster-video4.png" controls> |
− | <source src=" | + | <source src="https://static.igem.org/mediawiki/2017/4/4c/UuHPOutreach4.mp4" type='video/mp4'/> |
− | + | ||
− | + | ||
− | + | ||
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | <p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p> | ||
</video> | </video> | ||
+ | |||
+ | <div class="description">The lab can be a treacherous environment. One tiny mistake, and it could be your last.. We answer important questions about how to stay safe in the lab.</div> | ||
</div> | </div> | ||
Line 1,904: | Line 2,480: | ||
.outreach-video>video { width: 100%; } | .outreach-video>video { width: 100%; } | ||
.outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; } | .outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; } | ||
+ | |||
+ | .outreach-video .description { font-size: 12px; line-height: 20px; display: inline-block; } | ||
</style> | </style> | ||
</script> | </script> | ||
Line 2,045: | Line 2,623: | ||
<span class="team-duties"> | <span class="team-duties"> | ||
› Experimental - Secreted Cas9 and Cpf1<br> | › Experimental - Secreted Cas9 and Cpf1<br> | ||
− | › Human Practices - Application | + | › Human Practices - Application<br> |
+ | › Biobricks | ||
</span> | </span> | ||
Line 2,106: | Line 2,685: | ||
› Human Practices -<br> Application/Safety/Design<br> | › Human Practices -<br> Application/Safety/Design<br> | ||
› Experimental - Assembly/InterLab Study<br> | › Experimental - Assembly/InterLab Study<br> | ||
− | › Funding & Sponsoring | + | › Funding & Sponsoring<br> |
+ | › Treasurer | ||
</span> | </span> | ||
<div style="margin-top: 10px; font-weight: bold;">Bio</div> | <div style="margin-top: 10px; font-weight: bold;">Bio</div> | ||
− | <div class="team-bio"> | + | <div class="team-bio" style="height: 61px;"> |
Hi! I'm Lishi (21), a first year master student in Pharmacy at Utrecht University. After that, I want to become a hospital pharmacist. | Hi! I'm Lishi (21), a first year master student in Pharmacy at Utrecht University. After that, I want to become a hospital pharmacist. | ||
<div class="lb"></div> | <div class="lb"></div> | ||
Line 2,480: | Line 3,060: | ||
<div class="team_members"> | <div class="team_members"> | ||
<div class="timeline-item"> | <div class="timeline-item"> | ||
− | <div class="timeline-content timeline-card js--fadeInLeft"> | + | <div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front"> |
<div class="timeline-img-header"> | <div class="timeline-img-header"> | ||
− | <img width="100%" style="margin-top: - | + | <img width="100%" style="margin-top: -65px;" src="https://static.igem.org/mediawiki/2017/e/e0/UU_team_niels.png"> |
<h2>Niels Geijsen</h2> | <h2>Niels Geijsen</h2> | ||
</div> | </div> | ||
− | < | + | <span style="display: block; font-size: 12px; padding: 0 20px;"> |
− | < | + | Professor of Regenerative Medicine<br> |
− | + | <div style="margin-top: 10px; font-weight: bold;">Bio</div> | |
− | < | + | <div class="team-bio" style="height: 239px;"> |
− | </ | + | Hello, I’m Niels Geijsen, and supervising the very first iGEM team of Utrecht University has been an immensely fun and inspiring adventure. Scientific challenges require for our brightest minds with diverse perspectives and backgrounds to come together. This is the Utrecht iGEM team: they are a group of smart, creative and ambitious students who have contributed a wide range of knowledge backgrounds, life experiences and hobbies to the project. It was such a fantastic experience to see how each member brought a special talent ranging from artistic drawing skills and video animation to photography, coding and web design. Together, they have truly outdone themselves. |
+ | <div class="lb"></div> | ||
+ | As a professor in regenerative medicine at the Hubrecht Institute and Utrecht University, my research team works work at the boundaries of stem cell biology and technology development with a particular focus on (genetic) muscle disease. I spent 10 years in Boston, as post-doctoral fellow at the Whitehead Institute and faculty at Massachusetts General Hospital, Harvard Medical School and the Harvard Stem Cell Institute, and I'm particularly looking forward to joining the team in Boston for the Giant Jamboree. | ||
+ | <div class="lb"></div> | ||
+ | Aside from science, I experiment in the kitchen, have a passion for food and wine, and enjoy outdoor activities such as sailing, hiking and skiing. My three active young boys are a daily joy and challenge. <br> | ||
+ | <div class="team-bio-grad"></div> | ||
+ | </div> | ||
+ | <div class="team-expand">…</div> | ||
+ | <br> | ||
+ | </span> | ||
+ | </div> | ||
+ | <div class="back" style="line-height: 15px; font-size: 11px;"></div></div> | ||
</div> | </div> | ||
− | <div class="timeline-content timeline-card js--fadeInLeft"> | + | <div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front"> |
<div class="timeline-img-header"> | <div class="timeline-img-header"> | ||
− | <img width="100%" style="margin-top: - | + | <img width="100%" style="margin-top: -10px;" src="https://static.igem.org/mediawiki/2017/6/66/UU_team_roos2.png"> |
<h2>Roos Masereeuw</h2> | <h2>Roos Masereeuw</h2> | ||
</div> | </div> | ||
− | < | + | <span style="display: block; font-size: 12px; padding: 0 20px;"> |
− | < | + | Professor of Experimental Pharmacology<br>Department of Pharmaceutical Sciences<br> |
− | < | + | <div style="margin-top: 10px; font-weight: bold;">Bio</div> |
− | < | + | <div class="team-bio" style="height: 215px;"> |
− | </ | + | Hi all, I am Roos Masereeuw, and since June 2015 I am full professor of Experimental Pharmacology at Utrecht Institute for Pharmaceutical Sciences in The Netherlands. I did a master’s in Biopharmaceutical Sciences at Leiden University, and my PhD in Pharmacology and Toxicology at Radboud University in Nijmegen (January 1997). |
+ | <div class="lb"></div> | ||
+ | Part of my PhD research and a postdoc period I did at National Institute for Environmental Sciences (NIEHS/NIH) in Research Triangle Park, North Carolina of USA. Between 1998 and 2015, I was first assistent and then associate professor at Radboud University Medical Centre in Nijmegen, after which I moved to Utrecht University. | ||
+ | <div class="lb"></div> | ||
+ | My research is focused on understanding the pathways that can be pharmacologically triggered to enhance repair and regeneration processes after organ injury. An example is the development of a bioartificial kidney device to partly replace kidney function. Next to science, I mostly enjoy outdoor sports when I can. This includes mountain hiking, mountain biking and running, but I also love watching Netflix series with my family, and visiting concerts and festivals. | ||
+ | <div class="team-bio-grad"></div> | ||
+ | </div> | ||
+ | <div class="team-expand">…</div> | ||
+ | <br> | ||
+ | </span> | ||
+ | </div> | ||
+ | <div class="back"></div></div> | ||
</div> | </div> | ||
− | <div class="timeline-content timeline-card js--fadeInLeft"> | + | <div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front"> |
<div class="timeline-img-header"> | <div class="timeline-img-header"> | ||
− | <img width="100%" | + | <img width="100%" src="https://static.igem.org/mediawiki/2017/7/7a/UU_team_guido3.png"> |
<h2>Guido van den Ackerveken</h2> | <h2>Guido van den Ackerveken</h2> | ||
</div> | </div> | ||
− | < | + | <span style="display: block; font-size: 12px; padding: 0 20px;"> |
− | + | Professor of Translational Plant & Microbial Biology, Dept. Biology, Utrecht University<br> | |
− | < | + | <div style="margin-top: 10px; font-weight: bold;">Bio</div> |
− | < | + | <div class="team-bio" style="height: 201px;"> |
− | </ | + | Hello, I’m Guido van den Ackerveken and it is my privilege to be one of the supervisors of the energetic and bright team of Utrecht University. I am trained as a molecular biologist in the field of plant- and microbiology, and have always worked of plant-pathogen interactions. I have a research team of about 10 people and in our research we reveal molecular mechanisms in the dialogue between plants and microorganisms, which we then try to translate to improve the resistance of food crops to infectious diseases. It is real fun to work with the iGEM bunch and to support the starting researchers in their ambitious programme. |
+ | <div class="lb"></div> | ||
+ | Outside of my busy work I try to find time for playing squash and running (I ran my first marathon this year), but also of course to enjoy being with my family. Never a dull moment :-) | ||
+ | <div class="team-bio-grad"></div> | ||
+ | </div> | ||
+ | <div class="team-expand">…</div> | ||
+ | <br> | ||
+ | </span> | ||
+ | </div> | ||
+ | <div class="back"></div></div> | ||
</div> | </div> | ||
− | <div class="timeline-content timeline-card js--fadeInLeft"> | + | <div class="timeline-content timeline-card js--fadeInLeft" style="height: 590px;"><div class="card"><div class="front"> |
<div class="timeline-img-header"> | <div class="timeline-img-header"> | ||
− | <img width="100%" style="margin-top: - | + | <img width="100%" style="margin-top: -40px;" src="https://static.igem.org/mediawiki/2017/thumb/4/4f/UU_team_margot.jpg/507px-UU_team_margot.jpg"> |
+ | <h2>Margot Koster</h2> | ||
+ | </div> | ||
+ | <span style="display: block; font-size: 12px; padding: 0 20px;"> | ||
+ | Assistant professor of Microbiology<br> | ||
+ | <div style="margin-top: 10px; font-weight: bold;">Bio</div> | ||
+ | <div class="team-bio" style="height: 215px;"> | ||
+ | I am a microbiologist and work at Utrecht University. My research interest focusses on two topics. One is to unravel the mechanisms involved in secretion of proteins and the role of secreted proteins in bacteria. This knowledge is important to understand how bacteria interact with their environment and can be used to optimize large scale production of proteins and vaccine development. | ||
+ | <div class="lb"></div> | ||
+ | My second topic of interest is teaching, and especially how to stimulate students to become independent and critical researchers. Therefore, assisting the first Utrecht iGEM team has been a great experience. In my spare time, I like to eat, watch movies and spend time with my family, which includes two daughters and a lazy cat. | ||
+ | <div class="team-bio-grad"></div> | ||
+ | </div> | ||
+ | <div class="team-expand">…</div> | ||
+ | <br> | ||
+ | </span> | ||
+ | </div> | ||
+ | <div class="back"></div></div> | ||
+ | </div> | ||
+ | |||
+ | <div class="timeline-content timeline-card js--fadeInLeft" style="height: 590px;"><div class="card"><div class="front"> | ||
+ | <div class="timeline-img-header"> | ||
+ | <img width="100%" style="margin-top: -75px;" src="https://static.igem.org/mediawiki/2017/thumb/9/95/UU_team_clara.jpg/398px-UU_team_clara.jpg"> | ||
<h2>Clara Martinez Mir</h2> | <h2>Clara Martinez Mir</h2> | ||
</div> | </div> | ||
− | < | + | <span style="display: block; font-size: 12px; padding: 0 20px;"> |
− | <b>Background</b> | + | <b>Background</b> Cancer, Stem Cells and Developmental Biology<br> |
− | < | + | <div style="margin-top: 10px; font-weight: bold;">Bio</div> |
− | < | + | <div class="team-bio" style="height: 201px;"> |
− | </ | + | Hello, my name is Clara (23) and I’m a first year Cancer, Stem Cells and Developmental biology Master student in Utrecht. I finished a Bachelor’s degree in Genetics in Barcelona last year and came to the Netherlands with a fellowship for post-graduate internships abroad, which allowed me to join Niels Geijsen’s lab for six months. |
+ | <div class="lb"></div> | ||
+ | I’m really happy to have been asked to write a piece as part of the team, even if I haven’t been there for the whole process. I joined the team during the summer period to help with some lab work that was being carried out in my former lab. It has been a great experience to help supervising the Utrecht iGEM team and its amazing people, full of joy and stress I have to admit. Now the deadline is getting closer and we are all preparing for the big final! Thank you, guys, for this opportunity! | ||
+ | <div class="team-bio-grad"></div> | ||
+ | </div> | ||
+ | <div class="team-expand">…</div> | ||
+ | <br> | ||
+ | </span> | ||
+ | </div> | ||
+ | <div class="back"></div></div> | ||
</div> | </div> | ||
+ | |||
</div> | </div> | ||
</div> | </div> | ||
Line 2,594: | Line 3,236: | ||
}); | }); | ||
− | + | for(var team_i = 0; team_i <= 1; team_i++) | |
{ | { | ||
− | + | $$(".team_members")[team_i].on("click", ".team-expand", function(event, element) | |
− | + | ||
− | + | ||
− | + | ||
{ | { | ||
− | v.removeClassName("flipped"); | + | var content = element.up(".timeline-content"); |
+ | var bio = content.select(".team-bio")[0].innerHTML; | ||
+ | |||
+ | $$(".team_members .card.flipped").each(function(v, k) | ||
+ | { | ||
+ | v.removeClassName("flipped"); | ||
+ | }); | ||
+ | |||
+ | content.select(".back")[0].update(bio + "<div class='team-close'>←</div>"); | ||
+ | content.select(".card")[0].addClassName("flipped"); | ||
}); | }); | ||
− | |||
− | |||
− | |||
− | |||
− | $$(".team_members")[ | + | $$(".team_members")[team_i].on("click", ".team-close", function(event, element) |
− | { | + | { |
− | + | var content = element.up(".timeline-content"); | |
− | + | content.select(".card")[0].removeClassName("flipped"); | |
− | }); | + | }); |
+ | } | ||
</script> | </script> | ||
Line 2,645: | Line 3,290: | ||
<div class="slider_for" style="float: left; width: 400px;"> | <div class="slider_for" style="float: left; width: 400px;"> | ||
<div><b>Utrecht University is a Dutch public university with over 50.000 students.</b> As our home university, they were our first sponsor. They have helped us generously with great financial support, meeting space, PR-facilities and the opportunity to use several labspaces on campus.</div> | <div><b>Utrecht University is a Dutch public university with over 50.000 students.</b> As our home university, they were our first sponsor. They have helped us generously with great financial support, meeting space, PR-facilities and the opportunity to use several labspaces on campus.</div> | ||
+ | <div><b>The Jong Alumni Netwerk (JAN) organizes activities and events to help support the careers of recent graduates by providing networking opportunities.</b> JAN agreed to financially support us to make this project possible.</div> | ||
+ | <div><b>The Hubrecht Institute is a leading research centre focusing on developmental biology and stem cell research.</b> Hubrecht institute offered us guidance and assistance with our project by facilitating a lab assistant for the work we had to do for our project.</div> | ||
<div><b>RIVM is the National Institute for Public Health and the Environment, which belongs to the Ministry of Health, Welfare and Sport of the Dutch government.</b> They offered a sponsorship to the Dutch iGEM teams based on an assignment titled ‘think before you do’, stimulating us to think about the societal implications that our project could have. We submitted a proposal and the RIVM offered us a €1500 grant to further our project.</div> | <div><b>RIVM is the National Institute for Public Health and the Environment, which belongs to the Ministry of Health, Welfare and Sport of the Dutch government.</b> They offered a sponsorship to the Dutch iGEM teams based on an assignment titled ‘think before you do’, stimulating us to think about the societal implications that our project could have. We submitted a proposal and the RIVM offered us a €1500 grant to further our project.</div> | ||
<div><b>DSM is a science-based company focusing on health, nutrition and materials to drive sustainable innovation.</b> DSM is active in many different markets, including medicine, energy and food, so developments in synthetic biology are of major interest to them. For our project, they sponsored us with €1000.</div> | <div><b>DSM is a science-based company focusing on health, nutrition and materials to drive sustainable innovation.</b> DSM is active in many different markets, including medicine, energy and food, so developments in synthetic biology are of major interest to them. For our project, they sponsored us with €1000.</div> | ||
Line 2,663: | Line 3,310: | ||
<div style="clear: both;"></div> | <div style="clear: both;"></div> | ||
− | <div class="sponsors_slider" style="width: 100%;"> | + | <div style="position: relative; width: 100%;"> |
− | <div style="width: 150px;"><img src="https://static.igem.org/mediawiki/2017/e/e0/Uu17logo.png"></div> | + | <div class="sponsors_slider" style="width: 100%;"> |
− | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/e/e6/Uurivm.png"></div> | + | <div style="width: 150px;"><img src="https://static.igem.org/mediawiki/2017/e/e0/Uu17logo.png"></div> |
− | <div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5b/Uudsm.jpeg"></div> | + | <div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/8/85/Uu-jongealumninetwerk.png"></div> |
− | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/9/92/Uutakara.jpg"></div> | + | <div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/2/2a/Uu-logo-hubrecht.png"></div> |
− | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/3/38/Uusnapgene.png"></div> | + | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/e/e6/Uurivm.png"></div> |
− | <div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/e/e3/Uuelabjournal.png"></div> | + | <div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5b/Uudsm.jpeg"></div> |
− | <div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5c/Uuidt.jpg"></div> | + | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/9/92/Uutakara.jpg"></div> |
− | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/4/43/Uumathworks.png"></div> | + | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/3/38/Uusnapgene.png"></div> |
− | <div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/6/67/Speechrepublic.png"></div> | + | <div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/e/e3/Uuelabjournal.png"></div> |
− | <div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/d/db/Uubiolabs.png"></div> | + | <div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5c/Uuidt.jpg"></div> |
− | <div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/0/05/Ufonds.png"></div> | + | <div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/4/43/Uumathworks.png"></div> |
+ | <div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/6/67/Speechrepublic.png"></div> | ||
+ | <div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/d/db/Uubiolabs.png"></div> | ||
+ | <div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/0/05/Ufonds.png"></div> | ||
+ | </div> | ||
+ | <div style="pointer-events: none; position: absolute; top: 0; left: 0; width: 30%; height: 100%; | ||
+ | background: -moz-linear-gradient(left, rgba(255,255,255,1) 0%, rgba(255,255,255,0) 100%); /* FF3.6-15 */ | ||
+ | background: -webkit-linear-gradient(left, rgba(255,255,255,1) 0%,rgba(255,255,255,0) 100%); /* Chrome10-25,Safari5.1-6 */ | ||
+ | background: linear-gradient(to right, rgba(255,255,255,1) 0%,rgba(255,255,255,0) 100%); /* W3C, IE10+, FF16+, Chrome26+, Opera12+, Safari7+ */ | ||
+ | filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#ffffff', endColorstr='#00ffffff',GradientType=1 ); /* IE6-9 */ | ||
+ | "></div> | ||
+ | <div style="pointer-events: none; position: absolute; top: 0; right: 0; width: 30%; height: 100%; | ||
+ | background: -moz-linear-gradient(left, rgba(255,255,255,0) 0%, rgba(255,255,255,1) 100%); /* FF3.6-15 */ | ||
+ | background: -webkit-linear-gradient(left, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* Chrome10-25,Safari5.1-6 */ | ||
+ | background: linear-gradient(to right, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* W3C, IE10+, FF16+, Chrome26+, Opera12+, Safari7+ */ | ||
+ | filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#00ffffff', endColorstr='#ffffff',GradientType=1 ); /* IE6-9 */ | ||
+ | "></div> | ||
+ | |||
</div> | </div> | ||
Line 2,712: | Line 3,376: | ||
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. | Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. | ||
<br><br> | <br><br> | ||
− | Wageningen validated the secreted-Cas9 and secreted-Cpf1 biobricks for us (BB_numbers). Members of the Wageningen team came to Utrecht to perform this validation together with members of the Utrecht team in our lab. Hek293T-cells were transfected with secreted-Cas9 or secreted-Cpf1 or with regular intracellular Cas9 or Cpf1 as a control. Medium of the cells was analysed on a western blot to compare extracellular protein expression. This tells us whether Cas9 and Cpf1 are truly being secreted or if they just leak out of the cells. The results of this validation can be found on the | + | <div style="float: right; margin-left: 35px; margin-bottom: 10px;"> |
+ | <img src="https://static.igem.org/mediawiki/2017/thumb/f/f5/Collab_WUR_UU.jpg/320px-Collab_WUR_UU.jpg"> | ||
+ | <br> | ||
+ | <span class="text-figure"> | ||
+ | Our collaboration with Wageningen has been great fun. | ||
+ | </span> | ||
+ | </div> | ||
+ | Wageningen validated the secreted-Cas9 and secreted-Cpf1 biobricks for us (BB_numbers). | ||
+ | Members of the Wageningen team came to Utrecht to perform this validation together with members of the Utrecht team in our lab. | ||
+ | Hek293T-cells were transfected with secreted-Cas9 or secreted-Cpf1 or with regular intracellular Cas9 or Cpf1 as a control. | ||
+ | Medium of the cells was analysed on a western blot to compare extracellular protein expression. | ||
+ | This tells us whether Cas9 and Cpf1 are truly being secreted or if they just leak out of the cells. | ||
+ | The results of this validation can be found on the <a onclick="return change_page('basic_part', 1)" href="basic_part">Parts Page</a> and the experimental page on <a onclick="return change_page('secretion', 1)" href="secretion">secreted Cas9 and Cpf1</a>. | ||
<br><br> | <br><br> | ||
− | In return, for the Wageningen team, we did a blind validation of some of their biobricks. We performed a CpxR BiFC measurement, where E.coli K12 cells were transformed with the pSB1C3-araCpBAD-CpxReYFPn-CpxReYFPc plasmid. Fluorescence was then measured over the course of 6 hours. | + | In return, for the Wageningen team, we did a blind validation of some of their biobricks. |
− | + | We performed a CpxR BiFC measurement, where E.coli K12 cells were transformed with the pSB1C3-araCpBAD-CpxReYFPn-CpxReYFPc plasmid. | |
− | + | Fluorescence was then measured over the course of 6 hours <a target=_BLANK href="https://2017.igem.org/Team:Wageningen_UR/Collaborations" class="url_external">(link)</a>. | |
− | + | We also performed a leucine zipper BiFC measurement, where we transformed split sfGFP and split Venus to E.coli K12 and also full sfGFP and full Venus as controls. | |
+ | Cells were then lysed and fluorescence was measured in the cell lysate <a target=_BLANK href="https://2017.igem.org/Team:Wageningen_UR/Collaborations" class="url_external">(link)</a>. | ||
<br><br> | <br><br> | ||
<h2 class="subhead" id="subhead-3">RIVM (National Institute for Public Health and the Environment)</h2> | <h2 class="subhead" id="subhead-3">RIVM (National Institute for Public Health and the Environment)</h2> | ||
− | As safety is a very important aspect in synthetic biology, we collaborated with the RIVM National Institute for Public Health and Environment of the Netherlands. They encouraged us to think about safety for different stakeholders. The information we gathered was summarized in an infographic, which we used to talk to the general public about synthetic biology and safety at an event organized by the RIVM | + | As safety is a very important aspect in synthetic biology, we collaborated with the RIVM National Institute for Public Health and Environment of the Netherlands. They encouraged us to think about safety for different stakeholders. |
+ | The information we gathered was summarized in an infographic, which we used to talk to the general public about synthetic biology and safety at an event organized by the RIVM (see <a onclick="return change_page('safety', 1)" href="safety">Safety</a>). | ||
<br><br> | <br><br> | ||
− | < | + | |
+ | <center> | ||
+ | <img onclick="openmodal('rivm-event')" style="cursor: pointer;" src="https://static.igem.org/mediawiki/2017/thumb/f/f7/8997_Kennisparade_%281%29.jpg/240px-8997_Kennisparade_%281%29.jpg"> | ||
+ | <br> | ||
+ | <span class="text-figure"> | ||
+ | Attending a RIVM event. <a href="javascript:void(0)" onclick="openmodal('rivm-event')" style="font-size: 11px;">Click for full size.</a> | ||
+ | </span> | ||
+ | </center> | ||
<br><br> | <br><br> | ||
<h2 class="subhead" id="subhead-4">Dutch national science platform "De Kennis van Nu"</h2> | <h2 class="subhead" id="subhead-4">Dutch national science platform "De Kennis van Nu"</h2> | ||
− | Besides working in the lab on creating a diagnostic tool, we also tried to reach out to the public to make our project (and science in general) accessible and understandable to everyone. To achieve this, we collaborated with ‘de Kennis van Nu’, a Dutch platform of the national public broadcasting organization, that brings different scientific themes to the general public in an understandable way. On this platform we explain the formation of Utrecht’s first team, our design and how we are trying to solve healthcare problems. More information and some of the short videos we made can be found on our | + | Besides working in the lab on creating a diagnostic tool, we also tried to reach out to the public to make our project (and science in general) accessible and understandable to everyone. To achieve this, we collaborated with ‘de Kennis van Nu’, a Dutch platform of the national public broadcasting organization, that brings different scientific themes to the general public in an understandable way. On this platform we explain the formation of Utrecht’s first team, our design and how we are trying to solve healthcare problems. |
− | + | More information and some of the short videos we made can be found on our <a onclick="return change_page('outreach', 1)" href="outreach">Outreach</a> page and on the website of <a target=_BLANK href="https://www.dekennisvannu.nl/site/special/iGEM-2017-studenten-ontwerpen-nieuw-leven/111" class="url_external">“De Kennis van Nu”</a>. | |
<br><br> | <br><br> | ||
Line 2,737: | Line 3,422: | ||
<br><br> | <br><br> | ||
− | < | + | |
+ | <center> | ||
+ | <img width="100%" src="https://static.igem.org/mediawiki/2017/thumb/b/be/Collab_dusseldorf_postcards.jpg/800px-Collab_dusseldorf_postcards.jpg"> | ||
+ | </center> | ||
</script> | </script> | ||
<script id="page-achievements" type="text/template"> | <script id="page-achievements" type="text/template"> | ||
+ | <div style="position: absolute;top: 0;right: -250px;width: 200px;text-align: center;border: 1px solid gold;padding: 10px;border-radius: 10px;box-sizing: border-box;background: #ffedb8;"> | ||
+ | <div style=" | ||
+ | font-weight: bold; | ||
+ | font-size: 20px; | ||
+ | color: #c48b00; | ||
+ | border-bottom: 1px solid #ffd700; | ||
+ | padding-bottom: 15px; | ||
+ | margin-bottom: 15px; | ||
+ | ">Awards</div> | ||
+ | <img width="100" src="https://static.igem.org/mediawiki/2017/thumb/a/a2/UU_gold_medal.png/240px-UU_gold_medal.png"><br><div style="font-size: 15px;color: #c48b00; border-bottom: 1px solid #ffd700; padding-bottom: 15px; margin-top: 5px;">Gold medal</div> | ||
+ | <div style="margin-top: 15px; margin-bottom: 10px; font-size: 15px;color: #c48b00;"><b>Nominated</b><br />Best integrated human practices</div> | ||
+ | </div> | ||
<div class="page-heading">Achievements</div> | <div class="page-heading">Achievements</div> | ||
− | This page | + | This page gives an overview of the achievements of our team. These will be presented as the medal criteria we fulfilled to acquire the various medals. For several criteria we will provide a link to the page with more information on that item. |
<br><br> | <br><br> | ||
Line 2,757: | Line 3,457: | ||
<b>Deliverables</b><br> | <b>Deliverables</b><br> | ||
We have delivered all the required items on the iGEM deliverables page.<br> | We have delivered all the required items on the iGEM deliverables page.<br> | ||
− | <table border="0" cellspacing="0" cellpadding="0" width="600"> | + | <table class="uu-table" border="0" cellspacing="0" cellpadding="0" width="600" style="margin-top: 10px !important;"> |
<tr> | <tr> | ||
<td width="250"> | <td width="250"> | ||
<ul> | <ul> | ||
− | <li /><a href="">Team wiki</a> | + | <li /><a onclick="return change_page('home', 1)" href="https://2017.igem.org/Team:Utrecht/">Team wiki</a> |
− | <li /><a href="">Project attribution</a> | + | <li /><a onclick="return change_page('attributions', 1)" href="attributions">Project attribution</a> |
− | <li /><a href="">Team poster</a> | + | <li /><a onclick="return change_page('posters', 1)" href="posters">Team poster</a> |
− | <li / | + | <li />Team presentation |
− | <li /><a href="">Safety forms</a> | + | <li /><a target=_BLANK href="https://2017.igem.org/Safety/Final_Safety_Form?team_id=2351" class="url_external">Safety forms</a> |
</ul> | </ul> | ||
</td> | </td> | ||
<td width="350"> | <td width="350"> | ||
<ul> | <ul> | ||
− | <li /><a href="">Judging form</a> | + | <li /><a target=_BLANK href="https://igem.org/2017_Judging_Form?id=2351" class="url_external">Judging form</a> |
− | <li /><a href="">Registry part pages</a> | + | <li /><a onclick="return change_page('basic_part', 1)" href="basic_part">Registry part pages</a> |
− | <li /><a href="">Sample submission</a> | + | <li /><a target=_BLANK href="http://parts.igem.org/cgi/dna_transfer/batch_list.cgi?group_id=2850" class="url_external">Sample submission</a> |
− | <li /><a | + | <li /><a onclick="return change_page('interlab-study', 1)" href="interlab-study">Contribution to InterLab Study</a> |
− | + | ||
</ul> | </ul> | ||
</td> | </td> | ||
Line 2,789: | Line 3,488: | ||
<div style="float: left; width: 100%; margin: 0;"> | <div style="float: left; width: 100%; margin: 0;"> | ||
<b>Validate functionality of BioBrick</b><br> | <b>Validate functionality of BioBrick</b><br> | ||
− | + | BioBrick Part <a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351012" class="url_external">BBa_K2351012</a> (secreted Cpf1) has been validated. This BioBrick is very special since our team successfully secreted CRISPR-associated proteins from HEK293 cells. | |
− | + | ||
To our knowledge, this is the first time that Cpf1 has ever been expressed outside of the cell. | To our knowledge, this is the first time that Cpf1 has ever been expressed outside of the cell. | ||
+ | <br><br> | ||
+ | › <a onclick="return change_page('basic_part', 1)" href="basic_part">View submitted parts.</a> | ||
</div> | </div> | ||
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | <div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | ||
Line 2,797: | Line 3,497: | ||
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. In addition, we worked with the Rathenau Institute and the RIVM on our Human Practices and safety considerations. | Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. In addition, we worked with the Rathenau Institute and the RIVM on our Human Practices and safety considerations. | ||
<br><br> | <br><br> | ||
− | Furthermore, we contributed a postcard design to the Düsseldorf Cologne postcards campaign. Although these are not, strictly speaking, collaborations, we have attended several meet-ups with Dutch and other European iGEM teams to exchange ideas. An overview of our collaboration efforts can be found on the | + | Furthermore, we contributed a postcard design to the Düsseldorf Cologne postcards campaign. Although these are not, strictly speaking, collaborations, we have attended several meet-ups with Dutch and other European iGEM teams to exchange ideas. An overview of our collaboration efforts can be found on the <a onclick="return change_page('collaborations', 1)" href="collaborations">Collaborations page</a>. |
</div> | </div> | ||
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | <div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | ||
<b>Human Practices</b><br> | <b>Human Practices</b><br> | ||
− | Our team has contacted professionals from many different backgrounds to find the setting wherein the OUTCASST system would be of most use and to identify where the requirements of the intended application affect the design of our tool. Through a series of interviews with several experts, we came to the conclusion that our tool would be most useful in diagnostics and pathogen detection in particular. By talking to a representative from ‘Doctors without borders’ and a parasitology expert, we discovered that Chagas disease is a neglected tropical disease with a large impact, yet a good diagnostic tool for this disease is still missing. Therefore, we chose to focus on Chagas disease in the further design of our tool. ( | + | Our team has contacted professionals from many different backgrounds to find the setting wherein the OUTCASST system would be of most use and to identify where the requirements of the intended application affect the design of our tool. Through a series of interviews with several experts, we came to the conclusion that our tool would be most useful in diagnostics and pathogen detection in particular. By talking to a representative from ‘Doctors without borders’ and a parasitology expert, we discovered that Chagas disease is a neglected tropical disease with a large impact, yet a good diagnostic tool for this disease is still missing. Therefore, we chose to focus on Chagas disease in the further design of our tool. Read more about our <a onclick="return change_page('stakeholders', 1)" href="stakeholders">end users</a>. |
<br><br> | <br><br> | ||
− | Besides the interviews to find the focus of our project, we also worked on outreach. In collaboration with ‘De Kennis van Nu’, a Dutch platform that brings different scientific themes to the general public, we made videos and wrote blogs about synthetic biology, the iGEM competition, lab safety, tropical diseases and our project. To raise more awareness for the competition and our project within our university, we wrote articles in several student magazines. ( | + | Besides the interviews to find the focus of our project, we also worked on outreach. In collaboration with ‘De Kennis van Nu’, a Dutch platform that brings different scientific themes to the general public, we made videos and wrote blogs about synthetic biology, the iGEM competition, lab safety, tropical diseases and our project. To raise more awareness for the competition and our project within our university, we wrote articles in several student magazines. Read more about our <a onclick="return change_page('outreach', 1)" href="outreach">outreach</a>. |
</div> | </div> | ||
</div> | </div> | ||
Line 2,814: | Line 3,514: | ||
<div style="float: left; width: 100%; margin: 0;"> | <div style="float: left; width: 100%; margin: 0;"> | ||
<b>Integrated Human Practices</b><br> | <b>Integrated Human Practices</b><br> | ||
− | We incorporated the feedback we got from various professionals into the design of our final product. Not only did the information we gained make us choose for Chagas disease as the focus of our project, it also made us think about the way our system could be used on location. Through our conversations with specialists, we realized the importance of simplicity in use and resistance to varying temperatures and humidity. Only tools which take these factors into account can be used without a need for further lab equipment or trained personnel. Furthermore, with safety considerations in mind, we designed our device to keep our system separated from the outside world, making it impossible for the GMO’s to escape into the environment. ( | + | We incorporated the feedback we got from various professionals into the design of our final product. Not only did the information we gained make us choose for Chagas disease as the focus of our project, it also made us think about the way our system could be used on location. Through our conversations with specialists, we realized the importance of simplicity in use and resistance to varying temperatures and humidity. Only tools which take these factors into account can be used without a need for further lab equipment or trained personnel. Furthermore, with safety considerations in mind, we designed our device to keep our system separated from the outside world, making it impossible for the GMO’s to escape into the environment. Read more about our <a onclick="return change_page('product-design', 1)" href="product-design">design considerations</a>. |
</div> | </div> | ||
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | <div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | ||
<b>Model your project</b><br> | <b>Model your project</b><br> | ||
− | At the same time, our team worked on modeling our system. They first summarized the kinetics of our fusion proteins in a network of reactions. With this reaction network, we demonstrated that the system contains negative feedback on its own sensitivity and give some suggestions on how to alleviate that problem with additional bio-circuitry components. In addition, we show that the precision of the system may be increased by usage of a weaker protease. We subsequently used ODE reaction equations to test if differences in substrate affinity or protein production rates can alleviate sensitivity problems and if so, how. | + | At the same time, our team worked on modeling our system. They first summarized the kinetics of our fusion proteins in a network of reactions. With this reaction network, we demonstrated that the system contains negative feedback on its own sensitivity and give some suggestions on how to alleviate that problem with additional bio-circuitry components. In addition, we show that the precision of the system may be increased by usage of a weaker protease. We subsequently used ODE reaction equations to test if differences in substrate affinity or protein production rates can alleviate sensitivity problems and if so, how. Read more about our <a onclick="return change_page('modeling-and-mathematics', 1)" href="modeling-and-mathematics">modeling efforts</a>. |
+ | </div> | ||
+ | <div style="float: left; width: 100%; margin: 0; margin-top: 20px;"> | ||
+ | <b>Improve a previous part</b><br> | ||
+ | The part we improved is <a target=_BLANK href="http://parts.igem.org/Part:BBa_K1774001" class="url_external">BBa_K1774001</a>. This part is <i>S. pyogenes</i> Cas9, submitted by the University of Hong Kong 2015 iGEM team. To improve this part we did three things: codon optimize it for mammalian cells, add a signal sequence for secretion from mammalian cells and add a His-tag. Modifying the Cas9 protein in this way makes it possible to get it produced and secreted from mammalian cells instead of bacteria. It can then be easily isolated and purified using the His-tag. Isolating the protein from mammalian cells instead of bacteria makes this Cas9 more suitable for clinical applications in humans or human cells. We therefore think this version of S. pyogenes Cas9 has added value in future medicine and thus is an improvement over the bacterial-produced version of <i>S. pyogenes</i> Cas9. | ||
+ | <br><br> | ||
+ | The improved part was submitted as <a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351013" class="url_external">BBa_K2351013</a>. | ||
+ | <br><br> | ||
+ | › <a onclick="return change_page('basic_part', 1)" href="basic_part">View all submitted parts.</a> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 2,829: | Line 3,537: | ||
<div class="page-heading">Attribution and acknowledgement</div> | <div class="page-heading">Attribution and acknowledgement</div> | ||
− | The Utrecht iGEM team performed most of the experiments, funding, PR | + | The Utrecht iGEM team performed most of the experiments, funding, PR, human practices and other tasks on their own. All additional help is acknowledged below. |
+ | For a breakdown of the contribution of individual team members, see the <a onclick="return change_page('team', 1)" href="team">Team page</a>. | ||
<br><br> | <br><br> | ||
Line 2,867: | Line 3,576: | ||
<br><br> | <br><br> | ||
Thank you! | Thank you! | ||
+ | </script> | ||
+ | |||
+ | <script id="page-basic_part" type="text/template"> | ||
+ | <div class="page-heading">BioBricks - Basic Parts</div> | ||
+ | |||
+ | This page contains an overview of all the basic BioBricks we created for our project.<br> | ||
+ | Interested in our composite parts? You can find them <a onclick="return change_page('composite_part', 1)" href="composite_part">here</a>. | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | <table class="biobricktable" style="width: 100%; font-size: 12px; text-align: left;"> | ||
+ | <tr style="font-size: 15px; font-weight: bold;"> | ||
+ | <td width="150">Number</td> | ||
+ | <td width="200">Name</td> | ||
+ | <td>Short description</td> | ||
+ | </tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351000" class="url_external">BBa_K2351000</a></td><td>Ig lambda-2 chain V region signal sequence</td><td>Allows for proteins to be secreted</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351001" class="url_external">BBa_K2351001</a></td><td><b>Best basic part:</b> dAsCpf1</td><td>DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351002" class="url_external">BBa_K2351002</a></td><td>nCas9 </td><td>A cas9 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component that contains illegal restriction sites.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351003" class="url_external">BBa_K2351003</a></td><td>nCpf1</td><td>A cpf1 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component that contains illegal restriction sites.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351004" class="url_external">BBa_K2351004</a></td><td>Glycine [3x] linked histidine[6x] tag</td><td>Basic histidine tag with preceding glycine linker.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351007" class="url_external">BBa_K2351007</a></td><td>nCas9 </td><td>A cas9 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351008" class="url_external">BBa_K2351008</a></td><td>nCpf1</td><td>A cpf1 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351011" class="url_external">BBa_K2351011</a></td><td>dCpf1</td><td>DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351012" class="url_external">BBa_K2351012</a></td><td>sCpf1</td><td>Phytobrick* // Cpf1 that will be secreted from humane cells.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351013" class="url_external">BBa_K2351013</a></td><td>dCpf1</td><td>Phytobrick*// DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351014" class="url_external">BBa_K2351014</a></td><td>sCas9</td><td>Phytobrick* // Cas9 that will be secreted from humane cells.</td></tr> | ||
+ | </table> | ||
+ | |||
+ | <style type="text/css"> | ||
+ | .biobricktable { border: 0 !important; margin: 0 !important; } | ||
+ | .biobricktable tr:nth-child(even) td { background: #f7f7f7; } | ||
+ | .biobricktable td { padding: 5px !important; border: 0 !important; vertical-align: middle !important; } | ||
+ | </style> | ||
+ | |||
+ | </script> | ||
+ | |||
+ | <script id="page-composite_part" type="text/template"> | ||
+ | <div class="page-heading">BioBricks - Composite Parts</div> | ||
+ | |||
+ | This page contains an overview of all the composite BioBricks we created for our project.<br> | ||
+ | Interested in our basic parts? You can find them <a onclick="return change_page('basic_part', 1)" href="basic_part">here</a>. | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | <table class="biobricktable" style="width: 100%; font-size: 12px; text-align: left;"> | ||
+ | <tr style="font-size: 15px; font-weight: bold;"> | ||
+ | <td width="150">Number</td> | ||
+ | <td width="200">Name</td> | ||
+ | <td>Short description</td> | ||
+ | </tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351005" class="url_external">BBa_K2351005</a></td><td><b>Best composite part:</b> secreted Cas9</td><td>Cas9 that will be secreted from humane cells.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351006" class="url_external">BBa_K2351006</a></td><td>Secreted Cpf1</td><td>Cpf1 that will be secreted from humane cells.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351009" class="url_external">BBa_K2351009</a></td><td>sCas9</td><td>Cas9 that will be secreted from humane cells.</td></tr> | ||
+ | <tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351010" class="url_external">BBa_K2351010</a></td><td>sCpf1</td><td>Cpf1 that will be secreted from humane cells.</td></tr> | ||
+ | </table> | ||
+ | |||
+ | <style type="text/css"> | ||
+ | .biobricktable { border: 0 !important; margin: 0 !important; } | ||
+ | .biobricktable tr:nth-child(even) td { background: #f7f7f7; } | ||
+ | .biobricktable td { padding: 5px !important; border: 0 !important; vertical-align: middle !important; } | ||
+ | </style> | ||
+ | |||
+ | </script> | ||
+ | |||
+ | <script id="page-posters" type="text/template"> | ||
+ | <div class="page-heading">Team Posters</div> | ||
+ | |||
+ | Displayed here are the posters that we used to present our team during various events. | ||
+ | |||
+ | <br><br> | ||
+ | |||
+ | <div style="width: 100%; text-align: center;"> | ||
+ | |||
+ | <div class="outreach-video"> | ||
+ | <div style="width: 100%; text-align: center;"> | ||
+ | <img style="width: 150px;" src="https://static.igem.org/mediawiki/2017/thumb/b/b8/UU-poster-portrait.png/423px-UU-poster-portrait.png"> | ||
+ | </div> | ||
+ | |||
+ | <div class="description"><a target=_BLANK href="https://static.igem.org/mediawiki/2017/5/56/UU-poster-portrait-fullsize.pdf" class="pdf">Download poster</a></div> | ||
+ | </div> | ||
+ | |||
+ | <div class="outreach-video"> | ||
+ | <div style="width: 100%; text-align: center;"> | ||
+ | <img style="width: 200px;" src="https://static.igem.org/mediawiki/2017/d/da/UU-poster-landscape.png"> | ||
+ | </div> | ||
+ | |||
+ | <div class="description"><a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/4e/UU-poster-landscape-fullsize.pdf" class="pdf">Download poster</a></div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | <div style="clear: both;"></div> | ||
+ | |||
+ | <style type="text/css"> | ||
+ | .outreach-video | ||
+ | { | ||
+ | width: 230px; | ||
+ | padding: 20px; | ||
+ | background: #fafafa; | ||
+ | float: left; | ||
+ | border: 2px solid #f6f6f6; | ||
+ | margin: 0 30px 0 0; | ||
+ | display: inline-block; | ||
+ | text-align: center; | ||
+ | } | ||
+ | |||
+ | .outreach-video.right { float: right; margin-right: 0; } | ||
+ | |||
+ | .outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; } | ||
+ | |||
+ | .outreach-video .description { font-size: 12px; line-height: 20px; display: inline-block; } | ||
+ | </style> | ||
+ | |||
</script> | </script> | ||
Line 2,994: | Line 3,817: | ||
}, | }, | ||
"secretion" : { | "secretion" : { | ||
− | 1: " | + | 1: "Secreting functional Cas9 and Cpf1", |
2: "Introduction", | 2: "Introduction", | ||
3: "Methods", | 3: "Methods", | ||
4: "Results", | 4: "Results", | ||
− | 5: "Discussion" | + | 5: "Discussion", |
+ | 6: "References", | ||
+ | 7: "Supplementary" | ||
}, | }, | ||
"mesa-replication" : { | "mesa-replication" : { | ||
Line 3,007: | Line 3,832: | ||
5: "Results", | 5: "Results", | ||
6: "Discussion", | 6: "Discussion", | ||
− | 7: "Supplementary", | + | 7: "References", |
+ | 8: "Supplementary", | ||
}, | }, | ||
"outcasst" : { | "outcasst" : { | ||
Line 3,019: | Line 3,845: | ||
"modeling-and-mathematics" : { | "modeling-and-mathematics" : { | ||
1: "Modeling and Mathematics", | 1: "Modeling and Mathematics", | ||
− | 2: " | + | 2: "False positive reduction", |
− | 3: " | + | 3: "Substrate trapping reduction", |
+ | 4: "Effects of diffusion in membrane", | ||
+ | 5: "References" | ||
}, | }, | ||
"interlab-study" : { | "interlab-study" : { | ||
Line 3,041: | Line 3,869: | ||
2: "Toolkit design solutions", | 2: "Toolkit design solutions", | ||
3: "Additional considerations", | 3: "Additional considerations", | ||
+ | 4: "References" | ||
}, | }, | ||
"outreach" : {}, | "outreach" : {}, | ||
Line 3,068: | Line 3,897: | ||
6: "Administrative assistance", | 6: "Administrative assistance", | ||
7: "Final word" | 7: "Final word" | ||
− | } | + | }, |
+ | "basic_part" : {}, | ||
+ | "composite_part" : {}, | ||
+ | "posters" : {} | ||
}; | }; | ||
Line 3,084: | Line 3,916: | ||
} | } | ||
− | function change_page(page) | + | function dx_hide_widgets(same_page) |
+ | { | ||
+ | if($$("body")[0].getAttribute("data-page") == "home") | ||
+ | { | ||
+ | if(same_page) | ||
+ | { | ||
+ | for(var i = 1; i <= 4; i++) | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover("hide"); | ||
+ | |||
+ | if(i == 1) | ||
+ | { | ||
+ | jQuery("#link-" + i).addClass("selected"); | ||
+ | jQuery("#link-" + i).addClass("pulsing"); | ||
+ | jQuery("#figure-" + i).fadeIn("5"); | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#figure-" + i).fadeOut("5"); | ||
+ | } | ||
+ | } | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | for(var i = 1; i <= 4; i++) | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover({ | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } } | ||
+ | }).dxPopover("hide"); | ||
+ | } | ||
+ | } | ||
+ | } | ||
+ | else if($$("body")[0].getAttribute("data-page") == "product-design") | ||
+ | { | ||
+ | if(same_page) | ||
+ | { | ||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover("hide"); | ||
+ | |||
+ | if(i == 1) | ||
+ | { | ||
+ | jQuery("#link-" + i).addClass("selected"); | ||
+ | jQuery("#link-" + i).addClass("pulsing"); | ||
+ | jQuery("#figure-" + i).fadeIn("5"); | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | jQuery("#link-" + i).removeClass("selected"); | ||
+ | jQuery("#figure-" + i).fadeOut("5"); | ||
+ | } | ||
+ | } | ||
+ | } | ||
+ | else | ||
+ | { | ||
+ | for(var i = 1; i <= 9; i++) | ||
+ | { | ||
+ | jQuery("#popover-" + i).dxPopover({ | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } } | ||
+ | }).dxPopover("hide"); | ||
+ | } | ||
+ | } | ||
+ | } | ||
+ | |||
+ | if($$(".ref").length > 0) | ||
+ | { | ||
+ | $$(".ref").each(function(v, k) | ||
+ | { | ||
+ | jQuery("#tooltip-" + v.getAttribute("data-id")).dxTooltip("hide"); | ||
+ | }); | ||
+ | } | ||
+ | } | ||
+ | |||
+ | function change_page(page, return_false) | ||
{ | { | ||
if(typeof page_menus[page] !== "undefined") | if(typeof page_menus[page] !== "undefined") | ||
Line 3,110: | Line 4,016: | ||
} | } | ||
− | + | dx_hide_widgets(); | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
// scroll to top | // scroll to top | ||
Line 3,143: | Line 4,041: | ||
$$(".top-menu")[0].removeClassName("active"); | $$(".top-menu")[0].removeClassName("active"); | ||
$$(".menu-container")[0].removeClassName("active"); | $$(".menu-container")[0].removeClassName("active"); | ||
+ | |||
+ | // references | ||
+ | if($$(".page-container i.ref").length > 0) | ||
+ | { | ||
+ | $$(".page-container i.ref").each(function(v, k) | ||
+ | { | ||
+ | var ref_key = parseInt(v.innerHTML); | ||
+ | var reference; | ||
+ | |||
+ | var i = 1; | ||
+ | $$(".references>li").each(function(ref_v, ref_k) | ||
+ | { | ||
+ | if(i == ref_key) | ||
+ | { | ||
+ | reference = ref_v; | ||
+ | |||
+ | jQuery("#tooltip-" + v.getAttribute("data-id")).dxTooltip({ | ||
+ | target: v, | ||
+ | showEvent: 'click', | ||
+ | hideEvent: "", | ||
+ | closeOnOutsideClick: true, | ||
+ | width: 0, | ||
+ | height: 0, | ||
+ | visible: true, | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } }, | ||
+ | contentTemplate: "" | ||
+ | }).dxTooltip("hide"); | ||
+ | |||
+ | jQuery("#tooltip-" + v.getAttribute("data-id")).dxTooltip({ | ||
+ | width: "auto", | ||
+ | height: "auto", | ||
+ | animation: { show: { type: 'fade', from: 0, to: 1 }, hide: { type: 'fade', to: 0 } }, | ||
+ | contentTemplate: function () { | ||
+ | return "<div style='text-align: left;'><b>" + ref_v.getAttribute("data-title") + "</b><br>" + ref_v.getAttribute("data-author") + "<br>Link: <a target=_BLANK href='" + ref_v.getAttribute("data-link") + "'>click here</a><br><br><div class='ref-close'>View full reference</div></div>"; | ||
+ | }, | ||
+ | }); | ||
+ | |||
+ | throw $break; | ||
+ | } | ||
+ | |||
+ | i++; | ||
+ | }); | ||
+ | |||
+ | console.log(v, reference); | ||
+ | }); | ||
+ | } | ||
if(!first_load) | if(!first_load) | ||
Line 3,150: | Line 4,094: | ||
$$(".page-container")[0].removeClassName("hidden"); | $$(".page-container")[0].removeClassName("hidden"); | ||
}, 100); | }, 100); | ||
+ | } | ||
+ | |||
+ | if(return_false) | ||
+ | { | ||
+ | history.pushState({page: page}, page, page); | ||
+ | |||
+ | return false; | ||
} | } | ||
} | } | ||
+ | |||
+ | jQuery(window).on("popstate", function(e) { | ||
+ | if(typeof e.originalEvent !== "undefined") | ||
+ | { | ||
+ | if(e.originalEvent.state !== "undefined") | ||
+ | { | ||
+ | if(e.originalEvent.state == null) | ||
+ | change_page("home"); | ||
+ | else if(e.originalEvent.state.page !== "undefined") | ||
+ | change_page(e.originalEvent.state.page); | ||
+ | } | ||
+ | } | ||
+ | }); | ||
function getSectionByPage(page) | function getSectionByPage(page) | ||
Line 3,161: | Line 4,125: | ||
else | else | ||
{ | { | ||
− | var section = $$(".section[data-url='" + page + "']")[0]; | + | if($$(".section[data-url='" + page + "']").length == 0) |
− | + | key = "home"; | |
− | + | else | |
+ | { | ||
+ | var section = $$(".section[data-url='" + page + "']")[0]; | ||
+ | |||
+ | if(typeof section.up(".sections") !== "undefined") | ||
+ | key = section.up(".sections").getAttribute("data-key"); | ||
+ | else | ||
+ | key = "home"; | ||
+ | } | ||
} | } | ||
Line 3,183: | Line 4,155: | ||
"contribution": "interlab-study", | "contribution": "interlab-study", | ||
"model": "modeling-and-mathematics", | "model": "modeling-and-mathematics", | ||
− | "improve": " | + | "improve": "achievements", |
− | + | ||
− | + | ||
− | + | ||
"hp/silver": "stakeholders", | "hp/silver": "stakeholders", | ||
"hp/gold_integrated": "product-design", | "hp/gold_integrated": "product-design", | ||
Line 3,207: | Line 4,176: | ||
{ | { | ||
if(this.getAttribute("data-key") != "home") | if(this.getAttribute("data-key") != "home") | ||
+ | { | ||
document.body.addClassName("sections_active"); | document.body.addClassName("sections_active"); | ||
+ | |||
+ | dx_hide_widgets(1); | ||
+ | } | ||
this.addClassName("active"); | this.addClassName("active"); | ||
Line 3,237: | Line 4,210: | ||
var page = element.getAttribute("data-url"); | var page = element.getAttribute("data-url"); | ||
− | history.pushState({}, title, page); | + | history.pushState({page: page}, title, page); |
change_page(page); | change_page(page); | ||
Line 3,267: | Line 4,240: | ||
page = "/igemsite/"; | page = "/igemsite/"; | ||
− | history.pushState({}, title, page); | + | history.pushState({page: page}, title, page); |
} | } | ||
}); | }); | ||
Line 3,293: | Line 4,266: | ||
jQuery("html, body").animate({ scrollTop: pos.y - 200 }, 500); | jQuery("html, body").animate({ scrollTop: pos.y - 200 }, 500); | ||
+ | }); | ||
+ | |||
+ | // reference click | ||
+ | document.body.on("click", ".ref-close", function(event, element) | ||
+ | { | ||
+ | $$(".menu-container .item").each(function(v, k) | ||
+ | { | ||
+ | if(v.innerHTML.indexOf("Reference") > 0) | ||
+ | { | ||
+ | var pos = getPos($("subhead-" + v.getAttribute("data-key"))); | ||
+ | |||
+ | jQuery("html, body").animate({ scrollTop: pos.y - 200 }, 500); | ||
+ | |||
+ | throw $break; | ||
+ | } | ||
+ | }); | ||
}); | }); | ||
Line 3,305: | Line 4,294: | ||
}); | }); | ||
}); | }); | ||
+ | </script> | ||
+ | |||
+ | <script id="modal-rivm-event" type="text/template"> | ||
+ | <img width="650" src="https://static.igem.org/mediawiki/2017/f/f7/8997_Kennisparade_%281%29.jpg"> | ||
+ | </script> | ||
+ | |||
+ | <script id="modal-safetyposter" type="text/template"> | ||
+ | <img width="650" src="https://static.igem.org/mediawiki/2017/a/a4/Uu_fullsize_Safety-poster-RIVM-engels.png"> | ||
</script> | </script> | ||
Line 3,558: | Line 4,555: | ||
box-shadow: 0 1px 3px -1px rgba(0, 0, 0, 0.6); | box-shadow: 0 1px 3px -1px rgba(0, 0, 0, 0.6); | ||
} | } | ||
− | .timeline a:hover, a:active, a:focus { | + | .timeline a:hover, .timeline a:active, .timeline a:focus { |
background: #32408f; | background: #32408f; | ||
color: #FFFFFF; | color: #FFFFFF; |
Latest revision as of 00:24, 15 December 2017
<!DOCTYPE html>
×
There are also some things in the OUTCASST toolkit that need to be changed in comparison to the experimental approach in order to prepare the system for diagnosing Chagas disease. One of these things is the use of HEK293T cells, which need a very stable environment to stay alive. In the eventual tool, we will need to use cells that are more resistant to environmental fluctuations yet still cannot survive outside of the device (Patrick van Zon and Pieter-Jaap Krijtenburg, University Medical Center of Utrecht: genome diagnostics.) We also used a fluorescence signal as output in the experiments, which requires a fluorescence microscope to analyse the test results. To avoid the need of these and other equipment, we would ideally use an output signal in the form of visible light or, more promisingly, a change of color that is visible to the naked eye. Another thing we should keep in mind is the time it takes to get the results from our test device (Marit de Wit, Doctors without Borders).
There are also technical aspects that should be considered, like the method used for lysis of the parasites in the sample. Lysis needs to occur to get free DNA, i.e. a hypotonic solution (Jaap van Hellemond, Erasmus University Medical Center Rotterdam: parasitology). If a colorant is used as reporter mechanism, we need to remove the red color of heme groups from red blood cells, too, as it would interfere with the output signal.
Lastly, we should consider the target DNA we want to use to detect the parasites. Things that require careful consideration are GC-content, which has influence on binding affinity and specificity of the guide RNA. Specificity needs to be mutation specific as a strand with different base pairs should, ideally, not activate the system (Hans Bos and Hugo Snippert, University Medical Center Utrecht: cancer research).
Toolkit design solutions
The OUTCASST toolkit has a closed box design, wherein all the components to perform the test are present in distinct compartments, separated by seals. These seals can be broken by applying pressure on them.As was stated earlier, a lot of variables need to be kept constant to keep the HEK293T cells alive. Because of this, it is not feasible to use these cells in our design. Instead, we opt to use air-dried cells from the anhydrobiotic insect, Polypelidum vanderplanki, which can be stored at room temperature for 251 days and can restart proliferating again after rehydration 1. This way the shelf life of our tool can also be prolonged. To prevent the risk of our GMO getting out in the environment, several mechanisms and kill-switches will be incorporated in the cells, so they can only survive in our closed box system, in their resurgent state. This can be done by manipulating the metabolism, so that the cells can’t produce a crucial substance for survival, e.g. an amino acid, which will be added in the toolkit medium. In case the cells get out of the toolkit, they will die because of the absence of the crucial substance.
Rehydration can be done with a suitable medium. This has to be done one hour before use. The seal between the dried insect cells and the medium can be broken to pump the medium manually to the cells. After rehydration, the medium can be manually pumped to the waste compartment.
The next step is to add the two guide RNA’s to the revived cells. The gRNA’s are present in the design as dry powder to prevent premature degradation. This time, two seals need to be broken. First, the gRNA needs to be dissolved with the contents of another medium compartment. Then the medium with gRNA can be pumped to the cells where they will bind to dCas9 and dCpf1 on the extracellular cell membrane. This process takes about 10 minutes and after that, the medium with excessive gRNA can also be pumped to the waste compartment.
These are the preparation steps before the real diagnosis can start. First off, a blood sample has to be taken from a patient that might be infected with Chagas disease. To prevent the blood from clotting, heparin or EDTA can be added to the sample. The blood sample can then be introduced to the tool, after which the device needs to be sealed. To get access to the parasite DNA, all cells need to be lysed, including the red blood cells. This is done with a lysis buffer, a hypotonic solution.
The next step is to pump everything to a next compartment, wherein there are heme-binding compounds (such as HEBP) linked to the inside surface to decolorize the sample. Then a hypertonic resetting buffer is added to return the sample to isotonic levels, in order to prevent damage to the detector cells.
Now, the seal separating the sample from the cells can be broken and the sample can be introduced to the actual sensor. A color signal will appear after about 10 to 12 hours in case the patiënt is infected and will continue to become more visible after that.
The output signal will be a blue chromoprotein. This way, the sample color will become blue (or purple if there is still a little bit of heme in the sample) upon detection of the targeted DNA sequence.
After use, the tool should be disposed of in a safe manner preventing it to end up in the environment. Therefore, there will be a disposal guideline added in the toolkit manual. The test can be disposed of in a self-sealing bag, which can be boiled after the test is completed to minimize the risks.
Additional considerations
There are still a lot of things that should be considered to make the OUTCASST tool optimal for diagnosing Chagas disease.The first thing we still need to consider is the blood sample size needed to perform the test. From the patients aspect it would be best to take as little as possible. A smaller blood sample would also mean that the device can be made smaller, which in turn also makes the production costs for one test cheaper. However, there needs to be enough pathogen DNA in the blood sample to make sure that the test gives the right results. It would be possible to pretreat a larger sample to concentrate it before applying, increasing the chance of correct diagnosis, but this would again require skilled professionals and materials.
We have also thought about a question that was raised at the University Medical Center at the Cancer department. The question was why we wanted to express our system on the membrane of eukaryotic cells and not just express it intracellularly in bacteria. Then a blood sample could be added and the bacteria can be heat shocked to get the pathogen DNA intracellular, activating the binding of the two proteins. In this case, there would be a loss of the amplification step, since the transcription factor is then able to activate the reporter gene without a signal or cleavage of the transcription factor. Since we don’t know what the minimum amount of blood needed is, we wanted to design it in the way we can get the most signal, which is to include the amplification step. If it would prove that this amplification step is not needed, we could also just put the proteins in the tool and use a split reporter. On the other hand, the tool would not rely on use of living cells, which would make the use of our tool a whole lot safer.
We should also consider the material that the device is going to be made of. It should be of sturdy quality to prevent contamination of the environment with the device’s content. From the production perspective, the costs to produce it should be as low as possible to make the tool affordable. A main issue with costs, currently, is the production of the gRNA as it is expensive to synthesize.
We have also heard that the tool should have a low incidence of false positive and negative results and that our device should distinguish DNA strands with one different base pair. We want to take this information into account to design the target DNA. There are two possibilities from which we can choose. The first option would be to permit certain mutations in the target DNA, to prevent getting a false negative result in some cases. The second option would be to use a very conserved domain as target DNA and don’t allow any mismatches. From our perspective, we think the second option would be more suitable, since the specificity in our system is a very valuable aspect of the design. We have chosen to use the satellite DNA, which is present in the T. cruzi parasite as a 195 base pair repeat with about 100,000 copies (Aldert Bart, Academical Medical Center Amsterdam: Clinical molecular parasitologist).