Difference between revisions of "Template:Team:Utrecht/MainBody"

 
(39 intermediate revisions by the same user not shown)
Line 130: Line 130:
 
     margin-bottom: 30px;
 
     margin-bottom: 30px;
 
}
 
}
 +
 +
.slick-slide { opacity: 0.6; }
 +
.slick-current { opacity: 1; z-index: 10; }
  
 
.slick-dots
 
.slick-dots
Line 238: Line 241:
 
     -webkit-tap-highlight-color: transparent;
 
     -webkit-tap-highlight-color: transparent;
 
}
 
}
 +
 +
.slick-slider .slick-slide { transition: opacity 0.5s !important; }
  
 
.slick-list
 
.slick-list
Line 757: Line 762:
  
 
<script id="page-home" type="text/template"><!--
 
<script id="page-home" type="text/template"><!--
 +
<div style="position: absolute;top: 0;right: -250px;width: 200px;text-align: center;border: 1px solid gold;padding: 10px;border-radius: 10px;box-sizing: border-box;background: #ffedb8;">
 +
<div style="
 +
    font-weight: bold;
 +
    font-size: 20px;
 +
    color: #c48b00;
 +
    border-bottom: 1px solid #ffd700;
 +
padding-bottom: 15px;
 +
    margin-bottom: 15px;
 +
">Awards</div>
 +
<img width="100" src="https://static.igem.org/mediawiki/2017/thumb/a/a2/UU_gold_medal.png/240px-UU_gold_medal.png"><br><div style="font-size: 15px;color: #c48b00; border-bottom: 1px solid #ffd700; padding-bottom: 15px; margin-top: 5px;">Gold medal</div>
 +
<div style="margin-top: 15px; margin-bottom: 10px; font-size: 15px;color: #c48b00;"><b>Nominated</b><br />Best integrated human practices</div>
 +
</div>
 +
 
<div class="page-heading">The OUTCASST two-component system</div>
 
<div class="page-heading">The OUTCASST two-component system</div>
−
This year, Utrecht University participates in the iGEM for the first time.  
+
This year is the debut year for the Utrecht University iGEM team. Our team has developed an easy to use and cheap DNA detection kit for disease diagnosis in areas of the world where advanced diagnostic technologies are not available. We call our system ‘OUTCASST’, which stands for ‘Out-of-cell Crispr-Activated Sequence-specific Signal Transducer’.
−
We aim to create a cheap DNA detection kit for disease diagnosis that is easy to use and does not rely on complicated sequencing technologies.  
+
−
We call our system ‘OUTCASST’, which stands for ‘Out-of-cell Crispr-Activated Sequence-specific Signal Transducer’.
+
 
 
 
<br />
 
<br />
 
<br />
 
<br />
−
<video style="width: 100%;" poster="" controls>
+
<video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/7/7c/UU_outcasst_movie_poster.png" controls>
 
<source src="https://static.igem.org/mediawiki/2017/3/33/UU-iGEM_anim_final_1.mp4" type='video/mp4'/>
 
<source src="https://static.igem.org/mediawiki/2017/3/33/UU-iGEM_anim_final_1.mp4" type='video/mp4'/>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
Line 773: Line 789:
 
<h2 class="subhead" id="subhead-2">The problem</h2>
 
<h2 class="subhead" id="subhead-2">The problem</h2>
 
Disease diagnosis is of great importance for healthcare.  
 
Disease diagnosis is of great importance for healthcare.  
−
In developing countries, diagnoses are often based on limited information, even though accurate disease determination based on pathogen specific DNA is possible through sequencing technologies. These technologies, however, require specialised equipment and expertise that simply is not available everywhere.  
+
In developing countries, diagnoses are often based on limited information, even though accurate disease determination based on pathogen specific DNA is possible through sequencing technologies. These technologies, however, require specialised equipment and expertise that simply is not available in developing parts of the world.  
−
With the OUTCASST two-component system and detection kit, we hope to alleviate this problem.
+
The OUTCASST two-component system and detection kit was designed to alleviate this problem.
  
 
<center>
 
<center>
Line 784: Line 800:
 
 
 
<div id="popover-1" style="display: none;">
 
<div id="popover-1" style="display: none;">
−
Binding of components with search-specific gRNA sequences.
+
First, guide RNA (gRNA) needs to be added, which is complementary to the DNA sequence you want to detect.
 
<br>
 
<br>
 
<br>
 
<br>
Line 791: Line 807:
 
 
 
<div id="popover-2" style="display: none;">
 
<div id="popover-2" style="display: none;">
−
DNA sample fragment binds to one of the components.
+
dCas9 and dCpf1 will bind their corresponding gRNA.
 
<br>
 
<br>
 
<br>
 
<br>
Line 798: Line 814:
 
 
 
<div id="popover-3" style="display: none;">
 
<div id="popover-3" style="display: none;">
−
Fragment binding with both components induces co-localization.
+
DNA from the sample that matches the gRNA will first bind to one of the proteins.
 
<br>
 
<br>
 
<br>
 
<br>
Line 805: Line 821:
 
 
 
<div id="popover-4" style="display: none;">
 
<div id="popover-4" style="display: none;">
−
Protease cleaves, transcription factor is released from complex.
+
Once the DNA fragment binds the other protein, the system will co-localize. This allows the protease to release the transcription factor from the complex, resulting in an intracellular signal.
 
<br>
 
<br>
 
<br>
 
<br>
Line 828: Line 844:
 
 
 
<h2 class="subhead" id="subhead-3">The system</h2>
 
<h2 class="subhead" id="subhead-3">The system</h2>
−
The OUTCASST two-component system consists of two proteins that span the membrane.  
+
The OUTCASST two-component system consists of two synthetic receptors that span the membrane.  
 
One of the proteins has a Cas9 protein attached as an extracellular domain, the other has a Cpf1 protein attached.  
 
One of the proteins has a Cas9 protein attached as an extracellular domain, the other has a Cpf1 protein attached.  
 
Both proteins can be given a guide RNA that makes them bind to a specific, user-chosen, complementary sequence.  
 
Both proteins can be given a guide RNA that makes them bind to a specific, user-chosen, complementary sequence.  
−
When both proteins bind a single DNA fragment from a sample, possibly containing pathogen DNA, they co-localize, so that a protease releases a transcription factor which then induces an intracellular reporter mechanism, resulting in a stained or fluorescent cell.
+
When both proteins bind a single DNA fragment from a sample, possibly containing pathogen DNA, they co-localize, so that a protease releases a transcription factor which then induces an intracellular reporter mechanism such as a luminescent or fluorescent signal.
 +
<br><br>
 +
A final product would include the use of so-called anhydrobiotic insect <i>Polypedilum vanderplanki</i> cells, which can be air-dried, allowing them to be stored for prolonged periods of time at room temperature. The OUTCASST system is cheap to produce, store and ship, and requires nothing more then a simple microscope as a readout.
 
 
 +
 +
 
 +
 
 +
 
 +
 +
 
 +
 +
 
 +
 +
 +
 
 +
 
<script type="text/javascript" language="JavaScript">
 
<script type="text/javascript" language="JavaScript">
 
function tut_goto(step)
 
function tut_goto(step)
Line 843: Line 873:
 
{
 
{
 
jQuery("#link-" + i).removeClass("selected");
 
jQuery("#link-" + i).removeClass("selected");
 +
jQuery("#link-" + i).removeClass("pulsing");
 
jQuery("#popover-" + i).dxPopover("hide");
 
jQuery("#popover-" + i).dxPopover("hide");
 
jQuery("#figure-" + i).fadeOut("5");
 
jQuery("#figure-" + i).fadeOut("5");
Line 864: Line 895:
 
{
 
{
 
jQuery("#link-" + i).removeClass("selected");
 
jQuery("#link-" + i).removeClass("selected");
 +
jQuery("#link-" + i).removeClass("pulsing");
 
jQuery("#popover-" + i).dxPopover("hide");
 
jQuery("#popover-" + i).dxPopover("hide");
 
jQuery("#figure-" + i).fadeOut("5");
 
jQuery("#figure-" + i).fadeOut("5");
Line 893: Line 925:
 
var title;
 
var title;
 
 
−
if(i == 1)
+
/*if(i == 1)
 
title = "Guide RNA";
 
title = "Guide RNA";
 
else if(i == 2)
 
else if(i == 2)
Line 899: Line 931:
 
else if(i == 3)
 
else if(i == 3)
 
title = "Signal transduction";
 
title = "Signal transduction";
 +
else if(i == 4)
 +
title = "Signal transduction";*/
 +
 +
if(i == 1)
 +
title = "Start";
 +
else if(i == 2)
 +
title = "gRNA binding";
 +
else if(i == 3)
 +
title = "DNA binding";
 
else if(i == 4)
 
else if(i == 4)
 
title = "Signal transduction";
 
title = "Signal transduction";
Line 966: Line 1,007:
 
<script id="page-secretion" type="text/template">
 
<script id="page-secretion" type="text/template">
 
<div class="page-heading">Secreting functional Cas9 and Cpf1</div>
 
<div class="page-heading">Secreting functional Cas9 and Cpf1</div>
−
In order to realize OUTCASST it is crucial to verify the activity of the two DNA-sensing elements. In our system, these are Cas9 and Cpf1. This experiment is a novelty in itself. To put the gravity of this experiment into perspective, as of today, there is no evidence of catalytically active secreted Cas9 or Cpf1.  
+
 
 +
In the OUTCASST system, our two DNA-sensing elements (dCas9 and dCpf1) are extracellularly fused to transmembrane proteins (see <a onclick="return change_page('outcasst', 1)" href="outcasst">OUTCASST system production</a>).
 +
However, for proteins to reach the cell membrane, they have to pass through the Endoplasmic Reticulum and the Golgi apparatus <i class="ref" data-id="1">1</i>. The chemical environment inside these organelles differs greatly from that of the cytosol. This includes the possibility of glycosylation and disulfide bond formation to occur. For a functional OUTCASST, dCas9 and dCpf1 need to be able to pass through the secretion pathway, and still be able to bind gRNA complementary DNA afterwards.  
  
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-2">Introduction</h2>
 
<h2 class="subhead" id="subhead-2">Introduction</h2>
−
In this experiment, we aim to secrete the two extracellular protein domains of the OUTCASST two-component fusion-protein system, Cas9 and Cpf1, and subsequently prove their functionality. This is a critical step in the process as the proteins should have the ability to bind DNA when implemented as the extracellular domains of OUTCASST. We conducted this experiment by creating genes for secretable Cas9 and Cpf1, using the same signal tag that is also used for the eventual OUTCASST proteins. These genes were inserted into bacterial plasmids, which were multiplied and transfected to mammalian cells. The protein was collected, purified and tested for functionality. If these products prove to be fully functional, they can be implemented in the final design.  
+
With these experiment, we aim to make HEK293t cells secrete Cas9 and Cpf1 into their growth medium. Subsequently, we will purify these secreted proteins and attempt to verify that they are still functional by performing an endonuclease assay. The proteins have maintained their DNA binding and cleaving capabilities if the proteins are still able to cut DNA strands in the correct place. If this is so, the catalytically inactive versions that form OUTCASST’s extracellular domains can be used in the final system, for we can then be sure that the secretory pathway does not disturb its DNA binding properties.
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-3">Methods</h2>
 
  
−
SECTION 1: CREATING THE DNA CONSTRUCTS
+
To get the proteins into the ER, an N-terminal signal peptide sequence needs to be introduced to the protein coding sequence. For this, the Ig lambda-2 chain V region signal sequence will be used, which is also used by Daringer et al. in their Modular Extracellular Sensor Architecture <i class="ref" data-id="2">2</i>.
 +
<br><br><b>LINK (head) to MESA</b>
 +
 
 
<br><br>
 
<br><br>
−
The DNA sequences coding for Cas9 or Cpf1 were modified to contain an N-terminal signal sequence and a C-terminal His-tag. A kozak sequence was placed in front of the protein coding region. This was then placed in a backbone plasmid containing a CMV promotor.
+
 
 +
To be able to purify the secreted proteins from growth medium, a C-terminal His-tag with glycine linker (GGGHHHHHH) was added. Using this, it would be possible to purify the proteins using Ni-NTA affinity chromatography. Cas9 and Cpf1 containing the signal sequence and His-tag will henceforth be referred to as sCas9 and sCpf1, respectively.
 +
 
 
<br><br>
 
<br><br>
−
<b>AsCpf1:</b>
+
<h2 class="subhead" id="subhead-3">Methods</h2>
−
<ol>
+
−
<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cpf1 with a C-terminal Histag and overlap region for the final backbone plasmid <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b4/Cpf1_PCR_protocol.pdf" class="pdf pdf-inline"></a>.<br>
+
−
<pre style="margin-top: 10px;">Plasmid: Lenti-AsCpf1-Blast (from Addgene, nr: 84750)
+
−
Fw primer 5’-3’: TCATCGAGGAGGACAAGGCCC
+
−
Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTTGCGCAGCTCCTGGATGTAG</pre><br>
+
−
</li>
+
−
<li>gBlock containing a kozak sequence, signal sequence and overlap regions with the backbone and Cpf1 was ordered from IDT. See snapgene file below for sequence.</li>
+
−
<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/c9/UU_InFusion_protocol_v2.pdf" class="pdf pdf-inline"></a>.<br>
+
−
<pre style="margin-top: 10px;">Plasmid: pCAGGS_eGFP</per><br>
+
−
</li>
+
−
</ol>
+
  
 +
<b>Secretion, glycosylation and disulfide bond prediction</b>
 
<br>
 
<br>
 +
The signal sequence and His-tag were attached to Cas9 and Cpf1 in silico. The amino acid sequences were entered into the SignalP 4.1 server <i class="ref" data-id="3">3</i> to predict where the signal sequence would be cleaved off.
  
−
<b>Cas9:</b>
+
<br><br>
−
<ol>
+
 
−
<li>PCR was performed using the following plasmid and primers, to create a fragment containing Cas9 with a C-terminal Histag and overlap region for the final backbone plasmid <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/cd/UU_Cas9_PCR_protocol.pdf" class="pdf pdf-inline"></a>.<br>
+
The amino acids sequences were also entered in the NetNGlyc 1.0 Server <i class="ref" data-id="4">4</i>, which predicts N-glycosylation sites based on the known motif (Asn-X-Ser/Thr-Ser/Thr), and also on the DiANNA 1.1 web server <i class="ref" data-id="5">5</i>, to highlight the cysteines and their likelihood to form disulfide bonds.
−
<pre style="margin-top: 10px;">Plasmid: Lenti-Cas9-Blast (from Addgene, nr: 52962)
+
−
Fw primer 5’-3’: ATTCAAGGTGCTGGGCAACAC
+
−
Rv primer 5’-3’: GCCGCTTACTTGTACTTAATGATGATGATGATGATGGCCG CCGCCGTCGCCTCCCAGCTGAGACA</pre><br>
+
−
</li>
+
−
<li>PCR was performed to create a second fragment containing a kozak region, the signal sequence and the first part of Cas9 (without its methionine) <a target=_BLANK href="https://static.igem.org/mediawiki/2017/8/81/UU_-_PCR_Cas9_gBlock.pdf" class="pdf pdf-inline"></a>.<br>
+
−
<pre style="margin-top: 10px;">Plasmid: Lenti-Cas9-Blast (from Addgene)
+
−
Fw primer 5’-3’: CCCGGGATCCACCGGTGCCGCCACCATGGCGTGG ACCAGCCTGATTCTGAGCCTGCTGGCGCTGTGCAGCGGCGCGAGCAGCG ACAAGAAGTACAGCATCGGCCTG
+
−
Rv primer 5’-3’: CCCAGCACCTTGAATTTCTTGCTG</pre><br>
+
−
</li>
+
−
<li>In-Fusion Cloning was then performed using AgeI and BsrGI to linearize the backbone plasmid and the two previously created fragments <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/c9/UU_InFusion_protocol_v2.pdf" class="pdf pdf-inline"></a>.<br>
+
−
<pre style="margin-top: 10px;">Plasmid: pCAGGS_eGFP</pre><br>
+
−
</li>
+
−
</ol>
+
  
 
<br><br>
 
<br><br>
  
−
SECTION 2: TRANSFECTION INTO HEK293T CELLS<br>
+
The predicted N-glycosylation sites were marked on crystal structures of both Cas9 and Cpf1 using PyMol <i class="ref" data-id="6">6</i> to get a clear image of where these sites would be and to clarify the likelihood that glycosylation would disturb protein functionality.
−
HEK293t cells were cultured according to the cell culture protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/2e/UU_Cell_culture_protocol.pdf" class="pdf pdf-inline"></a>. We transfected the cells with the midiprepped plasmids according to the Lipofectamine 2000 transfection protocol [Experimental\Protocols\Wiki ready\Lipofectamine 2000 transfection protocol.pdf].
+
−
For protein purification under denaturing conditions, HEK cells in 6 wellplate wells were transfected. For protein purification under native conditions, HEK cells in 10 cm petridishes were cotransfected (9:1 plasmid of interest : plasmid containing GFP).  
+
  
 
<br><br>
 
<br><br>
−
SECTION 3: PROTEIN PURIFICATION UNDER DENATURING CONDITIONS<br>
+
 
−
Secreted and His-tagged Cas9 and Cpf1, which will be referred to as sCas9 and sCpf1, respectively, were purified from the medium using Ni-bead purification, according to protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/41/Purification_of_cells_and_medium_secreted_cpf1_and_cas9.pdf" class="pdf pdf-inline"></a>. Also, whole-cell lysates were made, following the same protocol, to check for possible accumulation of sCas9 or sCpf1 in HEK293t cells.
+
<b>Creating the DNA constructs</b>
 +
<br>
 +
DNA sequences coding for Cas9 and Cpf1 were modified to contain an N-terminal signal sequence (removing the first methionine from Cas9 and Cpf1) and a C-terminal His-tag. A kozak sequence was placed in front of the protein coding region, to help initiate the translation process in mammalian cells. This was then placed in a backbone plasmid (pCAGGS). These plasmids were subsequently amplified in <i>E. coli</i>. See the supplementary information for cloning procedures and plasmid sequences.
  
 
<br><br>
 
<br><br>
−
SECTION 4: VERIFYING THE PRESENCE OF HIS-TAGGED PROTEINS IN THE MEDIUM<br>
+
<b>HEK293t transfection</b>
−
The presence of sCas9 and sCpf1 was verified using SDS-PAGE and Western Blots. Proteins were separated using SDS-PAGE using the following protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/a/ab/General_Protocol_SDS-PAGE_Western_Blot.pdf" class="pdf pdf-inline"></a>.  
+
<br>
−
10% acrylamide running gels, and stacking gels were made according to the following protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b1/Preparing_SDS-PAGE_gels.pdf" class="pdf pdf-inline"></a>. Western Blots were carried out according to the same protocol as for the SDS-PAGE.
+
HEK293t cells were cultured according to our cell culture protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/2e/UU_Cell_culture_protocol.pdf" class="pdf pdf-inline"></a>.  
−
The secreted proteins were incubated with mouse anti-His6x (using dilutions of 1:2000 and 1:5000) and rabbit anti-Cas9 or rabbit anti-Cpf1 (using dilutions of 1:2000). The secondary antibody was a goat anti-mouse for the Histag and goat anti-rabbit for both Cas9 and Cpf1, with a horseradish peroxidase (HRP) conjugate to verify the presence of secreted proteins.  
+
The cells were transfected with plasmids according to the Lipofectamine 2000 transfection protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/17/UU_-_Lipofectamine_2000_transfection_protocol.pdf" class="pdf pdf-inline"></a>.
  
 
<br><br>
 
<br><br>
−
SECTION 5: PROTEIN PURIFICATION UNDER NATIVE CONDITIONS<br>
 
−
Proteins were purified using Ni-NTA superflow columns, according to the following protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/f/fa/UU_Ni-NTA_superflow_colums_protocol.pdf" class="pdf pdf-inline"></a>. No imidazole in the pre- and washing buffers was used. Additionally, 50 ul samples were taken of the pellet, supernatant, filtered supernatant, and the runthrough.
 
−
Whole cell lysates were made using protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/41/Purification_of_cells_and_medium_secreted_cpf1_and_cas9.pdf" class="pdf pdf-inline"></a> to check for possible accumulation of sCas9 or sCpf1 in Hek293t cells.
 
  
 +
<b>Verifying the presence of secreted proteins</b>
 +
<br>
 +
Medium and cells were harvested three days after transfection.
 +
Protein from the medium and cell lysates were purified under denaturing conditions using Ni-bead purification,
 +
according to a purification protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/41/Purification_of_cells_and_medium_secreted_cpf1_and_cas9.pdf" class="pdf pdf-inline"></a>.
 +
In a duplicate experiment, protein from medium and cell lysate was purified under native conditions according to a
 +
different purification protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/cc/UU_-_purifying_under_native_conditions.pdf" class="pdf pdf-inline"></a>.
 +
 +
<br><br>
 +
The presence of sCas9 and sCpf1 in medium, cell lysate and after purification steps was verified with SDS-PAGE and Western Blots.
 +
Proteins were separated using SDS-PAGE using a standard SDS-PAGE and blotting protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/a/ab/General_Protocol_SDS-PAGE_Western_Blot.pdf" class="pdf pdf-inline"></a>.
 +
Polyacrylamide running and stacking gels were made according to standard recipes <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b1/Preparing_SDS-PAGE_gels.pdf" class="pdf pdf-inline"></a>.
 +
Western Blots were carried out according to the same procedure as SDS-PAGE.
 +
<br><br>
 +
Subsequently, the blotting membranes were incubated with anti-his antibodies originating from a mouse at 1:2000 dilution or with anti-Cas9 and anti-Cpf1 antibodies,
 +
both originating from rabbit, also at 1:2000 dilution.
 +
Secondary antibodies containing a horseradish peroxidase (HRP) conjugate (1:10 000 dilution) were used to verify the presence of
 +
secreted proteins by the detection of chemiluminescence.
 +
<br><br>
 +
Additionally, together with team Wageningen_UR a final experiment was done to verify that the protein in the medium was indeed secreted instead of due to involuntary cell lysis (see <a onclick="return change_page('collaborations', 1)" href="collaborations">Collaborations</a>).
 +
This experiment was done in duplo, by members from both team Wageningen_UR and team Utrecht, individually, to provide independent verification of the result. This final experiment was done according to a collaboration protocol that was shared with the Wageningen_UR team <a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/40/UuProtocolCollaborationWageningen.pdf" class="pdf pdf-inline"></a>.
 +
<br><br>
 +
<b>Endonuclease activity assay</b>
 +
<br>
 +
An in vitro endonuclease activity assay was performed twice; first using purified Cas9 and Cpf1 (supplied to us by Geijsen lab),
 +
to test which gRNA concentrations are optimal for the assay. The second endonuclease activity assay was performed using purified sCas9 and sCpf1, as well as Cas9 and Cpf1.
 +
<br><br>
 +
Cas9 gRNA was prepared from DNA oligos according to a gRNA production protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/8/8d/UU_-_Nuclease_activity_assay_-_Cas9_gRNA_production.pdf" class="pdf pdf-inline"></a>.
 +
Cpf1 gRNA was ordered from IDT, as it proved too short for synthesis according to the aforementioned protocol. A linearized plasmid of approximately 800 base pairs was used as template, with sRNAs complementary to roughly the same region of the linearized plasmid. This would result in two cut fragments of ~260 base pair and ~560 base pair lengths for both Cas9 and Cpf1 cleavage.
 
<br><br>
 
<br><br>
−
SECTION 6: IN VITRO ENDONUCLEASE ACTIVITY ASSAY<br>
+
The first assay was performed according to protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/12/Nuclease_activity_assay_-_assay_UU.pdf" class="pdf pdf-inline"></a>. An adjusted protocol was used for the second assay, due to low concentrations of purified sCas9 and sCpf1 <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/13/UU_-_Nuclease_activity_assay_-_assay2.pdf" class="pdf pdf-inline"></a>. See the supplementary information for cloning procedures and sequences.
−
After successful purification of sCas9-His6x and sCpf1-His6x and subsequent verification of the presence of the aforementioned proteins, an in vitro endonuclease activity assay was carried out. The in vitro endonuclease activity assay was used to assess whether or not our secreted and, in all likelihood, glycosylated sCas9-His6x and sCpf1-His6x would still exhibit sgRNA-binding- and endonuclease activity. The assay was executed according to the protocol <a target=_BLANK href="https://static.igem.org/mediawiki/2017/1/12/Nuclease_activity_assay_-_assay_UU.pdf" class="pdf pdf-inline"></a>.  
+
−
Linearized plasmid 51-dPAM (823 bp) <a target=_BLANK href="https://static.igem.org/mediawiki/2017/3/3c/51_dPAM_800bp.zip" class="zip zip-inline"></a> was used as the target for sCas9-His6x and His6x-Cpf1. Two sgRNAs were used that were tailored to be bound by either Cas9 or Cpf1: <a target=_BLANK href="https://static.igem.org/mediawiki/2017/9/9d/SpCas9_gRNA1_Tet-luc.zip" class="zip zip-inline"></a> and <a target=_BLANK href="https://static.igem.org/mediawiki/2017/5/5e/Ascpf1_sgRNA.zip" class="zip zip-inline"></a>, respectively. Both sgRNAs were complementary to roughly the same region of the aforementioned linearized plasmid, which would result in two cut fragments of ~260 bp and ~560 bp for both His6x-Cas9 and His6x-Cpf1. The efficacy of these sgRNAs, both in binding to the target region in the linearized plasmid, and binding to either Cas9 or Cpf1 were also assessed. As positive controls we used unmodified Cas9 and Cpf1 produced by Escherichia coli, coupled with their respective sgRNAs and the linearized target plasmid. The negative controls consisted of the linearized plasmid with either Cas9 or Cpf1 without sgRNA, and a third negative control with the linearized plasmid only. Subsequently, the samples were separated by DNA gel electrophoresis.
+
  
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-4">Results</h2>
 
<h2 class="subhead" id="subhead-4">Results</h2>
  
−
SECTION 1: CREATING THE DNA CONSTRUCTS<br>
+
<b>Secretion, glycosylation and disulfide bond prediction</b>
−
As mentioned at the methods, the plasmid sequences and features can be viewed at:<br>
+
 
<br>
 
<br>
−
<img width="600" src="https://static.igem.org/mediawiki/2017/8/8e/Uuextra_figure1.png">
+
SignalP 4.1 predicted cleavage right after the signal sequence for both sCas9 and sCpf1. The results of the prediction can be found here <a target=_BLANK href="https://static.igem.org/mediawiki/2017/9/97/UU_-_SignalP_results.pdf" class="pdf pdf-inline"></a>.
−
<br>
+
−
<b>Snapgene file:</b> iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\  pCAGGS_sigseq_Cpf1_Histag.dna<br>
+
−
<br>
+
−
and<br>
+
−
<br>
+
−
<img width="600" src="https://static.igem.org/mediawiki/2017/3/3e/Uuextra_figure2.png"><br>
+
−
<b>Snapgene file:</b> iGEM 2017\Experimental\SnapGene\Secreted Cas  or Cpf\  pCAGGS_sigseq_Cas9_Histag.dna<br>
+
−
<br>
+
−
<b>Table 1. Nanodrop results of midiprepped plasmids</b>
+
−
<table width="450">
+
−
<tr>
+
−
<td><b>Plasmid</b></td>
+
−
<td><b>Concentration (ng/ul)</b></td>
+
−
</tr>
+
−
<tr>
+
−
<td>pCAGGs_sigseq_Cas9_Histag</td>
+
−
<td>809,7</td>
+
−
</tr>
+
−
<tr>
+
−
<td>pCAGGs_sigseq_Cpf1_Histag</td>
+
−
<td>1322</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Lenti Cas9</td>
+
−
<td>2593,9</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Lenti Cpf1</td>
+
−
<td>1312,7</td>
+
−
</tr>
+
−
</table>
+
 
<br><br>
 
<br><br>
 +
Six N-glycosylation motifs were detected in Cas9, of which five had a high probability of being N-glycosylated. In Cpf1, four motifs were detected, three of which had a high glycosylation probability.
 +
<br><br>
 +
<center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/4/4a/UU_fig1_-_Glycosylation_sites.PNG"></center>
 +
<span class="text-figure"><b>Figure 1. Glycosylations sites in Cas9 and Cpf1.</b> Predicted N-glycosylation sites are marked red in the crystal structures of Cas9 (PDB: 4OO8) and Cpf1 (PDB: 5B43). N-terminus is marked purple, C-terminus is marked yellow, gRNA is shown in orange and the bound DNA is shown in green.
 +
</span>
  
−
SECTION 2: TRANSFECTION INTO HEK293T CELLS
+
<br><br>
−
Lipofectamine 2000 has a high transfection efficiency and at the time no fluorescent microscope was available. Therefore we did not do a cotransfection of the plasmids with eGFP at the small batch (denaturing conditions). The transfection success was verified by the Western Blot results (See results of section 4?)
+
Two cysteines were marked as having a high chance of forming disulfide bonds in Cas9, while  eight such cysteines were found in Cpf1. Details can be found in the supplementary information.
 +
<br><br>
 +
<b>Creating the DNA constructs</b><br>
 +
All constructs were verified by sequencing.
 +
<br><br>
 +
<b>Verifying the presence of secreted proteins</b><br>
 +
<center><img style="margin-top: 10px; width: 400px;" src="https://static.igem.org/mediawiki/2017/c/cf/UU_fig2_-_western_under_denaturing_conditions.png"></center>
 +
<span class="text-figure"><b>Figure 2. Western Blot using protein purified under denaturing conditions.</b> A band at the correct height is present in the lanes containing purified sCas9 and sCpf1 from the medium, indicating presence of sCas9 and sCpf1 in the medium.
 +
</span>
 +
<br><br>
 +
Figure 2 shows the presence of sCas9 and sCpf1 in the medium, which indicated the proteins are secreted and that the experiment could be redone under native conditions but only small quantities of protein could be purified (~0,5 ng/uL in 0,5 mL for both sCas9 and sCpf1).
 +
<br><br>
 +
<center><img style="margin-top: 10px; width: 450px;" src="https://static.igem.org/mediawiki/2017/d/de/UU_fig3_-_western_under_native_conditions.png"></center>
 +
<span class="text-figure"><b>Figure 3. Western Blot using protein purified under native conditions.</b> The left image shows samples from cells transfected with a sCas9 containing plasmid, incubated with Anti-Cas9. The right image shows samples transfected with a sCpf1 containing plasmid, incubated with a Cpf1 antibody.The images suggest that sCas9 and sCpf1 are indeed secreted into the medium, though it cannot be excluded that part of the protein in the media is due to cell lysis.
 +
</span>
 +
<br><br>
 +
After newly expressing sCas9 and sCpf1 in HEK293t cells, blots of the Cpf1 protein (figure 4) displayed the presence of secreted Cpf1 in both medium and cell lysate. In the medium, two bands are shown, one with a lower mass than Cpf1 is supposed to have. This lower band is, ostensibly, a degradation product. In the cell lysate, we see a second band as well, this time of higher mass. We suspect that this band corresponds to glycosylation product that accumulates in the cells and cannot be secreted. The results from the Wageningen_UR team confirm the presence of sCpf1 in both cell lysate and medium, as expected, again showing a lower mass band for the protein in the medium.
 +
<br><br>
 +
<center><img style="margin-top: 10px;" src="https://static.igem.org/mediawiki/2017/0/0e/UU-secretion-fig4.png"></center>
 +
<span class="text-figure"><b>Figure 4. Secretion products of Cpf1.</b> The left image displays the blotting results of Utrecht’s team. The right image displays the blotting results of our Wageningen_UR collaborators. sCpf1 is shown on both blots, displaying two bands. Cell lysates of sCpf1 producing cells display sCpf1 as well.
 +
</span>
  
−
During transfection of the big batch (native conditions) we had a fluorescent microscope available and therefore the plasmids were cotransfected with eGFP (figure xa and xb).
+
<br><br>
  
−
<br>
+
<b>Endonuclease activity assay</b><br>
−
<img src="https://static.igem.org/mediawiki/2017/e/e1/Uutransfectionhekcells.png">
+
The first endonuclease activity assay was used to determine the optimal concentration of gRNA for the assay with the secreted proteins. The concentrations used were all functional for the Cpf1 protein (Figure 5, left pane). Cas9 however, showed no cleavage of the targeted DNA at all. This may be due to low quality gRNA. In the second assay, which contained sCas9 and sCpf1 purified from medium, there was no cleavage visible at all, even for the controls with Cas9 and Cpf1, as shown in figure 5 (right pane).
−
<br>
+
<center><img style="margin-top: 25px;" src="https://static.igem.org/mediawiki/2017/f/fc/UU_secretion_fig5.png"></center>
−
Figure x. Fluorescent microscope image of HEK293t cells cotransfected with eGFP and pCAGGs_sigseq_Cas9_Histag (a) and pCAGGs_sigseq_Cpf1_Histag (b) (plasmid ratio 1:9). In both cases, eGFP expression is clearly visible, indicating successful cotransfections.
+
<span class="text-figure">
 +
<b>Figure 5.</b> Left - DNA gel electrophoresis of a linearized 800 base pair length plasmid. Concentrations of Cas9 and Cpf1 used in the assay were 0,05 uM and 0,15 uM, respectively. Right - DNA gel electrophoresis of the linearized 800bp plasmid. 2,5 nM Cas9 or Cpf1 protein was used and 10 nM gRNA.
 +
</span>
  
 
<br><br>
 
<br><br>
−
SECTION 3: PROTEIN PURIFICATION UNDER DENATURING CONDITIONS<br>
+
<h2 class="subhead" id="subhead-5">Discussion</h2>
−
<br>
+
The goal of this experiment was to create secretable Cas9 and Cpf1 and test the functionality of these proteins. We have a clear indication that we achieved in obtaining secretion product, demonstrated by figures 2,3 and the collaboration results. Even if cell death has contributed to the protein concentrations in the media at all, it seems unlikely that it could account for a majority of the product. This, in addition to the lack of cell debris in the culturing plates, leads us to believe that the proteins can indeed be secreted.
−
<img width="600" src="https://static.igem.org/mediawiki/2017/e/e7/Uuwestern.png">
+
<br><br>
−
<br>
+
As of yet, we have not been able to demonstrate nuclease activity for either sCas9 or sCpf1. In our nuclease assay with the secreted proteins, the substrate was not cleaved. Even the control proteins did not show cleavage, suggesting that something went wrong with the assay. This lack of cleavage could be due to the low concentrations of protein purification product. In this assay, the incubation time was increased in comparison to standard endonuclease assay protocols to compensate for the low purification yields. Poor quality gRNA could also have caused the lack of cleavage. For future research, we suggest gRNA verification is performed before the assay is attempted. Based on our predictions for glycosylation, it seems likely that sCas9 and sCpf1 are still enzymatically active, even though some optimization might be required to gain satisfactory cleavage efficiency.
−
figure x: Western blots of Cpf1 and Cas9, using anti-Cas9 and anti-Cpf1 antibodies. In both cases, the purified protein shows a band, suggesting the successful secretion of Cpf1 and Cas9.
+
<br><br>
 +
Versions of Cas9 and Cpf1 that can pass through the secretion pathway and maintain their DNA binding capabilities are essential for the OUTCASST system. The secretable sCas9 and sCpf1 proteins have merit on their own as well. A system where Cas9 and Cpf1 are made and secreted by mammalian cells could be useful for production of clinically usable endonucleases. Bacterial production may, at first glance, seem more straightforward but poses problems of clinical purity as bacterial endotoxins can easily contaminate the protein. Production of these proteins in mammalian cells could circumvent this problem.
 +
 
  
 
<br><br>
 
<br><br>
−
SECTION 4: ACTIVITY ASSAY<br>
+
<h2 class="subhead" id="subhead-6">References</h2>
−
<br>
+
 
−
<img src="https://static.igem.org/mediawiki/2017/5/54/Uuactivityassay1.png">
+
<ol class="references">
−
<br>
+
<li data-title="Molecular Cell Biology." data-author="Lodish H, Berk A, Zipursky SL, et al. Molecular Cell Biology." data-link="https://www.ncbi.nlm.nih.gov/books/NBK21471/" /> Lodish H, Berk A, Zipursky SL, et al. Molecular Cell Biology. 4th edition. New York: W. H. Freeman; 2000. Section 17.3, Overview of the Secretory Pathway. <a target=_BLANK href="https://www.ncbi.nlm.nih.gov/books/NBK21471/" class="url_external"></a>
−
Figure x. DNA gel electroforesis of the linearized 800bp 51_dPAM plasmid, cut by either normal  Cas9 or  normal Cpf1. Lanes from left to right are 1. ladder , 2. Cas9 + 0,5 uM gRNA, 3. Cas9 + 1 uM gRNA, 4.Cas9 + 2 uM gRNA, 5. Cas9 // no gRNA, 6. Cpf1 + 1 uM gRNA, 7. Cpf1 + 5 uM gRNA, 8. Cpf1 + 10 uM gRNA, 9. Cpf1 // no gRNA, 10. only plasmid. Concentration of Cas9 and Cpf1 used in the assay were 0,05 and 0,15, respectively. Red in the image is an artefact due to the software. As can be seen in lanes 6-8, normal Cpf1 cleaves
+
<li data-title="Modular Extracellular sensor architecture for engineering mammalian cell-based devices." data-author="Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N." data-link="https://doi.org/10.1021/sb400128g" /> Daringer, N. M., Dudek, R. M., Schwarz, K. A., & Leonard, J. N. (2014). Modular Extracellular sensor architecture for engineering mammalian cell-based devices. ACS Synthetic Biology, 3(12), 892–902. <a target=_BLANK href="https://doi.org/10.1021/sb400128g" class="url_external"></a>
−
<br>
+
<li data-title="SignalP 4.0: discriminating signal peptides from transmembrane regions." data-author="Petersen, T.N., Brunak, S., Von Heijne, G. & Nielsen, H." data-link="http://www.cbs.dtu.dk/services/SignalP/" /> Petersen, T.N., Brunak, S., Von Heijne, G. & Nielsen, H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods, 8:785-786, 2011. <a target=_BLANK href="http://www.cbs.dtu.dk/services/SignalP/" class="url_external"></a>
−
<br>
+
<li data-title="Prediction of N-glycosylation sites in human proteins." data-author="Gupta, R., Jung, E. and Brunak, S." data-link="http://www.cbs.dtu.dk/services/NetOGlyc/" /> Gupta, R., Jung, E. and Brunak, S. Prediction of N-glycosylation sites in human proteins. In preparation, 2004. <a target=_BLANK href="http://www.cbs.dtu.dk/services/NetOGlyc/" class="url_external"></a>
−
<img src="https://static.igem.org/mediawiki/2017/3/39/Nocleavagedetected.png">
+
<li data-title="DiANNA 1.1: an extension of the DiANNA web server for ternary cysteine classification." data-author="Ferre, F. & Clote, P." data-link="http://clavius.bc.edu/~clotelab/DiANNA/" /> Ferre, F. & Clote, P. DiANNA 1.1: an extension of the DiANNA web server for ternary cysteine classification. Accepted for publication in Nucleic Acids Res. - Web Servers 2006 special issue. <a target=_BLANK href="http://clavius.bc.edu/~clotelab/DiANNA/" class="url_external"></a>
−
<br>
+
<li data-title="The PyMOL Molecular Graphics System." data-author="Schrödinger, LLC." data-link="https://pymol.org/2/" /> The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC. <a target=_BLANK href="https://pymol.org/2/" class="url_external"></a>
−
Figure x:
+
</ol>
 +
 
 +
<span id="tooltip-1"></span>
 +
<span id="tooltip-2"></span>
 +
<span id="tooltip-3"></span>
 +
<span id="tooltip-4"></span>
 +
<span id="tooltip-5"></span>
 +
<span id="tooltip-6"></span>
 +
 
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-5">Discussion</h2>
+
<h2 class="subhead" id="subhead-7">Supplementary</h2>
−
&hellip;
+
 
 +
<a target=_BLANK href="https://static.igem.org/mediawiki/2017/c/c2/UU_-_Supplementary_info_-_Secreting_functional_Cas9_and_Cpf1.pdf" class="pdf">Supplementary information - Secreting functional Cas9 and Cpf1.</a>
 +
 
 
</script>
 
</script>
  
Line 1,246: Line 1,301:
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-8">Supplementary</h2>
 
<h2 class="subhead" id="subhead-8">Supplementary</h2>
 +
 +
Full schemes of sample contents and their output can be downloaded here: <a target=_BLANK href="https://static.igem.org/mediawiki/2017/7/7a/UU_MESA-replication-supplementary.pdf" class="pdf pdf-inline"></a>.
  
 
</script>
 
</script>
Line 1,351: Line 1,408:
 
<h2 class="subhead" id="subhead-6">Supplementary</h2>
 
<h2 class="subhead" id="subhead-6">Supplementary</h2>
  
−
Plasmid nanodrop results can be found in a downloadable <a href="">document</a>.
+
Plasmid nanodrop results can be downloaded here: <a target=_BLANK href="https://static.igem.org/mediawiki/2017/b/b1/UU_-_Assembly_supplementary.pdf" class="pdf pdf-inline"></a>.
 
</script>
 
</script>
  
Line 1,357: Line 1,414:
 
<div class="page-heading">Modeling and Mathematics</div>
 
<div class="page-heading">Modeling and Mathematics</div>
  
−
The first thing we did to get a good overview of the system dynamics was to try and graphically represent the chemical interactions of the OUTCASST system as a small reaction network. From this network, we can already see that, if we disregard production and degradation of the proteins  (so under conditions of conservation of mass) all target chain proteins will be cleaved over time. For the eventual equilibrium outcome, the cleavage rate does not matter. It only matters for the duration of equilibrium onset. So, if the cleavage speed is of no importance for the end-result, does it affect sensitivity in another way?
+
The first step we took to get a good overview of the system dynamics was to try and graphically represent the molecular interactions of the OUTCASST system in a small reaction network.  
 +
From this network we could already point out two characteristics of the OUTCASST system that are most likely to hamper sensitivity. Fortunately, we were able to find possible solutions for those problems through analysis of the network and mathematical modeling.
 +
<br><br>
 +
For an introduction of the OUTCASST network model, check out the video below!
 +
 
 +
<br>
 +
 
 +
<video onclick="this.paused?this.play():this.pause();" style="margin-top: 10px; width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/d/d1/UU-modelingvideo-poster.png" controls>
 +
<source src="https://static.igem.org/mediawiki/2017/d/da/UuModelingVidBecauseWeDid.mp4" type='video/mp4'/>
 +
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 +
</video>
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-2">Optimization of the protease cleavage rate</h2>
+
<h2 class="subhead" id="subhead-2">False positive reduction</h2>
−
Since the concentration of substrate will be exceedingly low for our sensor, the number of binding events due to substrate will also be small. It would be ideal if each binding event would lead to cleavage while transient meetings between the two proteins only rarely lead to cleavage. This would reduce the chance of false positive signals. Considering the great binding affinities of both Cas9 and Cpf1 for gRNA complementary DNA, binding events are much longer in duration than transient meetings of the two proteins.  
+
 
 +
<b>Optimization of the protease cleavage rate</b><br>
 +
 
 +
In the case of detecting pathogen DNA, the concentration of DNA or RNA will be exceedingly low and thus the number of interaction events due to substrate binding will also be small. It would be ideal if each substrate binding event would lead to cleavage while transient meetings, in the absence of substrate, between the two chains only rarely lead to cleavage. This would reduce the chance of false positive signals. Considering the great binding affinities of both Cas9 and Cpf1 for gRNA complementary DNA, binding events are much longer in duration than transient meetings of the two proteins.  
 
<br><br>
 
<br><br>
−
In the image to the side, you can see a schematic illustration of the difference in half-life of the complex formed by transient and substrate-mediated interaction.
+
<div style="float: left; margin-right: 35px; width: 305px;">
−
<br><br>
+
<img style="width: 100%;" src="https://static.igem.org/mediawiki/2017/2/21/UU-model-fig1.png">
−
In the image, for clarity, we have taken the half-life of transient complex as 5 arbitrary time units and that of the substrate-mediated complex is set to 100.
+
<br>
−
<br><br>
+
<span class="text-figure" style="display: inline-block; line-height: 20px;">
−
In the real system, these values will be much wider apart, but we took these as a clear illustration of the point we wish to make.
+
<b>Figure 1.</b> Fraction of remaining complex for (orange) substrate mediated binding events and (blue) transient binding events.
 +
</span>
 +
 +
<br>
 +
 +
<img style="width: 100%; margin-top: 40px;" src="https://static.igem.org/mediawiki/2017/7/7f/UU-model-fig2.png">
 +
<br>
 +
<span class="text-figure" style="display: inline-block; line-height: 20px;">
 +
<b>Figure 2.</b> Probability of cleavage occurring over time for a (orange) fast and (blue) slow cleaver.
 +
</span>
 +
<br>
 +
<br>
 +
</div>
 +
In the image to the side, you can see a graphical illustration of the difference in half-life of the complex formed by transient and substrate-mediated interaction. For clarity, we have taken the half-life of transient complex as 5 arbitrary time units and that of the substrate-mediated complex is set to 100. In the real system, these values will be much further apart as the duration of DNA binding for catalytically inactive Cas9 and Cpf1 is rather long.
 
<br><br>
 
<br><br>
 
Consider two different versions of our system: one with a fast-cleaving protease and the second with a slow-cleaving protease. In the image to the left, we plotted the probability distribution of cleavage occurring over time for these two versions of our Protease Chain protein. Note that the probability that it will cleave over time will always be 1, the timespan wherein this happens simply differs.  
 
Consider two different versions of our system: one with a fast-cleaving protease and the second with a slow-cleaving protease. In the image to the left, we plotted the probability distribution of cleavage occurring over time for these two versions of our Protease Chain protein. Note that the probability that it will cleave over time will always be 1, the timespan wherein this happens simply differs.  
 +
<br><br>
 
For the mathematicians amongst those who are reading this: These plots are simple lognormal distributions, for the distribution cannot take negative values as it is impossible to cleave before the complex has been formed.
 
For the mathematicians amongst those who are reading this: These plots are simple lognormal distributions, for the distribution cannot take negative values as it is impossible to cleave before the complex has been formed.
 
<br><br>
 
<br><br>
−
We can now see that the probability of cleavage for the slow cleaver is much smaller than that of the fast cleaver in the timespan that the transient complex persists. Of course, the concentration of the substrate-mediated complex decreases over time, so the total cleavage decreases when it cleaves later. To investigate how much the transient and substrate-mediated complex contribute to signal development for both Protease Chain variants, we define:
+
By comparing the two figures, we can now see that the probability of cleavage for the slow cleaver is much smaller than that of the fast cleaver in the timespan that the transient complex persists. Of course, the concentration of the substrate-mediated complex decreases over time, so the total cleavage decreases when it cleaves later. To investigate how much the transient and substrate-mediated complex contribute to signal development for both Protease Chain variants, we define:
 +
 
 +
<center><img height="75" src="https://static.igem.org/mediawiki/2017/b/b5/UuModelingEquation1.png"></center>
 +
 
 +
Wherein S’ is the increase in signal, given by the probability of cleavage (p<sub>c</sub>) for the remaining uncleaved complex. The remaining uncleaved complex is given by the remaining complex fraction (C) and how likely it is that it has not already been cleaved (one minus the integral of p<sub>c</sub> from 0 until that timepoint).
 
<br><br>
 
<br><br>
−
<b>FORMULA</b>
+
<div style="float: left; margin-right: 35px; width: 350px;">
 +
<img style="width: 100%;" src="https://static.igem.org/mediawiki/2017/a/a2/UU-model-fig3.png">
 +
<br>
 +
<span class="text-figure" style="display: inline-block; line-height: 20px;">
 +
<b>Figure 3.</b> Signal accumulation of the slow cleaver for (orange) substrate mediated binding events and (blue) transient binding events. Note that the transient binding signal is very small. For clarity, it is displayed in the inset graph.
 +
</span>
 +
 +
<br>
 +
 +
<img style="width: 100%; margin-top: 25px;" src="https://static.igem.org/mediawiki/2017/5/51/UU-model-fig4.png">
 +
<br>
 +
<span class="text-figure" style="display: inline-block; line-height: 20px;">
 +
<b>Figure 4.</b> Signal accumulation of the fast cleaver for (orange) substrate mediated binding events and (blue) transient binding events.
 +
</span>
 +
</div>
 +
When we solve this for each Protease Chain version and for both the transient and substrate-mediated complex, we end up with time-plots of the signal contribution of a single binding event. In these plots, we see that the resulting substrate-mediated complex signal for the slow cleaver (top) is about half as strong as the signal for the fast cleaver (bottom). In theory, this is not a problem since the signal can be amplified by the cells.
 
<br><br>
 
<br><br>
−
Wherein S’ is the increase in signal, given by the probability of cleavage (p_c) for the remaining uncleaved complex. The remaining uncleaved complex is given by the remaining complex fraction (C) and how likely it is that it has not already been cleaved (one minus the integral of p_c from 0 until that timepoint).
+
For the fast cleaver, we see a much bigger issue. The signal contribution of the transient complex, i.e. the false positive, is only about ten-fold smaller than the signal contribution of the substrate-mediated complex. Considering that transient encounters will be a lot more frequent than substrate-binding events, the false positive signal can be multiplied many times, making it a lot stronger than the substrate-mediated signal can ever be.  
 
<br><br>
 
<br><br>
−
When we solve this for each Protease Chain version and for both the transient and substrate-mediated complex, we end up with time-plots of the resulting signal contribution of a single binding event over time. In these plots, we can see that, for the slow cleaver, shown in the top image to the left, the resulting substrate-mediated complex signal is about half of that for the fast cleaver, as shown in the lower image. The signal is less strong but, in theory, this is not a problem since the signal can be amplified by the cells.  
+
This is not the case for the slower cleaver, where the transient complex signal contribution is much smaller.
 
<br><br>
 
<br><br>
−
For the fast cleaver, we can see a much bigger issue. The signal contribution of the transient complex, i.e. the false positive, is ten-fold smaller than the signal contribution of the substrate-mediated complex but, considering that transient encounters will be a lot more frequent than substrate-binding events, the false positive signal can be multiplied many times, making it  a lot stronger than the substrate-mediated signal can ever be. This is not the case for the slower cleaver, where the transient complex signal contribution is in the order of 10^-7, and thus falls on the abscissa.
+
Using the contributions of a single transient binding event and a single substrate-mediated binding event, we can calculate a proxy for precision by dividing the contribution of the true signal (substrate-mediated) by the contribution of the false signal (transient). For the slow rate, the contribution of a single substrate-mediated event is almost 48,000 times that of the transient occurrence. For the fast cleavage rate, this is only 17 times.
 
<br><br>
 
<br><br>
−
Using the contributions of a single transient binding event and a single substrate-mediated binding event, we can calculate a proxy for precision by dividing the contribution of the true signal (substrate-mediated) by the contribution of the false signal (transient). For the slow rate, the contribution of a single substrate-mediated event is almost 48 000 times that of the transient occurrence. For the fast cleavage rate, this is only 17 times.
+
If we assume that the transient interaction occurs 100 times more frequently than the substrate-binding event, a modest estimate, ‘true’ signal strength would only be 0.17 times that of the background for the fast cleaver whereas it would still be 480 times stronger than the background for the slow cleaving protease.
 
<br><br>
 
<br><br>
−
If we assume that the transient interaction occurs 100 times more frequently than the substrate-binding event, ‘true’ signal strength would only be 0.17 times that of the background for the fast cleaver whereas it would still be 480 times stronger than the background for the slow cleaver.
+
In conclusion, a protease with a slower cleavage rate results in a much higher signal-to-noise ratio than a fast cleaving protease results in. Thus, for increased precision and minimization of false positive results, the cleavage rate should be such that it result in a cleavage duration near the half-life of the complex between target-chain, protease-chain and substrate.  
 
<br><br>
 
<br><br>
−
In conclusion, for minimization of false positive results, the cleavage rate should result in a cleavage duration that is near the half-life of the uncleaved complex between target-chain, protease-chain and substrate. Increasing the cleavage rate would not contribute to sensitivity and merely decrease precision.
+
The affinity of the protease can be altered in two ways. Firstly, the protease binding affinity itself can be tweaked by amino-acid substitution but this requires careful experimentation and has a low chance of success. Much more easily, the cleavage site can be positioned on the linker such that it is partially obstructed or harder to reach by the protease, thereby reducing the effective cleavage rate.
 
<br><br>
 
<br><br>
−
A full work-out of this demonstration in mathematica notebook can be found <a target=_BLANK href="https://drive.google.com/drive/folders/0B_qbow6tESp8b2FNb3pMa1psLTA" class="url_external">here</a>.
+
A full work-out of this demonstration in mathematica notebook format can be found <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/2f/UuModelingProteaseOptimization.txt" class="url_external">here</a>.
  
 
<br><br>
 
<br><br>
−
<h2 class="subhead" id="subhead-3">Optimization of protein production rates</h2>
+
<h2 class="subhead" id="subhead-3">Substrate trapping reduction</h2>
−
&hellip;
+
 
 +
<b>Optimizing DNA affinity of Target Chain and Protease Chain</b><br>
 +
 
 +
Cleavage of the target chain is required for signal output. Unfortunately, the truncated target chain potentially traps the DNA molecule and thereby reduces the concentration of accessible substrate. The trapped state is visualized in the network model (Fig. 5) as the top node.
 +
<br>
 +
<center><img style="margin-top: 25px; width: 350px;" src="https://static.igem.org/mediawiki/2017/thumb/1/17/UU-model-fig5.png/681px-UU-model-fig5.png"></center>
 +
<span class="text-figure">
 +
<b>Figure 5.</b> Snapshot of the OUTCASST network model assuming identical binding affinities for target and protease chain, as indicated by arrow thickness.
 +
</span>
 +
 
 +
<br><br>
 +
From figure 5, we can already see that the likeliness of this trapped state (Fig. 5, state 8) depends on the rates with which the cut complex (Fig. 5, state 6) goes into either of the two subsequent states (Fig. 5, state 7 & 8). In order to optimize the accessibility of substrate, and thereby signal per substrate, we have to ensure that more of the cut complex turns into state 7. From state 7, the DNA-bound protease chain can encounter new transcription-factor containing target chain and further contribute to signal. This could be achieved by increasing the substrate affinity of the protease chain or conversely, lower the substrate affinity of the target chain, as indicated by the difference in arrow thickness in figure 6.
 +
 
 +
<br>
 +
<center><img style="margin-top: 25px; width: 350px;" src="https://static.igem.org/mediawiki/2017/thumb/7/76/UU-model-fig6.png/681px-UU-model-fig6.png"></center>
 +
<span class="text-figure">
 +
<b>Figure 6.</b> Proposed solution to substrate trapping in the target chain. Increased binding affinity of the protease chain towards the DNA substrate would shift the equilibrium between state 7 and 8 towards the desired state 7.
 +
</span>
 +
<br><br>
 +
Substrate affinity is a measure of how strongly the chain will bind the substrate. Ideally, we want the affinity of both to be high because then small amounts of substrate can result in signal producing events. On the other hand, the affinity of the protease chain needs to be higher than that of the target chain as we want the substrate to dissociate from the target chain more, so that there is a higher turnover of target chain.
 +
<br><br>
 +
Fortunately, the two different Cas-like proteins OUTCASST uses as DNA-binding domains already differ in DNA binding affinity; Cas9 binds DNA more strongly than Cpf1. In addition, the used guide RNA can be used to further tune the binding affinities <i class="ref" data-id="1">1</i> <i class="ref" data-id="2">2</i>.
 +
<br><br>
 +
Hence, the proposed optimization could be achieved by using Cpf1 for the target chain and Cas9 for the protease chain. In addition, the affinities also largely depend on the used guide RNA, and choosing appropriate guide RNA can thus be used to modulate this affinity further.
 +
 
 +
<br><br>
 +
 
 +
<b>Optimization of relative protein concentrations</b><br>
 +
 +
This trapping problem could also be tackled by regulating the concentration of target chain that is available. There are two considerations that are important here. First, we want a high amount of target chain to get a high potential for signal. On the other hand, we want a low amount of target chain so there will also be little cleaved target chain to trap the DNA substrate. Thus, there must be an optimum where these two considerations are balanced.
 +
<br><br>
 +
To demonstrate this, we first need to express the behaviour of the system in equations. First off, we assume that the false positive signal has been minimized by optimization of the used protease and thus the mathematical model described here does not contain the false positive signal mechanism.
 +
<br><br>
 +
In this system of ordinary differential equations, the increase or decrease of the state concentrations are given. Here, we consider association and dissociation of complexes and production and decay of the protein chains. The equations below assume a well-mixed system. The flow from state to state can be characterized with the following equations:
 +
<br><br>
 +
 
 +
<center>
 +
<img src="https://static.igem.org/mediawiki/2017/b/bc/UuModelingQuationTable.png">
 +
</center>
 +
 
 +
<br><br>
 +
 
 +
There are eight important parameters in these equations. The k<sub>1</sub> and k<sub>2</sub> rates are the association and dissociation rates between DNA and the target chain. The k<sub>3</sub> and k<sub>4</sub> are the association and dissociation rates of the protease chain and DNA. k<sub>5</sub> gives the effective cleavage rate. pP and pT are the production rates of the protease and target chain and d gives the decay-rate for proteins in general.
 +
<br><br>
 +
The concentration of each state is given by the name of the state in square brackets, such that T stands for target chain, S stands for substrate (DNA), P stands for protease chain, F stands for effector molecule and T<sub>c</sub> stands for cleaved target chain. Binding is indicated by ‘:’ between two components.
 +
<br><br>
 +
The first thing we did was to check whether this system of equations behaves the way we expect it to, on short timescales. At first, we were only interested in the system equilibria. At the time-scale of state transitions, protein production and decay per time-unit are negligible and so the values for d, p<sub>T</sub> and p<sub>P</sub> were initially set to zero.
 +
<br><br>
 +
Using the association and dissociation constants from Richardson et al. <i class="ref" data-id="3">3</i>, we set the parameters k<sub>3</sub> and k<sub>4</sub> to 4 * 10<sup>4</sup> and 5 * 10<sup>-5</sup> respectively. Fonfara et al. <i class="ref" data-id="4">4</i> found a range of Cpf1 affinities in the same order of magnitude as Richardson et al. and so we chose to perform several runs with a variety of Cpf1 parameters going from .9 to 1.1 times the rates of Cas9. All runs resulted in similar equilibria where all target chain would be processed and cleaved.
 +
<br><br>
 +
This result is expected from a well-mixed system but, considering the membrane-bound nature of our proteins, the dynamics might not be accurate. Diffusion in the membrane is limited and thus might limit the interactions of the molecules. We made an attempt to illustrate this, too, using a molecular dynamics model but this will be described later on.
 +
<br><br>
 +
We tried to generate bifurcation diagrams for the equilibrium state of our system, using the above set of equations but this was not possible. The numerical bifurcation analysis toolbox we used, a matlab package called <a target=_BLANK href="https://sourceforge.net/projects/matcont/" class="url_external">matcont</a>, would not attain equilibrium convergence. After checking the eigenvectors of the system using <a target=_BLANK href="http://theory.bio.uu.nl/rdb/grind.html" class="url_external">GRIND</a> we determined that the matcont continuation algorithm would indeed not be able to handle this system, as the majority of the system eigenvectors were in the direction of a single variable. To continue, we had to simplify the system of equations.
 +
<br><br>
 +
From these relations, it is already clear that there can only be a stable signal potential, i.e. a stable fraction of the target chains remains uncleaved, when the production of target chain outweighs the decay and cleavage of it, whilst the acquisition of cleaved target chain is balanced by its decay, such that the following conditions apply:
 +
<center><img height="50" src="https://static.igem.org/mediawiki/2017/9/91/UuModelingEquation2.png"></center>
 +
<center><img height="45" src="https://static.igem.org/mediawiki/2017/e/e0/UuModelingEquation3.png"></center>
 +
Which together forms:
 +
<br>
 +
<center><img height="45" src="https://static.igem.org/mediawiki/2017/9/90/UuModelingEquation4.png"></center>
 +
<br>
 +
However, the concentrations of the intermediary complexes is dependent on the concentration and hence production of protease chain P. We know that, at equilibrium concentrations, the following must hold:
 +
<br><br>
 +
<center><img height="45" src="https://static.igem.org/mediawiki/2017/4/4b/UuModelingEquation5.png"></center>
 +
<br>
 +
By combining these equations, we can get an expression for T depending on the production, decay and complex concentrations:
 +
<br><br>
 +
<center><img height="50" src="https://static.igem.org/mediawiki/2017/b/b9/UuModelingEquation6.png"></center>
 +
<br>
 +
By assuming that the DNA binding dynamics of the system occur at much faster timescales than protein production and decay, we can assume that the substrate binding of the protease and target chains is at steady state, yielding the following expressions:
 +
<br><br>
 +
<center><img height="75" src="https://static.igem.org/mediawiki/2017/0/0d/UuModelingEquation7.png"></center>
 +
<center><img height="75" src="https://static.igem.org/mediawiki/2017/1/19/UuModelingEquation8.png"></center>
 +
<center><img height="75" src="https://static.igem.org/mediawiki/2017/e/ee/UuModelingEquation9.png"></center>
 +
<br>
 +
We could then substitute these three concentrations for their expressions in the expression of the target chain concentration. Making further quasi steady state assumptions on the formation of the pre-cleavage and post-cleavage complexes reduces the expression by two more dependencies. This was done in mathematica notebook, found <a target=_BLANK href="https://static.igem.org/mediawiki/2017/2/21/UuModelingQSSAWorkouts.txt" class="url_external">here</a>.
 +
<br><br>
 +
 
 +
The resulting expression shows that the concentration of target chain depends on: 1) The concentrations of its production relative to the production of the protease chain. 2) The concentration of protease chain. 3) The concentration of substrate. 4) How much cleaved target chain is available to trap said substrate.
 +
<br><br>
 +
The fraction of the total target chain that is cleaved is a saturation function that depends on substrate and protease chain concentrations with respect to how quickly the function's saturation point is attained. We can minimize the cleaved target chain fraction, and the occurrence of substrate trapping with it, by simply having a target chain amount that is much larger than that of the substrate.
 +
<br><br>
 +
In short, the more substrate there is available per target chain, the less signal per substrate molecule we can get as ineffectual target chain concentration increases.
 +
<br><br>
 +
The equations suggest that there is a theoretical optimum for the production rates of both chains, relative to the substrate concentration in the system. Due to time constraints, the expression for this optimum could not be given. The methods given in the mathematica script provided here should be able to reach this solution, given enough time. The meaning of such an optimum, however, is questionable. As the substrate concentrations in our toolkit may differ greatly depending on severity of infection and chance, optimization through growth-rates would need to be different per sample. In conclusion, the only effective optimization of protein productions is to make sure that the protein concentrations greatly exceed the sample concentration of DNA sequence we wish to detect.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">Effects of diffusion in membrane</h2>
 +
 
 +
<b>Coarse-grained Molecular Modelling for optimization of linker lengths</b><br>
 +
 
 +
Apart from the systems approach to modeling OUTCASST, we sought to investigate the molecular properties of OUTCASST. The idea originated from our concerns about the linkers that connect the transmembrane domains and their respective intra- and extracellular domains. Our hypothesis was that longer linkers facilitate formation of the effective complex between target and protease chain but as discussed above, may also increase false positive rates since the reach of the protease is increased. We thought that there must be an optimum for all linker lengths to maximize the signal-to-noise ratio.
 +
<br><br>
 +
In order to test our hypothesis, we wrote a python script for a 2D coarse-grained Molecular Dynamics simulation of a target and a protease chain in a membrane, illustrating the limitations of diffusion in the membrane. We aimed to test the effect of different linker lengths on the false positive rate on the number of encounters between protease and transcription factor.
 +
<br><br>
 +
Unfortunately, we never we got to test our hypothesis because we had problems to realistically model the linker. In our current approach the linker is represented by a harmonic potential between the membrane domains and the intra- and extracellular domains but we believe that this does not allow for a realistic sampling of conformational space. Ideally, we would want to model the linker in the form of a polymer chain but we never pursued that idea since we put our focus more on a systems approach to OUTCASST.
 +
<br><br>
 +
 
 +
<video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" controls>
 +
<source src="https://static.igem.org/mediawiki/2017/9/99/UuModelingMDSimulationVid.mp4" type='video/mp4'/>
 +
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 +
</video>
 +
<br>
 +
 
 +
<span class="text-figure">
 +
Video: This short video records a short molecular dynamics simulation run of our python code.
 +
</span>
 +
 
 +
<br><br>
 +
Nevertheless, we showed that our molecular dynamics simulation works conceptually and that the python code could be used as a basis for other teams to theoretically investigate their transmembrane systems. For people who are curious about the inner working of this simulation, have a look in the <a target=_BLANK href="https://static.igem.org/mediawiki/2017/0/06/UuModelingMDSimulationScript.txt" class="url_external">python code</a>. We tried to comment it as clearly as possible. It is also always possible to contact us via email or facebook.
 +
<br><br>
 +
 
 +
<b>Spatial modelling of protein interactions</b><br>
 +
 
 +
To clarify the importance of membrane diffusion and as a short demonstration, a small cellular automaton model was written in C code, compiled for Ubuntu 16.04. They were made using the <a target=_BLANK href="http://theory.bio.uu.nl/rdb/software.htm" class="url_external">CASH framework</a>. Several editions were generated, each with different production rates for both protein chains. These are provided with a readme file as executable files in a zipped format <a target=_BLANK href="https://static.igem.org/mediawiki/2017/f/f3/UuModelingCAIllustrations.zip" class="url_external">here</a>.
 +
<br><br>
 +
The simulations display two fields. The first in black and white displays DNA objects diffusing in space. The second field in mustard displays the membrane of a cell. On this membrane, blue and red objects spawn that represent target and protease chains respectively. DNA diffuses
 +
four times as fast as the membrane compounds.
 +
<br><br>
 +
When a chain in the membrane field meets a DNA object in a corresponding location in the sample field, they bind. The DNA object is removed and the state of the chain is updated to
 +
a lighter colour to indicate its DNA bound state. DNA release from a chain that had it bound is also possible.
 +
<br><br>
 +
If this chain now encounters a chain of the other colour that is not bound, they can form an effective complex. The effective complex can decay in two ways. It can either fall apart into the two proteins that formed it, or it can result in a release of a protease chain and a cleaved target chain. Either of the release products remains bound to the DNA but not both. In addition, once the cleaved target chain release occurs, a counter is incremented to keep track of how much signal is produced.
 +
<br><br>
 +
In essence, these simulations do not provide much insight that was not already known beforehand but they do make for a nice illustration.
 +
<br><br>
 +
In the zipped folder, you can find five versions. The first number in its name gives the production rate of the protease chain, the second number gives the production rate of the target chain and the third number gives the decay rate of both proteins. All interactions were determined using pseudo-random number generation according to a preset function and prespecified seed.
 +
 
 +
<br><br>
 +
<h2 class="subhead" id="subhead-5">References</h2>
 +
 
 +
<ol class="references">
 +
<li data-title="Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1." data-author="Singh, Mallon, Poddar, Wang, Tipanna, Yang, Bailey and Ha." data-link="http://dx.doi.org/10.1101/205575" /> Singh, Mallon, Poddar, Wang, Tipanna, Yang, Bailey and Ha, 2017: Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1. bioRxiv preprint. <a target=_BLANK href="http://dx.doi.org/10.1101/205575" class="url_external"></a>
 +
<li data-title="Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage." data-author="Josephs, Kocak, Fitzgibbon, McMenemy, Gersbach and Marszalek." data-link="http://dx.doi.org/10.1093/nar/gkv892" /> Josephs, Kocak, Fitzgibbon, McMenemy, Gersbach and Marszalek, 2015: Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage. Nucleic Acids Research, volume 43, number 18, pages 8924-8941. DOI: 10.1093/nar/gkv892. <a target=_BLANK href="http://dx.doi.org/10.1093/nar/gkv892" class="url_external"></a>
 +
<li data-title="Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA." data-author="Richardson, C.D., Ray, G.J., DeWitt, M.A., Curie, G.L. & Corn, J.E." data-link="http://dx.doi.org/10.1038/nbt.3481" /> Richardson, C.D., Ray, G.J., DeWitt, M.A., Curie, G.L. & Corn, J.E., 2016: Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology, volume 34, number 3. DOI: 10.1038/nbt.3481. <a target=_BLANK href="http://dx.doi.org/10.1038/nbt.3481" class="url_external"></a>
 +
<li data-title="The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA." data-author="Fonfara, I., Richter, H., Bratovič, M., Rhun, A.L. & Charpentier, E." data-link="http://dx.doi.org/10.1038/nature17945" /> Fonfara, I., Richter, H., Bratovič, M., Rhun, A.L. & Charpentier, E., 2016: The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature, volume 532, pages 517-521, doi:10.1038/nature17945. <a target=_BLANK href="http://dx.doi.org/10.1038/nature17945" class="url_external"></a>
 +
</ol>
 +
 
 +
<span id="tooltip-1"></span>
 +
<span id="tooltip-2"></span>
 +
<span id="tooltip-3"></span>
 +
<span id="tooltip-4"></span>
  
 
</script>
 
</script>
Line 1,452: Line 1,696:
  
 
<script id="page-stakeholders" type="text/template">
 
<script id="page-stakeholders" type="text/template">
−
As OUTCASST is a system with a very broad application, we wanted to find the most suitable end users and focus our design on their needs and restrictions. To achieve this goal, we have interviewed multiple professionals from different backgrounds. In these conversations, we tried to discover strengths and weaknesses of our system and design with regard to existing techniques and whether the OUTCASST system would be useful in the professions of the interviewed individuals. If not, we tried to figure out in what direction it might prove more useful or what aspects needed to be improved. In addition, we also discussed safety issues and technical aspects of our toolkit design.  
+
As OUTCASST is a system with a very broad application, we wanted to find the most suitable end users and focus our design on their needs and restrictions. To achieve this goal, we have interviewed multiple professionals from different backgrounds. In these conversations, we tried to discover strengths and weaknesses of our system and design with regard to existing techniques and whether the OUTCASST system would be useful in the professions of the interviewed individuals. If not, we tried to figure out in what direction it might prove more useful or what aspects needed to be improved. In addition, we also discussed safety issues and technical aspects of our toolkit design, of which the outcomes were compiled on their own respective pages:  <a onclick="return change_page('safety', 1)" href="safety">Safety</a> and <a onclick="return change_page('product-design', 1)" href="product-design">Design & Integration</a>.
 
<br><br>
 
<br><br>
 
In the short video below, we show a summary of the journey we made to get to our end users. Besides this summary, more elaborate descriptions of each interview can be found below.
 
In the short video below, we show a summary of the journey we made to get to our end users. Besides this summary, more elaborate descriptions of each interview can be found below.
 
<br><br>
 
<br><br>
−
<video style="width: 100%;" poster="" controls>
+
 
−
<source src="" type='video/mp4'/>
+
<video onclick="this.paused?this.play():this.pause();" style="width: 100%; cursor: pointer;" poster="https://static.igem.org/mediawiki/2017/8/8d/UU-stakeholders-video-poster.png" controls>
−
<source src="" type='video/ogg; codecs="theora, vorbis"'/>
+
<source src="https://static.igem.org/mediawiki/2017/6/6f/UuHPEndUsersVid.mp4" type='video/mp4'/>
−
<source src="" type='video/webm; codecs="vp8, vorbis"'/>
+
−
<a href=""><img border="0" src="" alt="Click to view on Youtube" width="100%"></a>
+
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
</video>
 
</video>
 +
 
<div class="shuffle-container" style="position: relative; margin-top: 30px; margin-bottom: 50px; width: 900px; margin-left: -75px;">
 
<div class="shuffle-container" style="position: relative; margin-top: 30px; margin-bottom: 50px; width: 900px; margin-left: -75px;">
 
<div style="position: absolute; top: 200px; left: 350px; z-index: 1;">
 
<div style="position: absolute; top: 200px; left: 350px; z-index: 1;">
Line 1,468: Line 1,711:
 
</div>
 
</div>
 
   <div class="js-grid my-shuffle shuffle" style="height: 520.262px; transition: height 250ms cubic-bezier(0.4, 0, 0.2, 1);">
 
   <div class="js-grid my-shuffle shuffle" style="height: 520.262px; transition: height 250ms cubic-bezier(0.4, 0, 0.2, 1);">
−
   <figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity; transform: translate(0px, 0px) scale(1);">
+
   <figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-doctors').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity; transform: translate(0px, 0px) scale(1);">
 
       <div class="aspect aspect--32x9">
 
       <div class="aspect aspect--32x9">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fe/Marit_de_Wit.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fe/Marit_de_Wit.jpg"></div>
−
<div style="position: absolute; bottom: 5px; left: 5px; right: 5px; color: white; font-size: 13px; line-height: 100%;">
 
−
Marit de Wit<br>
 
−
<span style="font-style: italic;">Doctors without borders</span>
 
−
</div>
 
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
     <figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
     <figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-westerdijk').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--9x80">
 
       <div class="aspect aspect--9x80">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fc/Bert_Gerrits_van_den_Ende.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/f/fc/Bert_Gerrits_van_den_Ende.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-cancer').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 0px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--9x80">
 
       <div class="aspect aspect--9x80">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/6/63/Hans_Bos.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/6/63/Hans_Bos.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-parasitology').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--16x9">
 
       <div class="aspect aspect--16x9">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/8/8e/Jaap_van_Hellemond.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/8/8e/Jaap_van_Hellemond.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-amca').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(225px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--32x9">
 
       <div class="aspect aspect--32x9">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/4/4b/Jet_and_Ruud.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/4/4b/Jet_and_Ruud.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column col-span shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column col-span shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-genomediagnostics').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--32x9">
 
       <div class="aspect aspect--32x9">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/c/cd/Patrick_en_Pieter-Jaap.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/c/cd/Patrick_en_Pieter-Jaap.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-cancer').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(0px, 129px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--9x80">
 
       <div class="aspect aspect--9x80">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/5/59/Hugo_Snippert_%282%29.jpg"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/5/59/Hugo_Snippert_%282%29.jpg"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
−
<figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
+
<figure class="js-item column shuffle-item shuffle-item--visible" onclick="jQuery('html, body').animate({scrollTop: jQuery('#item-nfi').offset().top - 150}, 500);" style="cursor: pointer; position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(675px, 260px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 
       <div class="aspect aspect--9x80">
 
       <div class="aspect aspect--9x80">
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/d/d0/Titia_Sijen.JPG"></div>
 
         <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/d/d0/Titia_Sijen.JPG"></div>
 +
      </div>
 +
    </figure>
 +
<figure class="js-item column shuffle-item shuffle-item--visible" style="position: absolute; top: 0px; left: 0px; visibility: visible; will-change: transform; opacity: 1; transform: translate(450px, 389px) scale(1); transition-duration: 250ms; transition-timing-function: cubic-bezier(0.4, 0, 0.2, 1); transition-property: transform, opacity;">
 +
      <div class="aspect aspect--9x80" style="padding-bottom: 70%;">
 +
        <div class="aspect__inner"><img src="https://static.igem.org/mediawiki/2017/1/10/Uu-hp-team-photo.png"></div>
 
       </div>
 
       </div>
 
     </figure>
 
     </figure>
Line 1,518: Line 1,762:
 
<section class="timeline" style="width: 1000px; margin-left: -100px;">
 
<section class="timeline" style="width: 1000px; margin-left: -100px;">
 
   <div class="timeline-container" style="width: 100%;">
 
   <div class="timeline-container" style="width: 100%;">
−
     <div class="timeline-item">
+
     <div id="item-westerdijk" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,531: Line 1,775:
  
 
     </div>
 
     </div>
−
     <div class="timeline-item">
+
     <div id="item-genomediagnostics" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,550: Line 1,794:
 
     </div>
 
     </div>
 
 
−
<div class="timeline-item">
+
<div id="item-amca" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,565: Line 1,809:
 
     </div>
 
     </div>
 
 
−
<div class="timeline-item">
+
<div id="item-cancer" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,582: Line 1,826:
 
     </div>   
 
     </div>   
 
 
−
<div class="timeline-item">
+
<div id="item-nfi" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,599: Line 1,843:
 
     </div>   
 
     </div>   
 
 
−
<div class="timeline-item">
+
<div id="item-doctors" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,615: Line 1,859:
 
     </div>   
 
     </div>   
 
 
−
<div class="timeline-item">
+
<div id="item-parasitology" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,631: Line 1,875:
 
     </div>
 
     </div>
 
 
−
<div class="timeline-item">
+
<div id="item-clinical" class="timeline-item">
  
 
       <div class="timeline-img"></div>
 
       <div class="timeline-img"></div>
Line 1,658: Line 1,902:
  
 
<style type="text/css">
 
<style type="text/css">
−
.page-container ul, .page-container ol { padding-left: 20px; }
+
.page-container ul, .page-container ol { padding-left: 20px; margin: 0; }
 
.page-container ul, .page-container ol { text-align: left; }
 
.page-container ul, .page-container ol { text-align: left; }
  
Line 1,666: Line 1,910:
  
 
.url_external { background: url(https://static.igem.org/mediawiki/2017/0/0f/Uu_url_external.png) center right no-repeat !important; height: 13px !important; padding-right: 15px !important; }
 
.url_external { background: url(https://static.igem.org/mediawiki/2017/0/0f/Uu_url_external.png) center right no-repeat !important; height: 13px !important; padding-right: 15px !important; }
 +
 +
sub { vertical-align: sub; font-size: smaller; }
 +
sup { vertical-align: super; font-size: smaller; }
 +
 +
.uu-table { border: 0 !important; margin: 0 !important; }
 +
.uu-table td { border: 0 !important; padding: 0 !important; }
  
 
#modal-overlay
 
#modal-overlay
Line 1,859: Line 2,109:
 
</script>
 
</script>
  
−
<script id="page-product-design" type="text/template">
+
<script id="page-product-design" type="text/template"><!--
 
<div class="page-heading">Integrated human practices: design of OUTCASST</div>
 
<div class="page-heading">Integrated human practices: design of OUTCASST</div>
 
Altogether, we gathered information from many different fields and perspectives. All of these views helped us to optimize our design to use OUTCASST as a tool for diagnosing Chagas disease. Since we want our tool to be easy to use in the field and rural areas, there are different aspects that should be taken into account. Robustness and resistance of the toolkit to temperature fluctuations and humidity are chief among these. In addition, it is important not to rely on material and storage containers such as fridges or freezers (Marit de Wit, Doctors without borders).  
 
Altogether, we gathered information from many different fields and perspectives. All of these views helped us to optimize our design to use OUTCASST as a tool for diagnosing Chagas disease. Since we want our tool to be easy to use in the field and rural areas, there are different aspects that should be taken into account. Robustness and resistance of the toolkit to temperature fluctuations and humidity are chief among these. In addition, it is important not to rely on material and storage containers such as fridges or freezers (Marit de Wit, Doctors without borders).  
 
<br><br>
 
<br><br>
  
−
<b>INTERACTIVE SCREEN</b>
+
<style type="text/css">
 +
.tutorial-design .tutorial_button { width: 25px; height: 25px;
 +
    font-size: 1.2em;
 +
    line-height: 25px;
 +
border: 3px solid #ffb252
 +
}
  
−
<br><br>
+
.tutorial-design .container { background: transparent; z-index: 1; }
 +
</style>
 +
 
 +
<div class="tutorial tutorial-design" style="position: relative; width: 100%; display: inline-block;">
 +
<img id="figure-1" style="position: absolute; top: 0; right: 25px; width: 600px;" src="https://static.igem.org/mediawiki/2017/9/97/UU-hp-0.png">
 +
<img id="figure-2" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/4a/UU-hp-1.png">
 +
<img id="figure-3" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/49/UU-hp-2.png">
 +
<img id="figure-4" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/6/61/UU-hp-3.png">
 +
<img id="figure-5" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/3/37/UU-hp-4.png">
 +
<img id="figure-6" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/5/56/UU-hp-5.png">
 +
<img id="figure-7" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/c/c8/UU-hp-6.png">
 +
<img id="figure-8" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/d/dd/UU-hp-7.png">
 +
<img id="figure-9" style="position: absolute; top: 0; right: 25px; width: 600px; display: none;" src="https://static.igem.org/mediawiki/2017/4/4d/UU-hp-8.png">
 +
 +
<div style="clear: both;"></div>
 +
 +
<div id="popover-1" style="display: none;">
 +
The OUTCASST toolkit consists of dried cells in a closed off compartment, two medium compartments (green) and a lysis and reset buffer compartment (purple).
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-2" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 
 +
<div id="popover-2" style="display: none;">
 +
First, the seal on one of the medium compartments is broken so medium goes onto the cells. The cells will now be rejuvenated and allowed to acclimatize in 12 hours.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-3" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 
 +
<div id="popover-3" style="display: none;">
 +
After 12 hours, a patient's sample can be added to the test kit. The sample will enter the filtering compartment, which contains chemicals that bind all sorts of unwanted chemicals.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-4" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 
 +
<div id="popover-4" style="display: none;">
 +
The seal on the lysis buffer compartment is broken. The lysis buffer causes any intact cells to burst, releasing their DNA and internal contents. Unwanted cell debris is bound by the filter molecules, coated to the inside of the filtering compartment.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-5" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 +
<div id="popover-5" style="display: none;">
 +
The seal on the reset buffer compartment is broken. Reset buffer, sample and lysis buffer mingle, neutralizing each other and resulting in an isotonic mixture that will not harm the sensor cells.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-6" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 +
<div id="popover-6" style="display: none;">
 +
The second medium pocket is used to resuspend the gRNA. We kept the gRNA dry until now to prevent degradation of this sensitive chemical.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-7" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 +
<div id="popover-7" style="display: none;">
 +
The dissolved gRNA is released onto the sensor cells. The protein chains on the surface of these cells can now bind with the gRNA, making the sensor cells specific for DNA that is complementary to the gRNA they were provided with.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-8" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 +
<div id="popover-8" style="display: none;">
 +
The seal to the waste compartment is broken. As this compartment was under a slight vacuum, a part of the medium is sucked away from the cells, making room for the sample.
 +
<br>
 +
<br>
 +
<a href="javascript: void(0);" class="btn blue" id="goto-9" style="margin: 0; padding: 10px 25px; font-size: 18px;">Next</a>
 +
</div>
 +
 +
<div id="popover-9" style="display: none;">
 +
The seal to the waste compartment is closed again and so are the seals to the medium pockets. The lysed and filtered sample, containing the patient's DNA, is now brought to the cells. If the right DNA sequence is present, the cells will detect it and give an output signal.
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 20px; left: 20px; width: 40px; z-index: 2;">
 +
<span id="link-1" class="tutorial_button selected pulsing" style="font-size: 17px; width: 40px; height: 40px; line-height: 40px; border: 5px solid #ffb252;">Start</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 80px; left: 30px;">
 +
<span id="link-2" class="tutorial_button">2</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 120px; left: 30px;">
 +
<span id="link-3" class="tutorial_button">3</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 160px; left: 30px;">
 +
<span id="link-4" class="tutorial_button">4</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 200px; left: 30px;">
 +
<span id="link-5" class="tutorial_button">5</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 240px; left: 30px;">
 +
<span id="link-6" class="tutorial_button">6</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 280px; left: 30px;">
 +
<span id="link-7" class="tutorial_button">7</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 320px; left: 30px;">
 +
<span id="link-8" class="tutorial_button">8</span>
 +
</div>
 +
 +
<div class="container" style="position: absolute; top: 360px; left: 30px;">
 +
<span id="link-9" class="tutorial_button">9</span>
 +
</div>
 +
</div>
 +
 
 +
<script type="text/javascript" language="JavaScript">
 +
function tut_goto(step)
 +
{
 +
if(step == 1)
 +
{
 +
for(var i = 1; i <= 9; i++)
 +
{
 +
if(i != step)
 +
{
 +
jQuery("#link-" + i).removeClass("selected");
 +
jQuery("#link-" + i).removeClass("pulsing");
 +
jQuery("#popover-" + i).dxPopover("hide");
 +
jQuery("#figure-" + i).fadeOut("5");
 +
}
 +
else
 +
{
 +
jQuery("#popover-" + i).dxPopover("show");
 +
jQuery("#link-" + i).addClass("selected");
 +
jQuery("#link-" + i).removeClass("pulsing");
 +
jQuery("#figure-" + i).fadeIn("5");
 +
}
 +
}
 +
 +
//jQuery('html, body').animate({scrollTop: jQuery('.tutorial').offset().top - 200}, 500);
 +
}
 +
else
 +
{
 +
for(var i = 1; i <= 9; i++)
 +
{
 +
if(i != step)
 +
{
 +
jQuery("#link-" + i).removeClass("selected");
 +
jQuery("#link-" + i).removeClass("pulsing");
 +
jQuery("#popover-" + i).dxPopover("hide");
 +
jQuery("#figure-" + i).fadeOut("5");
 +
}
 +
else
 +
{
 +
jQuery("#popover-" + i).dxPopover("show");
 +
jQuery("#link-" + i).addClass("selected");
 +
jQuery("#figure-" + i).fadeIn("5");
 +
}
 +
}
 +
 +
//jQuery('html, body').animate({scrollTop: jQuery('.tutorial').offset().top - 200}, 500);
 +
}
 +
}
 +
 
 +
jQuery(function(){
 +
for(var i = 1; i <= 9; i++)
 +
{
 +
var position = "left";
 +
var showEvent = "";
 +
 +
var content = jQuery("#popover-" + i)[0].innerHTML;
 +
 +
jQuery("#popover-" + i).dxPopover({
 +
target: "#link-" + i,
 +
showEvent: "",
 +
hideEvent: "",
 +
closeOnBackButton: false,
 +
closeOnOutsideClick: false,
 +
position: {
 +
my: (position == "left" ? "right" : "left"),
 +
at: position,
 +
of: $("#link-" + i)
 +
},
 +
width: 0,
 +
height: 0,
 +
showTitle: false,
 +
visible: true,
 +
animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } },
 +
contentTemplate: "",
 +
closeOnTargetScroll: function(){
 +
return true;
 +
}
 +
}).dxPopover("hide");
 +
 +
jQuery("#popover-" + i).dxPopover({
 +
width: 300,
 +
height: "auto",
 +
animation: { show: { type: 'fade', from: 0, to: 1 }, hide: { type: 'fade', to: 0 } },
 +
contentTemplate: content
 +
});
 +
}
 +
 +
for(var i = 1; i <= 9; i++)
 +
{
 +
jQuery("#link-" + i).click(function()
 +
{
 +
tut_goto(this.id.split("-")[1]);
 +
});
 +
}
 +
 +
jQuery('body').on('click', 'a', function(event) {
 +
var id = event.target.id;
 +
 +
if(id.indexOf("goto-") > -1)
 +
{
 +
tut_goto(parseInt(id.split("-")[1]));
 +
}
 +
});
 +
});
 +
</script>
 +
 
 +
<div style="clear: both;"></div>
  
 
The tool should be cheap to produce and easy to use. To achieve this goal, the tool needs to have a closed box design wherein only the blood sample has to be added and a simple protocol can be followed to perform the test (Jet Bliek and Ruud van den Bogaard, Academical Medical Center Amsterdam: clinical genetics). Disposal of the system also needs to be considered (collaboration RIVM National Insitute for Public Health and the Environment).
 
The tool should be cheap to produce and easy to use. To achieve this goal, the tool needs to have a closed box design wherein only the blood sample has to be added and a simple protocol can be followed to perform the test (Jet Bliek and Ruud van den Bogaard, Academical Medical Center Amsterdam: clinical genetics). Disposal of the system also needs to be considered (collaboration RIVM National Insitute for Public Health and the Environment).
Line 1,882: Line 2,355:
 
The OUTCASST toolkit has a closed box design, wherein all the components to perform the test are present in distinct compartments, separated by seals. These seals can be broken by applying pressure on them.  
 
The OUTCASST toolkit has a closed box design, wherein all the components to perform the test are present in distinct compartments, separated by seals. These seals can be broken by applying pressure on them.  
 
<br><br>
 
<br><br>
−
As was stated earlier, a lot of variables need to be kept constant to keep the HEK293T cells alive. Because of this, it is not feasible to use these cells in our design. Instead, we opt to use air-dried cells from the anhydrobiotic insect, Polypelidum vanderplanki, which can be stored at room temperature for 251 days and can restart proliferating again after rehydration (Watanabe K, Imanishi S, Akiduki G, Cornette R, Okuda T. Air-dried cells from the anhydrobiotic insect, Polypedilum vanderplanki, can survive long term preservation at room temperature and retain proliferation potential after rehydration. Cryobiology. 2016 Aug 31;73(1):93-8). This way the shelf life of our tool can also be prolonged. To prevent the risk of our GMO getting out in the environment, several mechanisms and kill-switches will be incorporated in the cells, so they can only survive in our closed box system, in their resurgent state.  
+
As was stated earlier, a lot of variables need to be kept constant to keep the HEK293T cells alive. Because of this, it is not feasible to use these cells in our design. Instead, we opt to use air-dried cells from the anhydrobiotic insect, Polypelidum vanderplanki, which can be stored at room temperature for 251 days and can restart proliferating again after rehydration <i class="ref" data-id="1">1</i>. This way the shelf life of our tool can also be prolonged. To prevent the risk of our GMO getting out in the environment, several mechanisms and kill-switches will be incorporated in the cells, so they can only survive in our closed box system, in their resurgent state.  
 
This can be done by manipulating the metabolism, so that the cells can’t produce a crucial substance for survival, e.g. an amino acid, which will be added in the toolkit medium. In case the cells get out of the toolkit, they will die because of the absence of the crucial substance.
 
This can be done by manipulating the metabolism, so that the cells can’t produce a crucial substance for survival, e.g. an amino acid, which will be added in the toolkit medium. In case the cells get out of the toolkit, they will die because of the absence of the crucial substance.
 
<br><br>
 
<br><br>
Line 1,915: Line 2,388:
 
We have also heard that the tool should have a low incidence of false positive and negative results and that our device should distinguish DNA strands with one different base pair.  
 
We have also heard that the tool should have a low incidence of false positive and negative results and that our device should distinguish DNA strands with one different base pair.  
 
We want to take this information into account to design the target DNA. There are two possibilities from which we can choose. The first option would be to permit certain mutations in the target DNA, to prevent getting a false negative result in some cases. The second option would be to use a very conserved domain as target DNA and don’t allow any mismatches. From our perspective, we think the second option would be more suitable, since the specificity in our system is a very valuable aspect of the design. We have chosen to use the satellite DNA, which is present in the <i>T. cruzi</i> parasite as a 195 base pair repeat with about 100,000 copies (Aldert Bart, Academical Medical Center Amsterdam: Clinical molecular parasitologist).
 
We want to take this information into account to design the target DNA. There are two possibilities from which we can choose. The first option would be to permit certain mutations in the target DNA, to prevent getting a false negative result in some cases. The second option would be to use a very conserved domain as target DNA and don’t allow any mismatches. From our perspective, we think the second option would be more suitable, since the specificity in our system is a very valuable aspect of the design. We have chosen to use the satellite DNA, which is present in the <i>T. cruzi</i> parasite as a 195 base pair repeat with about 100,000 copies (Aldert Bart, Academical Medical Center Amsterdam: Clinical molecular parasitologist).
 +
 +
<br><br>
 +
<h2 class="subhead" id="subhead-4">References</h2>
 +
 +
<ol class="references">
 +
<li data-title="Air-dried cells from the anhydrobiotic insect, Polypedilum vanderplanki, can survive long term&hellip;" data-author="Watanabe K, Imanishi S, Akiduki G, Cornette R, Okuda T." data-link="https://doi.org/10.1016/j.cryobiol.2016.05.006" /> Watanabe K, Imanishi S, Akiduki G, Cornette R, Okuda T. Air-dried cells from the anhydrobiotic insect, Polypedilum vanderplanki, can survive long term preservation at room temperature and retain proliferation potential after rehydration. Cryobiology. 2016 Aug 31;73(1):93-8. <a target=_BLANK href="https://doi.org/10.1016/j.cryobiol.2016.05.006" class="url_external"></a>
 +
</ol>
 +
 +
<span id="tooltip-1"></span>
  
 
--></script>
 
--></script>
Line 1,920: Line 2,402:
 
<script id="page-outreach" type="text/template">
 
<script id="page-outreach" type="text/template">
 
<div class="page-heading">Outreach</div>
 
<div class="page-heading">Outreach</div>
−
Science can have an impact on the world in many ways. With our project, we are not only trying to make a difference by creating a diagnostic tool, but by reaching out to the public we hope to make science accessible for everyone as well. We tried to achieve this by collaborating with ‘de Kennis van Nu’, a platform of the Dutch national public broadcasting corporation that brings different scientific themes to the general public in an understandable way. They aim to make science accessible to everyone, old and young, and encourage everyone to be curious and bring out the scientist in themselves!  
+
Science impacts the world in many ways. With our project, we are not only aiming to make a difference by creating a diagnostic tool, but also to reach out to the public to create awareness and make science accessible for everyone. We collaborated with ‘de Kennis van Nu’, a well-known national TV program and internet platform that brings different scientific themes to the general public in an understandable way. They aim to make science accessible to everyone, old and young, and encourage everyone to be curious and bring out the scientist in themselves!  
 
On their platform, we explain the formation of Utrecht’s very first team, our design and how we are trying to solve healthcare problems.  
 
On their platform, we explain the formation of Utrecht’s very first team, our design and how we are trying to solve healthcare problems.  
−
Through our whole iGEM experience, they follow us from lab bench to Boston.
+
Through our whole iGEM experience, they follow us from lab bench to Boston. Their special about our team can be found <a target=_BLANK href="https://dekennisvannu.nl/site/special/iGEM-2017-studenten-ontwerpen-nieuw-leven/111#!/" class="url_external">here</a>.
 
<br><br>
 
<br><br>
 
Below, you can find the short movies, articles and infographics that were so far made in cooperation with Kennis van Nu to reach out to the public.  
 
Below, you can find the short movies, articles and infographics that were so far made in cooperation with Kennis van Nu to reach out to the public.  
Line 1,933: Line 2,415:
 
<h2 class="subhead" id="subhead-2">iGEM Utrecht: an introduction</h2>
 
<h2 class="subhead" id="subhead-2">iGEM Utrecht: an introduction</h2>
  
−
<video poster="" controls>
+
<video poster="https://static.igem.org/mediawiki/2017/2/2e/UU-poster-video1.png" controls>
−
<source src="" type='video/mp4'/>
+
<source src="https://static.igem.org/mediawiki/2017/b/bb/UuHPOutreach1.mp4" type='video/mp4'/>
−
<source src="" type='video/ogg; codecs="theora, vorbis"'/>
+
−
<source src="" type='video/webm; codecs="vp8, vorbis"'/>
+
−
<a href=""><img border="0" src="" alt="Click to view on Youtube" width="100%"></a>
+
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
</video>
 
</video>
  
 +
<div class="description">What does iGEM mean and what’s so fun about it? What are the biggest challenges faced during the experiments. In this movie we explain it all.</div>
 
</div>
 
</div>
 
<div class="outreach-video right">
 
<div class="outreach-video right">
Line 1,946: Line 2,426:
 
<h2 class="subhead" id="subhead-2">Meet the team</h2>
 
<h2 class="subhead" id="subhead-2">Meet the team</h2>
  
−
<video poster="" controls>
+
<video poster="https://static.igem.org/mediawiki/2017/6/6a/UU-poster-video2.png" controls>
−
<source src="" type='video/mp4'/>
+
<source src="https://static.igem.org/mediawiki/2017/6/68/UuHPOutreach2.mp4" type='video/mp4'/>
−
<source src="" type='video/ogg; codecs="theora, vorbis"'/>
+
−
<source src="" type='video/webm; codecs="vp8, vorbis"'/>
+
−
<a href=""><img border="0" src="" alt="Click to view on Youtube" width="100%"></a>
+
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
</video>
 
</video>
 +
 +
<div class="description">During the formation of the team, a lot of attention is paid to diversity of the members and their background. In this movie some of the members introduce themselves and explain why they participate in this competition.</div>
  
 
</div>
 
</div>
Line 1,959: Line 2,438:
 
<h2 class="subhead" id="subhead-2">The problem; the detection of infectious disease has to be improved</h2>
 
<h2 class="subhead" id="subhead-2">The problem; the detection of infectious disease has to be improved</h2>
  
−
<video poster="" controls>
+
<video poster="https://static.igem.org/mediawiki/2017/6/6c/Uu-outreach-video3-poster.png" controls>
−
<source src="" type='video/mp4'/>
+
<source src="https://static.igem.org/mediawiki/2017/b/bb/UuHPOutreach3.mp4" type='video/mp4'/>
−
<source src="" type='video/ogg; codecs="theora, vorbis"'/>
+
−
<source src="" type='video/webm; codecs="vp8, vorbis"'/>
+
−
<a href=""><img border="0" src="" alt="Click to view on Youtube" width="100%"></a>
+
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
</video>
 
</video>
 +
 +
<div class="description">For which problem do we find a solution in our research? The concept of the problem is explained in this draw-my-life video.</div>
  
 
</div>
 
</div>
 
<div class="outreach-video right">
 
<div class="outreach-video right">
  
−
<h2 class="subhead" id="subhead-2">Why Chagas Disease?</h2>
+
<h2 class="subhead" id="subhead-2">Labsafety for Dummies</h2>
  
−
<video poster="" controls>
+
<video poster="https://static.igem.org/mediawiki/2017/5/5b/UU-poster-video4.png" controls>
−
<source src="" type='video/mp4'/>
+
<source src="https://static.igem.org/mediawiki/2017/4/4c/UuHPOutreach4.mp4" type='video/mp4'/>
−
<source src="" type='video/ogg; codecs="theora, vorbis"'/>
+
−
<source src="" type='video/webm; codecs="vp8, vorbis"'/>
+
−
<a href=""><img border="0" src="" alt="Click to view on Youtube" width="100%"></a>
+
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
<p style="font-style:italic;color:red;border-style:solid;border-width:2px;border-color:red">Your browser either does not support HTML5 or cannot handle MediaWiki open video formats. Please consider upgrading your browser, installing the appropriate plugin or switching to a Firefox or Chrome install.</p>
 
</video>
 
</video>
 +
 +
<div class="description">The lab can be a treacherous environment. One tiny mistake, and it could be your last.. We answer important questions about how to stay safe in the lab.</div>
  
 
</div>
 
</div>
Line 2,003: Line 2,480:
 
.outreach-video>video { width: 100%; }
 
.outreach-video>video { width: 100%; }
 
.outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; }
 
.outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; }
 +
 +
.outreach-video .description { font-size: 12px; line-height: 20px; display: inline-block; }
 
</style>
 
</style>
 
</script>
 
</script>
Line 2,144: Line 2,623:
 
<span class="team-duties">
 
<span class="team-duties">
 
&rsaquo; Experimental - Secreted Cas9 and Cpf1<br>
 
&rsaquo; Experimental - Secreted Cas9 and Cpf1<br>
−
&rsaquo; Human Practices - Application
+
&rsaquo; Human Practices - Application<br>
 +
&rsaquo; Biobricks
 
</span>
 
</span>
 
 
Line 2,205: Line 2,685:
 
&rsaquo; Human Practices -<br>&nbsp;&nbsp;Application/Safety/Design<br>
 
&rsaquo; Human Practices -<br>&nbsp;&nbsp;Application/Safety/Design<br>
 
&rsaquo; Experimental - Assembly/InterLab Study<br>
 
&rsaquo; Experimental - Assembly/InterLab Study<br>
−
&rsaquo; Funding & Sponsoring
+
&rsaquo; Funding & Sponsoring<br>
 +
&rsaquo; Treasurer
 
</span>
 
</span>
 
 
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio">
+
<div class="team-bio" style="height: 61px;">
 
Hi! I'm Lishi (21), a first year master student in Pharmacy at Utrecht University. After that, I want to become a hospital pharmacist.
 
Hi! I'm Lishi (21), a first year master student in Pharmacy at Utrecht University. After that, I want to become a hospital pharmacist.
 
<div class="lb"></div>
 
<div class="lb"></div>
Line 2,579: Line 3,060:
 
<div class="team_members">
 
<div class="team_members">
 
<div class="timeline-item">
 
<div class="timeline-item">
−
<div class="timeline-content timeline-card js--fadeInLeft"><div class="card"><div class="front">
+
<div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front">
 
         <div class="timeline-img-header">
 
         <div class="timeline-img-header">
−
<img width="100%" style="margin-top: -75px;" src="">
+
<img width="100%" style="margin-top: -65px;" src="https://static.igem.org/mediawiki/2017/e/e0/UU_team_niels.png">
 
           <h2>Niels Geijsen</h2>
 
           <h2>Niels Geijsen</h2>
 
         </div>
 
         </div>
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> TODO<br>
+
Professor of Regenerative Medicine<br>
−
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
+
−
<span class="team-duties">
+
−
&rsaquo; a
+
−
</span>
+
−
+
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio" style="height: 61px;">
+
<div class="team-bio" style="height: 239px;">
−
Bio
+
Hello, I’m Niels Geijsen, and supervising the very first iGEM team of Utrecht University has been an immensely fun and inspiring adventure. Scientific challenges require for our brightest minds with diverse perspectives and backgrounds to come together. This is the Utrecht iGEM team: they are a group of smart, creative and ambitious students who have contributed a wide range of knowledge backgrounds, life experiences and hobbies to the project. It was such a fantastic experience to see how each member brought a special talent ranging from artistic drawing skills and video animation to photography, coding and web design. Together, they have truly outdone themselves.
 +
<div class="lb"></div>
 +
As a professor in regenerative medicine at the Hubrecht Institute and Utrecht University, my research team works work at the boundaries of stem cell biology and technology development with a particular focus on (genetic) muscle disease. I spent 10 years in Boston, as post-doctoral fellow at the Whitehead Institute and faculty at Massachusetts General Hospital, Harvard Medical School and the Harvard Stem Cell Institute, and I'm particularly looking forward to joining the team in Boston for the Giant Jamboree.
 +
<div class="lb"></div>
 +
Aside from science, I experiment in the kitchen, have a passion for food and wine, and enjoy outdoor activities such as sailing, hiking and skiing. My three active young boys  are a daily joy and challenge. <br>
 
<div class="team-bio-grad"></div>
 
<div class="team-bio-grad"></div>
 
</div>
 
</div>
Line 2,600: Line 3,080:
 
</span>
 
</span>
 
</div>
 
</div>
−
<div class="back"></div></div>
+
<div class="back" style="line-height: 15px; font-size: 11px;"></div></div>
 
       </div>
 
       </div>
 
   
 
   
−
  <div class="timeline-content timeline-card js--fadeInLeft"><div class="card"><div class="front">
+
  <div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front">
 
         <div class="timeline-img-header">
 
         <div class="timeline-img-header">
−
<img width="100%" style="margin-top: -75px;" src="">
+
<img width="100%" style="margin-top: -10px;" src="https://static.igem.org/mediawiki/2017/6/66/UU_team_roos2.png">
 
           <h2>Roos Masereeuw</h2>
 
           <h2>Roos Masereeuw</h2>
 
         </div>
 
         </div>
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> Professor of Experimental Pharmacology<br>Department of Pharmaceutical Sciences<br>
+
Professor of Experimental Pharmacology<br>Department of Pharmaceutical Sciences<br>
−
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
+
−
<span class="team-duties">
+
−
&rsaquo; a
+
−
</span>
+
−
+
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio" style="height: 61px;">
+
<div class="team-bio" style="height: 215px;">
−
Bio
+
Hi all, I am Roos Masereeuw, and since June 2015 I am full professor of Experimental Pharmacology at Utrecht Institute for Pharmaceutical Sciences in The Netherlands. I did a master’s in Biopharmaceutical Sciences at Leiden University, and my PhD in Pharmacology and Toxicology at Radboud University in Nijmegen (January 1997).
 +
<div class="lb"></div>
 +
Part of my PhD research and a postdoc period I did at National Institute for Environmental Sciences (NIEHS/NIH) in Research Triangle Park, North Carolina of USA. Between 1998 and 2015, I was first assistent and then associate professor at Radboud University Medical Centre in Nijmegen, after which I moved to Utrecht University.
 +
<div class="lb"></div>
 +
My research is focused on understanding the pathways that can be pharmacologically triggered to enhance repair and regeneration processes after organ injury. An example is the development of a bioartificial kidney device to partly replace kidney function. Next to science, I mostly enjoy outdoor sports when I can. This includes mountain hiking, mountain biking and running, but I also love watching Netflix series with my family, and visiting concerts and festivals.
 
<div class="team-bio-grad"></div>
 
<div class="team-bio-grad"></div>
 
</div>
 
</div>
Line 2,627: Line 3,106:
 
       </div>
 
       </div>
 
   
 
   
−
  <div class="timeline-content timeline-card js--fadeInLeft"><div class="card"><div class="front">
+
  <div class="timeline-content timeline-card js--fadeInLeft" style="height: 600px;"><div class="card"><div class="front">
 
         <div class="timeline-img-header">
 
         <div class="timeline-img-header">
−
<img width="100%" style="margin-top: -75px;" src="">
+
<img width="100%" src="https://static.igem.org/mediawiki/2017/7/7a/UU_team_guido3.png">
 
           <h2>Guido van den Ackerveken</h2>
 
           <h2>Guido van den Ackerveken</h2>
 
         </div>
 
         </div>
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> Professor of Translational Plant & Microbial Biology, Dept. Biology, Utrecht University<br>
+
Professor of Translational Plant & Microbial Biology, Dept. Biology, Utrecht University<br>
−
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
+
−
<span class="team-duties">
+
−
&rsaquo; a
+
−
</span>
+
−
+
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio" style="height: 61px;">
+
<div class="team-bio" style="height: 201px;">
−
Bio
+
Hello, I’m Guido van den Ackerveken and it is my privilege to be one of the supervisors of the energetic and bright team of Utrecht University. I am trained as a molecular biologist in the field of plant- and microbiology, and have always worked of plant-pathogen interactions. I have a research team of about 10 people and in our research we reveal molecular mechanisms in the dialogue between plants and microorganisms, which we then try to translate to improve the resistance of food crops to infectious diseases. It is real fun to work with the iGEM bunch and to support the starting researchers in their ambitious programme.
 +
<div class="lb"></div>
 +
Outside of my busy work I try to find time for playing squash and running (I ran my first marathon this year), but also of course to enjoy being with my family. Never a dull moment :-)
 
<div class="team-bio-grad"></div>
 
<div class="team-bio-grad"></div>
 
</div>
 
</div>
Line 2,651: Line 3,127:
 
       </div>
 
       </div>
 
   
 
   
−
  <div class="timeline-content timeline-card js--fadeInLeft"><div class="card"><div class="front">
+
  <div class="timeline-content timeline-card js--fadeInLeft" style="height: 590px;"><div class="card"><div class="front">
 
         <div class="timeline-img-header">
 
         <div class="timeline-img-header">
−
<img width="100%" style="margin-top: -75px;" src="">
+
<img width="100%" style="margin-top: -40px;" src="https://static.igem.org/mediawiki/2017/thumb/4/4f/UU_team_margot.jpg/507px-UU_team_margot.jpg">
 
           <h2>Margot Koster</h2>
 
           <h2>Margot Koster</h2>
 
         </div>
 
         </div>
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
−
<b>Background</b> Assistant professor of Microbiology<br>
+
Assistant professor of Microbiology<br>
−
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
+
−
<span class="team-duties">
+
−
&rsaquo; a
+
−
</span>
+
−
+
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio" style="height: 61px;">
+
<div class="team-bio" style="height: 215px;">
−
Bio
+
I am a microbiologist and work at Utrecht University. My research interest focusses on two topics. One is to unravel the mechanisms involved in secretion of proteins and the role of secreted proteins in bacteria. This knowledge is important to understand how bacteria interact with their environment and can be used  to  optimize large scale production of proteins and vaccine development.
 +
<div class="lb"></div>
 +
My second topic of interest is teaching, and especially how to stimulate students to become independent and critical researchers. Therefore, assisting the first Utrecht iGEM team has been a great experience. In my spare time, I like to eat, watch movies and spend time with my family, which includes two daughters and a lazy cat.
 
<div class="team-bio-grad"></div>
 
<div class="team-bio-grad"></div>
 
</div>
 
</div>
Line 2,675: Line 3,148:
 
       </div>
 
       </div>
 
   
 
   
−
  <div class="timeline-content timeline-card js--fadeInLeft"><div class="card"><div class="front">
+
  <div class="timeline-content timeline-card js--fadeInLeft" style="height: 590px;"><div class="card"><div class="front">
 
         <div class="timeline-img-header">
 
         <div class="timeline-img-header">
−
<img width="100%" style="margin-top: -75px;" src="">
+
<img width="100%" style="margin-top: -75px;" src="https://static.igem.org/mediawiki/2017/thumb/9/95/UU_team_clara.jpg/398px-UU_team_clara.jpg">
 
           <h2>Clara Martinez Mir</h2>
 
           <h2>Clara Martinez Mir</h2>
 
         </div>
 
         </div>
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
         <span style="display: block; font-size: 12px; padding: 0 20px;">
 
<b>Background</b> Cancer, Stem Cells and Developmental Biology<br>
 
<b>Background</b> Cancer, Stem Cells and Developmental Biology<br>
−
<div style="display: inline-block; font-weight: bold; padding-top: 10px;">Responsibilities</div><br>
 
−
<span class="team-duties">
 
−
&rsaquo; Experimental - Secreting<br>&nbsp;&nbsp;Cas9 and Cpf1/MESA replication/Assembly
 
−
</span>
 
−
 
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
 
<div style="margin-top: 10px; font-weight: bold;">Bio</div>
−
<div class="team-bio" style="height: 61px;">
+
<div class="team-bio" style="height: 201px;">
 
Hello, my name is Clara (23) and I’m a first year Cancer, Stem Cells and Developmental biology Master student in Utrecht. I finished a Bachelor’s degree in Genetics in Barcelona last year and came to the Netherlands with a fellowship for post-graduate internships abroad, which allowed me to join Niels Geijsen’s lab for six months.
 
Hello, my name is Clara (23) and I’m a first year Cancer, Stem Cells and Developmental biology Master student in Utrecht. I finished a Bachelor’s degree in Genetics in Barcelona last year and came to the Netherlands with a fellowship for post-graduate internships abroad, which allowed me to join Niels Geijsen’s lab for six months.
−
<br><br>
+
<div class="lb"></div>
 
I’m really happy to have been asked to write a piece as part of the team, even if I haven’t been there for the whole process. I joined the team during the summer period to help with some lab work that was being carried out in my former lab. It has been a great experience to help supervising the Utrecht iGEM team and its amazing people, full of joy and stress I have to admit. Now the deadline is getting closer and we are all preparing for the big final! Thank you, guys, for this opportunity!  
 
I’m really happy to have been asked to write a piece as part of the team, even if I haven’t been there for the whole process. I joined the team during the summer period to help with some lab work that was being carried out in my former lab. It has been a great experience to help supervising the Utrecht iGEM team and its amazing people, full of joy and stress I have to admit. Now the deadline is getting closer and we are all preparing for the big final! Thank you, guys, for this opportunity!  
 
<div class="team-bio-grad"></div>
 
<div class="team-bio-grad"></div>
Line 2,768: Line 3,236:
 
});
 
});
  
−
$$(".team_members")[0].on("click", ".team-expand", function(event, element)
+
for(var team_i = 0; team_i <= 1; team_i++)
 
{
 
{
−
var content = element.up(".timeline-content");
+
$$(".team_members")[team_i].on("click", ".team-expand", function(event, element)
−
var bio = content.select(".team-bio")[0].innerHTML;
+
−
+
−
$$(".team_members .card.flipped").each(function(v, k)
+
 
{
 
{
−
v.removeClassName("flipped");
+
var content = element.up(".timeline-content");
 +
var bio = content.select(".team-bio")[0].innerHTML;
 +
 +
$$(".team_members .card.flipped").each(function(v, k)
 +
{
 +
v.removeClassName("flipped");
 +
});
 +
 +
content.select(".back")[0].update(bio + "<div class='team-close'>&larr;</div>");
 +
content.select(".card")[0].addClassName("flipped");
 
});
 
});
−
 
−
content.select(".back")[0].update(bio + "<div class='team-close'>&larr;</div>");
 
−
content.select(".card")[0].addClassName("flipped");
 
−
});
 
  
−
$$(".team_members")[0].on("click", ".team-close", function(event, element)
+
$$(".team_members")[team_i].on("click", ".team-close", function(event, element)
−
{
+
{
−
var content = element.up(".timeline-content");
+
var content = element.up(".timeline-content");
−
content.select(".card")[0].removeClassName("flipped");
+
content.select(".card")[0].removeClassName("flipped");
−
});
+
});
 +
}
 
</script>
 
</script>
  
Line 2,819: Line 3,290:
 
<div class="slider_for" style="float: left; width: 400px;">
 
<div class="slider_for" style="float: left; width: 400px;">
 
<div><b>Utrecht University is a Dutch public university with over 50.000 students.</b> As our home university, they were our first sponsor. They have helped us generously with great financial support, meeting space, PR-facilities and the opportunity to use several labspaces on campus.</div>
 
<div><b>Utrecht University is a Dutch public university with over 50.000 students.</b> As our home university, they were our first sponsor. They have helped us generously with great financial support, meeting space, PR-facilities and the opportunity to use several labspaces on campus.</div>
 +
<div><b>The Jong Alumni Netwerk (JAN) organizes activities and events to help support the careers of recent graduates by providing networking opportunities.</b> JAN agreed to financially support us to make this project possible.</div>
 +
<div><b>The Hubrecht Institute is a leading research centre focusing on developmental biology and stem cell research.</b> Hubrecht institute offered us guidance and assistance with our project by facilitating a lab assistant for the work we had to do for our project.</div>
 
<div><b>RIVM is the National Institute for Public Health and the Environment, which belongs to the Ministry of Health, Welfare and Sport of the Dutch government.</b> They offered a sponsorship to the Dutch iGEM teams based on an assignment titled ‘think before you do’, stimulating us to think about the societal implications that our project could have. We submitted a proposal and the RIVM offered us a €1500 grant to further our project.</div>
 
<div><b>RIVM is the National Institute for Public Health and the Environment, which belongs to the Ministry of Health, Welfare and Sport of the Dutch government.</b> They offered a sponsorship to the Dutch iGEM teams based on an assignment titled ‘think before you do’, stimulating us to think about the societal implications that our project could have. We submitted a proposal and the RIVM offered us a €1500 grant to further our project.</div>
 
<div><b>DSM is a science-based company focusing on health, nutrition and materials to drive sustainable innovation.</b> DSM is active in many different markets, including medicine, energy and food, so developments in synthetic biology are of major interest to them. For our project, they sponsored us with €1000.</div>
 
<div><b>DSM is a science-based company focusing on health, nutrition and materials to drive sustainable innovation.</b> DSM is active in many different markets, including medicine, energy and food, so developments in synthetic biology are of major interest to them. For our project, they sponsored us with €1000.</div>
Line 2,837: Line 3,310:
 
<div style="clear: both;"></div>
 
<div style="clear: both;"></div>
  
−
<div class="sponsors_slider" style="width: 100%;">
+
<div style="position: relative; width: 100%;">
−
<div style="width: 150px;"><img src="https://static.igem.org/mediawiki/2017/e/e0/Uu17logo.png"></div>
+
<div class="sponsors_slider" style="width: 100%;">
−
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/e/e6/Uurivm.png"></div>
+
<div style="width: 150px;"><img src="https://static.igem.org/mediawiki/2017/e/e0/Uu17logo.png"></div>
−
<div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5b/Uudsm.jpeg"></div>
+
<div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/8/85/Uu-jongealumninetwerk.png"></div>
−
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/9/92/Uutakara.jpg"></div>
+
<div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/2/2a/Uu-logo-hubrecht.png"></div>
−
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/3/38/Uusnapgene.png"></div>
+
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/e/e6/Uurivm.png"></div>
−
<div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/e/e3/Uuelabjournal.png"></div>
+
<div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5b/Uudsm.jpeg"></div>
−
<div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5c/Uuidt.jpg"></div>
+
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/9/92/Uutakara.jpg"></div>
−
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/4/43/Uumathworks.png"></div>
+
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/3/38/Uusnapgene.png"></div>
−
<div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/6/67/Speechrepublic.png"></div>
+
<div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/e/e3/Uuelabjournal.png"></div>
−
<div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/d/db/Uubiolabs.png"></div>
+
<div style="width: 250px;"><img src="https://static.igem.org/mediawiki/2017/5/5c/Uuidt.jpg"></div>
−
<div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/0/05/Ufonds.png"></div>
+
<div style="width: 300px;"><img src="https://static.igem.org/mediawiki/2017/4/43/Uumathworks.png"></div>
 +
<div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/6/67/Speechrepublic.png"></div>
 +
<div style="width: 275px;"><img src="https://static.igem.org/mediawiki/2017/d/db/Uubiolabs.png"></div>
 +
<div style="width: 200px;"><img src="https://static.igem.org/mediawiki/2017/0/05/Ufonds.png"></div>
 +
</div>
 +
<div style="pointer-events: none; position: absolute; top: 0; left: 0; width: 30%; height: 100%;
 +
background: -moz-linear-gradient(left, rgba(255,255,255,1) 0%, rgba(255,255,255,0) 100%); /* FF3.6-15 */
 +
background: -webkit-linear-gradient(left, rgba(255,255,255,1) 0%,rgba(255,255,255,0) 100%); /* Chrome10-25,Safari5.1-6 */
 +
background: linear-gradient(to right, rgba(255,255,255,1) 0%,rgba(255,255,255,0) 100%); /* W3C, IE10+, FF16+, Chrome26+, Opera12+, Safari7+ */
 +
filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#ffffff', endColorstr='#00ffffff',GradientType=1 ); /* IE6-9 */
 +
"></div>
 +
<div style="pointer-events: none; position: absolute; top: 0; right: 0; width: 30%; height: 100%;
 +
background: -moz-linear-gradient(left, rgba(255,255,255,0) 0%, rgba(255,255,255,1) 100%); /* FF3.6-15 */
 +
background: -webkit-linear-gradient(left, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* Chrome10-25,Safari5.1-6 */
 +
background: linear-gradient(to right, rgba(255,255,255,0) 0%,rgba(255,255,255,1) 100%); /* W3C, IE10+, FF16+, Chrome26+, Opera12+, Safari7+ */
 +
filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#00ffffff', endColorstr='#ffffff',GradientType=1 ); /* IE6-9 */
 +
"></div>
 +
 
</div>
 
</div>
  
Line 2,886: Line 3,376:
 
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks.
 
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks.
 
<br><br>
 
<br><br>
−
Wageningen validated the secreted-Cas9 and secreted-Cpf1 biobricks for us (BB_numbers). Members of the Wageningen team came to Utrecht to perform this validation together with members of the Utrecht team in our lab. Hek293T-cells were transfected with secreted-Cas9 or secreted-Cpf1 or with regular intracellular Cas9 or Cpf1 as a control. Medium of the cells was analysed on a western blot to compare extracellular protein expression. This tells us whether Cas9 and Cpf1 are truly being secreted or if they just leak out of the cells. The results of this validation can be found on the Parts Page (> Links to [Basic Parts]) and the experimental page on secreted Cas9 and Cpf1. (>Links to [Experimental][Secreted])
+
<div style="float: right; margin-left: 35px; margin-bottom: 10px;">
 +
<img src="https://static.igem.org/mediawiki/2017/thumb/f/f5/Collab_WUR_UU.jpg/320px-Collab_WUR_UU.jpg">
 +
<br>
 +
<span class="text-figure">
 +
Our collaboration with Wageningen has been great fun.
 +
</span>
 +
</div>
 +
Wageningen validated the secreted-Cas9 and secreted-Cpf1 biobricks for us (BB_numbers).  
 +
Members of the Wageningen team came to Utrecht to perform this validation together with members of the Utrecht team in our lab.  
 +
Hek293T-cells were transfected with secreted-Cas9 or secreted-Cpf1 or with regular intracellular Cas9 or Cpf1 as a control.  
 +
Medium of the cells was analysed on a western blot to compare extracellular protein expression.  
 +
This tells us whether Cas9 and Cpf1 are truly being secreted or if they just leak out of the cells.  
 +
The results of this validation can be found on the <a onclick="return change_page('basic_part', 1)" href="basic_part">Parts Page</a> and the experimental page on <a onclick="return change_page('secretion', 1)" href="secretion">secreted Cas9 and Cpf1</a>.
 
<br><br>
 
<br><br>
−
In return, for the Wageningen team, we did a blind validation of some of their biobricks. We performed a CpxR BiFC measurement, where E.coli K12 cells were transformed with the pSB1C3-araCpBAD-CpxReYFPn-CpxReYFPc plasmid. Fluorescence was then measured over the course of 6 hours.(>Links to [Wageningen Collab Page]) We also performed a leucine zipper BiFC measurement, where we transformed split sfGFP and split Venus to E.coli K12 and also full sfGFP and full Venus as controls. Cells were then lysed and fluorescence was measured in the cell lysate. (>Links to [Wageningen Collab Page])  
+
In return, for the Wageningen team, we did a blind validation of some of their biobricks.  
−
 
+
We performed a CpxR BiFC measurement, where E.coli K12 cells were transformed with the pSB1C3-araCpBAD-CpxReYFPn-CpxReYFPc plasmid.  
−
<br><br>
+
Fluorescence was then measured over the course of 6 hours <a target=_BLANK href="https://2017.igem.org/Team:Wageningen_UR/Collaborations" class="url_external">(link)</a>.
−
<b>NICE PICTURE OF US AND WAGENINGEN GUYS IN SOME LAB</b>
+
We also performed a leucine zipper BiFC measurement, where we transformed split sfGFP and split Venus to E.coli K12 and also full sfGFP and full Venus as controls.  
 +
Cells were then lysed and fluorescence was measured in the cell lysate <a target=_BLANK href="https://2017.igem.org/Team:Wageningen_UR/Collaborations" class="url_external">(link)</a>.
  
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-3">RIVM (National Institute for Public Health and the Environment)</h2>
 
<h2 class="subhead" id="subhead-3">RIVM (National Institute for Public Health and the Environment)</h2>
  
−
As safety is a very important aspect in synthetic biology, we collaborated with the RIVM National Institute for Public Health and Environment of the Netherlands. They encouraged us to think about safety for different stakeholders. The information we gathered was summarized in an infographic, which we used to talk to the general public about synthetic biology and safety at an event organized by the RIVM. (>Links to [Human Practices][Safety])
+
As safety is a very important aspect in synthetic biology, we collaborated with the RIVM National Institute for Public Health and Environment of the Netherlands. They encouraged us to think about safety for different stakeholders.  
 +
The information we gathered was summarized in an infographic, which we used to talk to the general public about synthetic biology and safety at an event organized by the RIVM (see <a onclick="return change_page('safety', 1)" href="safety">Safety</a>).
  
 
<br><br>
 
<br><br>
−
<b>NICE PICTURE OF RAWAN AND LISHI AT THE RIVM</b>
+
 
 +
<center>
 +
<img onclick="openmodal('rivm-event')" style="cursor: pointer;" src="https://static.igem.org/mediawiki/2017/thumb/f/f7/8997_Kennisparade_%281%29.jpg/240px-8997_Kennisparade_%281%29.jpg">
 +
<br>
 +
<span class="text-figure">
 +
Attending a RIVM event. <a href="javascript:void(0)" onclick="openmodal('rivm-event')" style="font-size: 11px;">Click for full size.</a>
 +
</span>
 +
</center>
  
 
<br><br>
 
<br><br>
 
<h2 class="subhead" id="subhead-4">Dutch national science platform "De Kennis van Nu"</h2>
 
<h2 class="subhead" id="subhead-4">Dutch national science platform "De Kennis van Nu"</h2>
−
Besides working in the lab on creating a diagnostic tool, we also tried to reach out to the public to make our project (and science in general) accessible and understandable to everyone. To achieve this, we collaborated with ‘de Kennis van Nu’, a Dutch platform of the national public broadcasting organization, that brings different scientific themes to the general public in an understandable way. On this platform we explain the formation of Utrecht’s first team, our design and how we are trying to solve healthcare problems. More information and some of the short videos we made can be found on our Outreach page (>Links to [Human Practices][Outreach]) and on the website of “De Kennis van Nu”
+
Besides working in the lab on creating a diagnostic tool, we also tried to reach out to the public to make our project (and science in general) accessible and understandable to everyone. To achieve this, we collaborated with ‘de Kennis van Nu’, a Dutch platform of the national public broadcasting organization, that brings different scientific themes to the general public in an understandable way. On this platform we explain the formation of Utrecht’s first team, our design and how we are trying to solve healthcare problems.  
−
(>https://www.dekennisvannu.nl/site/special/iGEM-2017-studenten-ontwerpen-nieuw-leven/111).  
+
More information and some of the short videos we made can be found on our <a onclick="return change_page('outreach', 1)" href="outreach">Outreach</a> page and on the website of <a target=_BLANK href="https://www.dekennisvannu.nl/site/special/iGEM-2017-studenten-ontwerpen-nieuw-leven/111" class="url_external">“De Kennis van Nu”</a>.  
  
 
<br><br>
 
<br><br>
Line 2,911: Line 3,422:
  
 
<br><br>
 
<br><br>
−
<b>PICTURE OF POSTCARDS LISHI IS GONNA MAKE</b>
+
 
 +
<center>
 +
<img width="100%" src="https://static.igem.org/mediawiki/2017/thumb/b/be/Collab_dusseldorf_postcards.jpg/800px-Collab_dusseldorf_postcards.jpg">
 +
</center>
  
 
</script>
 
</script>
  
 
<script id="page-achievements" type="text/template">
 
<script id="page-achievements" type="text/template">
 +
<div style="position: absolute;top: 0;right: -250px;width: 200px;text-align: center;border: 1px solid gold;padding: 10px;border-radius: 10px;box-sizing: border-box;background: #ffedb8;">
 +
<div style="
 +
    font-weight: bold;
 +
    font-size: 20px;
 +
    color: #c48b00;
 +
    border-bottom: 1px solid #ffd700;
 +
padding-bottom: 15px;
 +
    margin-bottom: 15px;
 +
">Awards</div>
 +
<img width="100" src="https://static.igem.org/mediawiki/2017/thumb/a/a2/UU_gold_medal.png/240px-UU_gold_medal.png"><br><div style="font-size: 15px;color: #c48b00; border-bottom: 1px solid #ffd700; padding-bottom: 15px; margin-top: 5px;">Gold medal</div>
 +
<div style="margin-top: 15px; margin-bottom: 10px; font-size: 15px;color: #c48b00;"><b>Nominated</b><br />Best integrated human practices</div>
 +
</div>
 
<div class="page-heading">Achievements</div>
 
<div class="page-heading">Achievements</div>
  
−
This page will give an overview of the achievements of our team. These will be presented as the medal criteria we fulfilled to acquire the various medals. For several criteria we will provide a link to the page with more information on that item.
+
This page gives an overview of the achievements of our team. These will be presented as the medal criteria we fulfilled to acquire the various medals. For several criteria we will provide a link to the page with more information on that item.
  
 
<br><br>
 
<br><br>
Line 2,931: Line 3,457:
 
<b>Deliverables</b><br>
 
<b>Deliverables</b><br>
 
We have delivered all the required items on the iGEM deliverables page.<br>
 
We have delivered all the required items on the iGEM deliverables page.<br>
−
<table border="0" cellspacing="0" cellpadding="0" width="600">
+
<table class="uu-table" border="0" cellspacing="0" cellpadding="0" width="600" style="margin-top: 10px !important;">
 
<tr>
 
<tr>
 
<td width="250">
 
<td width="250">
 
<ul>
 
<ul>
−
<li /><a href="">Team wiki</a>
+
<li /><a onclick="return change_page('home', 1)" href="https://2017.igem.org/Team:Utrecht/">Team wiki</a>
−
<li /><a href="">Project attribution</a>
+
<li /><a onclick="return change_page('attributions', 1)" href="attributions">Project attribution</a>
−
<li /><a href="">Team poster</a>
+
<li /><a onclick="return change_page('posters', 1)" href="posters">Team poster</a>
−
<li /><a href="">Team presentation</a>
+
<li />Team presentation
−
<li /><a href="">Safety forms</a>
+
<li /><a target=_BLANK href="https://2017.igem.org/Safety/Final_Safety_Form?team_id=2351" class="url_external">Safety forms</a>
 
</ul>
 
</ul>
 
</td>
 
</td>
 
<td width="350">
 
<td width="350">
 
<ul>
 
<ul>
−
<li /><a href="">Judging form</a>
+
<li /><a target=_BLANK href="https://igem.org/2017_Judging_Form?id=2351" class="url_external">Judging form</a>
−
<li /><a href="">Registry part pages</a>
+
<li /><a onclick="return change_page('basic_part', 1)" href="basic_part">Registry part pages</a>
−
<li /><a href="">Sample submission</a>
+
<li /><a target=_BLANK href="http://parts.igem.org/cgi/dna_transfer/batch_list.cgi?group_id=2850" class="url_external">Sample submission</a>
−
<li /><a href="">Project attribution</a>
+
<li /><a onclick="return change_page('interlab-study', 1)" href="interlab-study">Contribution to InterLab Study</a>
−
<li /><a href="">Contribution to InterLab Study</a>
+
 
</ul>
 
</ul>
 
</td>
 
</td>
Line 2,963: Line 3,488:
 
<div style="float: left; width: 100%; margin: 0;">
 
<div style="float: left; width: 100%; margin: 0;">
 
<b>Validate functionality of BioBrick</b><br>
 
<b>Validate functionality of BioBrick</b><br>
−
<li /><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351012">Part BBa_K2351012 (secreted Cpf1)</a><br>
+
BioBrick Part <a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351012" class="url_external">BBa_K2351012</a> (secreted Cpf1) has been validated. This BioBrick is very special since our team successfully secreted CRISPR-associated proteins from HEK293 cells.  
−
BioBrick Part BBa_K2351012 (secreted Cpf1) has been validated. This BioBrick is very special since our team successfully secreted CRISPR-associated proteins from HEK293 cells.  
+
 
To our knowledge, this is the first time that Cpf1 has ever been expressed outside of the cell.
 
To our knowledge, this is the first time that Cpf1 has ever been expressed outside of the cell.
 +
<br><br>
 +
&rsaquo; <a onclick="return change_page('basic_part', 1)" href="basic_part">View submitted parts.</a>
 
</div>
 
</div>
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
Line 2,971: Line 3,497:
 
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. In addition, we worked with the Rathenau Institute and the RIVM on our Human Practices and safety considerations.
 
Our team collaborated with the Wageningen team to obtain independent validations of both our and their biobricks. In addition, we worked with the Rathenau Institute and the RIVM on our Human Practices and safety considerations.
 
<br><br>
 
<br><br>
−
Furthermore, we contributed a postcard design to the Düsseldorf Cologne postcards campaign. Although these are not, strictly speaking, collaborations, we have attended several meet-ups with Dutch and other European iGEM teams to exchange ideas. An overview of our collaboration efforts can be found on the Collaborations page (> Links to [Collaborations page]).
+
Furthermore, we contributed a postcard design to the Düsseldorf Cologne postcards campaign. Although these are not, strictly speaking, collaborations, we have attended several meet-ups with Dutch and other European iGEM teams to exchange ideas. An overview of our collaboration efforts can be found on the <a onclick="return change_page('collaborations', 1)" href="collaborations">Collaborations page</a>.
 
</div>
 
</div>
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 
<b>Human Practices</b><br>
 
<b>Human Practices</b><br>
−
Our team has contacted professionals from many different backgrounds to find the setting wherein the OUTCASST system would be of most use and to identify where the requirements of the intended application affect the design of our tool. Through a series of interviews with several experts, we came to the conclusion that our tool would be most useful in diagnostics and pathogen detection in particular. By talking to a representative from ‘Doctors without borders’ and a parasitology expert, we discovered that Chagas disease is a neglected tropical disease with a large impact, yet a good diagnostic tool for this disease is still missing. Therefore, we chose to focus on Chagas disease in the further design of our tool. (> Links to [Human Practices] [End User])
+
Our team has contacted professionals from many different backgrounds to find the setting wherein the OUTCASST system would be of most use and to identify where the requirements of the intended application affect the design of our tool. Through a series of interviews with several experts, we came to the conclusion that our tool would be most useful in diagnostics and pathogen detection in particular. By talking to a representative from ‘Doctors without borders’ and a parasitology expert, we discovered that Chagas disease is a neglected tropical disease with a large impact, yet a good diagnostic tool for this disease is still missing. Therefore, we chose to focus on Chagas disease in the further design of our tool. Read more about our <a onclick="return change_page('stakeholders', 1)" href="stakeholders">end users</a>.
 
<br><br>
 
<br><br>
−
Besides the interviews to find the focus of our project, we also worked on outreach. In collaboration with ‘De Kennis van Nu’, a Dutch platform that brings different scientific themes to the general public, we made videos and wrote blogs about synthetic biology, the iGEM competition, lab safety, tropical diseases and our project. To raise more awareness for the competition and our project within our university, we wrote articles in several student magazines. (> Links to [Human Practices] [Outreach])  
+
Besides the interviews to find the focus of our project, we also worked on outreach. In collaboration with ‘De Kennis van Nu’, a Dutch platform that brings different scientific themes to the general public, we made videos and wrote blogs about synthetic biology, the iGEM competition, lab safety, tropical diseases and our project. To raise more awareness for the competition and our project within our university, we wrote articles in several student magazines. Read more about our <a onclick="return change_page('outreach', 1)" href="outreach">outreach</a>.
 
</div>
 
</div>
 
</div>
 
</div>
Line 2,988: Line 3,514:
 
<div style="float: left; width: 100%; margin: 0;">
 
<div style="float: left; width: 100%; margin: 0;">
 
<b>Integrated Human Practices</b><br>
 
<b>Integrated Human Practices</b><br>
−
We incorporated the feedback we got from various professionals into the design of our final product. Not only did the information we gained make us choose for Chagas disease as the focus of our project, it also made us think about the way our system could be used on location. Through our conversations with specialists, we realized the importance of simplicity in use and resistance to varying temperatures and humidity. Only tools which take these factors into account can be used without a need for further lab equipment or trained personnel. Furthermore, with safety considerations in mind, we designed our device to keep our system separated from the outside world, making it impossible for the GMO’s to escape into the environment. (> Link to [Human Practices][Design])
+
We incorporated the feedback we got from various professionals into the design of our final product. Not only did the information we gained make us choose for Chagas disease as the focus of our project, it also made us think about the way our system could be used on location. Through our conversations with specialists, we realized the importance of simplicity in use and resistance to varying temperatures and humidity. Only tools which take these factors into account can be used without a need for further lab equipment or trained personnel. Furthermore, with safety considerations in mind, we designed our device to keep our system separated from the outside world, making it impossible for the GMO’s to escape into the environment. Read more about our <a onclick="return change_page('product-design', 1)" href="product-design">design considerations</a>.
 
</div>
 
</div>
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 
<b>Model your project</b><br>
 
<b>Model your project</b><br>
−
At the same time, our team worked on modeling our system. They first summarized the kinetics of our fusion proteins in a network of reactions. With this reaction network, we demonstrated that the system contains negative feedback on its own sensitivity and give some suggestions on how to alleviate that problem with additional bio-circuitry components. In addition, we show that the precision of the system may be increased by usage of a weaker protease. We subsequently used ODE reaction equations to test if differences in substrate affinity or protein production rates can alleviate sensitivity problems and if so, how.
+
At the same time, our team worked on modeling our system. They first summarized the kinetics of our fusion proteins in a network of reactions. With this reaction network, we demonstrated that the system contains negative feedback on its own sensitivity and give some suggestions on how to alleviate that problem with additional bio-circuitry components. In addition, we show that the precision of the system may be increased by usage of a weaker protease. We subsequently used ODE reaction equations to test if differences in substrate affinity or protein production rates can alleviate sensitivity problems and if so, how. Read more about our <a onclick="return change_page('modeling-and-mathematics', 1)" href="modeling-and-mathematics">modeling efforts</a>.
 +
</div>
 +
<div style="float: left; width: 100%; margin: 0; margin-top: 20px;">
 +
<b>Improve a previous part</b><br>
 +
The part we improved is <a target=_BLANK href="http://parts.igem.org/Part:BBa_K1774001" class="url_external">BBa_K1774001</a>. This part is <i>S. pyogenes</i> Cas9, submitted by the University of Hong Kong 2015 iGEM team. To improve this part we did three things: codon optimize it for mammalian cells, add a signal sequence for secretion from mammalian cells and add a His-tag. Modifying the Cas9 protein in this way makes it possible to get it produced and secreted from mammalian cells instead of bacteria. It can then be easily isolated and purified using the His-tag. Isolating the protein from mammalian cells instead of bacteria makes this Cas9 more suitable for clinical applications in humans or human cells. We therefore think this version of S. pyogenes Cas9 has added value in future medicine and thus is an improvement over the bacterial-produced version of <i>S. pyogenes</i> Cas9.
 +
<br><br>
 +
The improved part was submitted as <a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351013" class="url_external">BBa_K2351013</a>.
 +
<br><br>
 +
&rsaquo; <a onclick="return change_page('basic_part', 1)" href="basic_part">View all submitted parts.</a>
 
</div>
 
</div>
 
</div>
 
</div>
Line 3,003: Line 3,537:
 
<div class="page-heading">Attribution and acknowledgement</div>
 
<div class="page-heading">Attribution and acknowledgement</div>
  
−
The Utrecht iGEM team performed most of the experiments, funding, PR and human practices on their own. All additional help is acknowledged here:
+
The Utrecht iGEM team performed most of the experiments, funding, PR, human practices and other tasks on their own. All additional help is acknowledged below.
 +
For a breakdown of the contribution of individual team members, see the <a onclick="return change_page('team', 1)" href="team">Team page</a>.
  
 
<br><br>
 
<br><br>
Line 3,041: Line 3,576:
 
<br><br>
 
<br><br>
 
Thank you!
 
Thank you!
 +
</script>
 +
 +
<script id="page-basic_part" type="text/template">
 +
<div class="page-heading">BioBricks - Basic Parts</div>
 +
 +
This page contains an overview of all the basic BioBricks we created for our project.<br>
 +
Interested in our composite parts? You can find them <a onclick="return change_page('composite_part', 1)" href="composite_part">here</a>.
 +
 +
<br><br>
 +
 +
<table class="biobricktable" style="width: 100%; font-size: 12px; text-align: left;">
 +
<tr style="font-size: 15px; font-weight: bold;">
 +
<td width="150">Number</td>
 +
<td width="200">Name</td>
 +
<td>Short description</td>
 +
</tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351000" class="url_external">BBa_K2351000</a></td><td>Ig lambda-2 chain V region signal sequence</td><td>Allows for proteins to be secreted</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351001" class="url_external">BBa_K2351001</a></td><td><b>Best basic part:</b> dAsCpf1</td><td>DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351002" class="url_external">BBa_K2351002</a></td><td>nCas9 </td><td>A cas9 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component that contains illegal restriction sites.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351003" class="url_external">BBa_K2351003</a></td><td>nCpf1</td><td>A cpf1 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component that contains illegal restriction sites.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351004" class="url_external">BBa_K2351004</a></td><td>Glycine [3x] linked histidine[6x] tag</td><td>Basic histidine tag with preceding glycine linker.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351007" class="url_external">BBa_K2351007</a></td><td>nCas9 </td><td>A cas9 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351008" class="url_external">BBa_K2351008</a></td><td>nCpf1</td><td>A cpf1 variant without first Methionine and without stopcodon, such that it can be used as a fusion protein component.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351011" class="url_external">BBa_K2351011</a></td><td>dCpf1</td><td>DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351012" class="url_external">BBa_K2351012</a></td><td>sCpf1</td><td>Phytobrick* // Cpf1 that will be secreted from humane cells.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351013" class="url_external">BBa_K2351013</a></td><td>dCpf1</td><td>Phytobrick*// DNA and gRNA binding properties are maintained but no endonuclease activity is exhibited.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351014" class="url_external">BBa_K2351014</a></td><td>sCas9</td><td>Phytobrick* // Cas9 that will be secreted from humane cells.</td></tr>
 +
</table>
 +
 +
<style type="text/css">
 +
.biobricktable { border: 0 !important; margin: 0 !important; }
 +
.biobricktable tr:nth-child(even) td { background: #f7f7f7; }
 +
.biobricktable td { padding: 5px !important; border: 0 !important; vertical-align: middle !important; }
 +
</style>
 +
 +
</script>
 +
 +
<script id="page-composite_part" type="text/template">
 +
<div class="page-heading">BioBricks - Composite Parts</div>
 +
 +
This page contains an overview of all the composite BioBricks we created for our project.<br>
 +
Interested in our basic parts? You can find them <a onclick="return change_page('basic_part', 1)" href="basic_part">here</a>.
 +
 +
<br><br>
 +
 +
<table class="biobricktable" style="width: 100%; font-size: 12px; text-align: left;">
 +
<tr style="font-size: 15px; font-weight: bold;">
 +
<td width="150">Number</td>
 +
<td width="200">Name</td>
 +
<td>Short description</td>
 +
</tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351005" class="url_external">BBa_K2351005</a></td><td><b>Best composite part:</b> secreted Cas9</td><td>Cas9 that will be secreted from humane cells.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351006" class="url_external">BBa_K2351006</a></td><td>Secreted Cpf1</td><td>Cpf1 that will be secreted from humane cells.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351009" class="url_external">BBa_K2351009</a></td><td>sCas9</td><td>Cas9 that will be secreted from humane cells.</td></tr>
 +
<tr><td><a target=_BLANK href="http://parts.igem.org/Part:BBa_K2351010" class="url_external">BBa_K2351010</a></td><td>sCpf1</td><td>Cpf1 that will be secreted from humane cells.</td></tr>
 +
</table>
 +
 +
<style type="text/css">
 +
.biobricktable { border: 0 !important; margin: 0 !important; }
 +
.biobricktable tr:nth-child(even) td { background: #f7f7f7; }
 +
.biobricktable td { padding: 5px !important; border: 0 !important; vertical-align: middle !important; }
 +
</style>
 +
 +
</script>
 +
 +
<script id="page-posters" type="text/template">
 +
<div class="page-heading">Team Posters</div>
 +
 +
Displayed here are the posters that we used to present our team during various events.
 +
 +
<br><br>
 +
 +
<div style="width: 100%; text-align: center;">
 +
 +
<div class="outreach-video">
 +
<div style="width: 100%; text-align: center;">
 +
<img style="width: 150px;" src="https://static.igem.org/mediawiki/2017/thumb/b/b8/UU-poster-portrait.png/423px-UU-poster-portrait.png">
 +
</div>
 +
 +
<div class="description"><a target=_BLANK href="https://static.igem.org/mediawiki/2017/5/56/UU-poster-portrait-fullsize.pdf" class="pdf">Download poster</a></div>
 +
</div>
 +
 +
<div class="outreach-video">
 +
<div style="width: 100%; text-align: center;">
 +
<img style="width: 200px;" src="https://static.igem.org/mediawiki/2017/d/da/UU-poster-landscape.png">
 +
</div>
 +
 +
<div class="description"><a target=_BLANK href="https://static.igem.org/mediawiki/2017/4/4e/UU-poster-landscape-fullsize.pdf" class="pdf">Download poster</a></div>
 +
</div>
 +
 +
</div>
 +
 +
<div style="clear: both;"></div>
 +
 +
<style type="text/css">
 +
.outreach-video
 +
{
 +
width: 230px;
 +
    padding: 20px;
 +
    background: #fafafa;
 +
    float: left;
 +
    border: 2px solid #f6f6f6;
 +
    margin: 0 30px 0 0;
 +
display: inline-block;
 +
text-align: center;
 +
}
 +
 +
.outreach-video.right { float: right; margin-right: 0; }
 +
 +
.outreach-video>h2 { font-size: 17px; color: black; font-weight: bold; padding-bottom: 10px; border-bottom: 2px solid #f6f6f6; }
 +
 +
.outreach-video .description { font-size: 12px; line-height: 20px; display: inline-block; }
 +
</style>
 +
 
</script>
 
</script>
 
 
Line 3,168: Line 3,817:
 
},
 
},
 
"secretion" : {
 
"secretion" : {
−
1: "Secretion",
+
1: "Secreting functional Cas9 and Cpf1",
 
2: "Introduction",
 
2: "Introduction",
 
3: "Methods",
 
3: "Methods",
 
4: "Results",
 
4: "Results",
−
5: "Discussion"
+
5: "Discussion",
 +
6: "References",
 +
7: "Supplementary"
 
},
 
},
 
"mesa-replication" : {
 
"mesa-replication" : {
Line 3,194: Line 3,845:
 
"modeling-and-mathematics" : {
 
"modeling-and-mathematics" : {
 
1: "Modeling and Mathematics",
 
1: "Modeling and Mathematics",
−
2: "Optimization of the protease cleavage rate",
+
2: "False positive reduction",
−
3: "Optimization of protein production rates",
+
3: "Substrate trapping reduction",
 +
4: "Effects of diffusion in membrane",
 +
5: "References"
 
},
 
},
 
"interlab-study" : {
 
"interlab-study" : {
Line 3,216: Line 3,869:
 
2: "Toolkit design solutions",
 
2: "Toolkit design solutions",
 
3: "Additional considerations",
 
3: "Additional considerations",
 +
4: "References"
 
},
 
},
 
"outreach" : {},
 
"outreach" : {},
Line 3,243: Line 3,897:
 
6: "Administrative assistance",
 
6: "Administrative assistance",
 
7: "Final word"
 
7: "Final word"
−
}
+
},
 +
"basic_part" : {},
 +
"composite_part" : {},
 +
"posters" : {}
 
};
 
};
  
Line 3,263: Line 3,920:
 
if($$("body")[0].getAttribute("data-page") == "home")
 
if($$("body")[0].getAttribute("data-page") == "home")
 
{
 
{
−
for(var i = 1; i <= 4; i++)
+
if(same_page)
 
{
 
{
−
if(same_page)
+
for(var i = 1; i <= 4; i++)
 
{
 
{
−
for(var i = 1; i <= 4; i++)
+
jQuery("#popover-" + i).dxPopover("hide");
 +
 +
if(i == 1)
 
{
 
{
−
jQuery("#popover-" + i).dxPopover("hide");
+
jQuery("#link-" + i).addClass("selected");
−
+
jQuery("#link-" + i).addClass("pulsing");
−
if(i == 1)
+
jQuery("#figure-" + i).fadeIn("5");
−
{
+
}
−
jQuery("#link-" + i).addClass("selected");
+
else
−
jQuery("#link-" + i).addClass("pulsing");
+
{
−
jQuery("#figure-" + i).fadeIn("5");
+
jQuery("#link-" + i).removeClass("selected");
−
}
+
jQuery("#figure-" + i).fadeOut("5");
−
else
+
−
{
+
−
jQuery("#link-" + i).removeClass("selected");
+
−
jQuery("#figure-" + i).fadeOut("5");
+
−
}
+
 
}
 
}
 
}
 
}
−
else
+
}
 +
else
 +
{
 +
for(var i = 1; i <= 4; i++)
 +
{
 +
jQuery("#popover-" + i).dxPopover({
 +
animation: { show: { type: 'fade', from: 0, to: 1, duration: 0 }, hide: { type: 'fade', to: 0, duration: 0 } }
 +
}).dxPopover("hide");
 +
}
 +
}
 +
}
 +
else if($$("body")[0].getAttribute("data-page") == "product-design")
 +
{
 +
if(same_page)
 +
{
 +
for(var i = 1; i <= 9; i++)
 +
{
 +
jQuery("#popover-" + i).dxPopover("hide");
 +
 +
if(i == 1)
 +
{
 +
jQuery("#link-" + i).addClass("selected");
 +
jQuery("#link-" + i).addClass("pulsing");
 +
jQuery("#figure-" + i).fadeIn("5");
 +
}
 +
else
 +
{
 +
jQuery("#link-" + i).removeClass("selected");
 +
jQuery("#figure-" + i).fadeOut("5");
 +
}
 +
}
 +
}
 +
else
 +
{
 +
for(var i = 1; i <= 9; i++)
 
{
 
{
 
jQuery("#popover-" + i).dxPopover({
 
jQuery("#popover-" + i).dxPopover({
Line 3,409: Line 4,097:
 
 
 
if(return_false)
 
if(return_false)
 +
{
 +
history.pushState({page: page}, page, page);
 +
 
return false;
 
return false;
 +
}
 
}
 
}
 +
 +
jQuery(window).on("popstate", function(e) {
 +
if(typeof e.originalEvent !== "undefined")
 +
{
 +
if(e.originalEvent.state !== "undefined")
 +
{
 +
if(e.originalEvent.state == null)
 +
change_page("home");
 +
else if(e.originalEvent.state.page !== "undefined")
 +
change_page(e.originalEvent.state.page);
 +
}
 +
}
 +
});
  
 
function getSectionByPage(page)
 
function getSectionByPage(page)
Line 3,420: Line 4,125:
 
else
 
else
 
{
 
{
−
var section = $$(".section[data-url='" + page + "']")[0];
+
if($$(".section[data-url='" + page + "']").length == 0)
−
+
key = "home";
−
key = section.up(".sections").getAttribute("data-key");
+
else
 +
{
 +
var section = $$(".section[data-url='" + page + "']")[0];
 +
 +
if(typeof section.up(".sections") !== "undefined")
 +
key = section.up(".sections").getAttribute("data-key");
 +
else
 +
key = "home";
 +
}
 
}
 
}
 
 
Line 3,442: Line 4,155:
 
"contribution": "interlab-study",
 
"contribution": "interlab-study",
 
"model": "modeling-and-mathematics",
 
"model": "modeling-and-mathematics",
−
"improve": "",
+
"improve": "achievements",
−
"attributions": "team",
+
−
"basic_part": "",
+
−
"composite_part": "",
+
 
"hp/silver": "stakeholders",
 
"hp/silver": "stakeholders",
 
"hp/gold_integrated": "product-design",
 
"hp/gold_integrated": "product-design",
Line 3,500: Line 4,210:
 
var page = element.getAttribute("data-url");
 
var page = element.getAttribute("data-url");
 
 
−
history.pushState({}, title, page);
+
history.pushState({page: page}, title, page);
 
 
 
change_page(page);
 
change_page(page);
Line 3,530: Line 4,240:
 
page = "/igemsite/";
 
page = "/igemsite/";
 
 
−
history.pushState({}, title, page);
+
history.pushState({page: page}, title, page);
 
}
 
}
 
});
 
});
Line 3,584: Line 4,294:
 
});
 
});
 
});
 
});
 +
</script>
 +
 +
<script id="modal-rivm-event" type="text/template">
 +
<img width="650" src="https://static.igem.org/mediawiki/2017/f/f7/8997_Kennisparade_%281%29.jpg">
 
</script>
 
</script>
  

Latest revision as of 00:24, 15 December 2017

<!DOCTYPE html>

  • Home
  • Experimental
  • Human practices
  • Team & Sponsors
Cas9 & Cpf1 secretion
and activity
Comparison of endonuclease activity for Cas9 and Cpf1 that has been produced in, and excreted by, HEK293 cells.
MESA two-component system replication
Details on the MESA two-component system, explanation of its relation to our design and the results of its reproduction.
OUTCASST system production
Detailed explanation of the OUTCASST mechanism, experimental progress and technical prospects.
Modeling and
mathematics
Ordinary differential equations, cellular automaton and an object based model for optimal linker-length estimation.
InterLab study participation
Results and details of our measurements for the iGEM 2017 InterLab Study.
Stakeholders & opinions
Interviews and dialogues with stakeholders, potential users, third parties and experts relating to pathogen detection or DNA-based diagnostics.
Risks & safety-issues
Implications and design considerations relating to safety in the usage and implementation of OUTCASST as a diagnostics tool.
Design & integration
OUTCASST toolkit and product design with factors such as bio-safety and user-friendliness taken into account.
Outreach
Videos we made for the dutch public, together with 'de Kennis van Nu'.
Meet our team
About us, our interests and roles in the team and our supervisors.
Sponsors
A listing of our sponsors, how they assisted us and our gratitude for their assistance.
Collaborations
Read about our exchanges with other iGEM teams and government agencies.
Achievements
A short description of all that we have achieved during our participation in the iGEM.
Attributions
A thank-you for everyone that assited us, both in and outside the lab.
Intro
The problem
The system