Difference between revisions of "Team:NJU-China/Attributions"

Line 1: Line 1:
 
<html lang="en">
 
<html lang="en">
 
<head>
 
<head>
−
<meta charset="UTF-8">
+
    <meta charset="UTF-8">
−
<title>ATTRIBUTIONS</title>
+
    <title>PROJECT</title>
−
<link href="https://2017.igem.org/Team:NJU-China/CSS:bootstrap-min?action=raw&ctype=text/css" rel="stylesheet">
+
   
−
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:vicstyle?action=raw&ctype=text/css">
+
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:Bootstrap?action=raw&ctype=text/css">
−
<link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:jumpto?action=raw&ctype=text/css">
+
        <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:vicstyle?action=raw&ctype=text/css">
−
<script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-2-1-4?  action=raw&ctype=text/javascript"></script>
+
    <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:NJU-China/CSS:jumpto?action=raw&ctype=text/css">
−
<script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-scripts?action=raw&ctype=text/javascript"></script>
+
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-2-1-4?  action=raw&ctype=text/javascript"></script>
−
<script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-jumpto?action=raw&ctype=text/javascript"></script>
+
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-scripts?action=raw&ctype=text/javascript"></script>
−
<link href="https://2017.igem.org/Team:NJU-China/CSS:font-awesome?action=raw&ctype=text/css" rel="stylesheet">
+
    <script type="text/javascript" src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-jumpto?action=raw&ctype=text/javascript"></script>
 +
 
 
<style>
 
<style>
 
#sideMenu,
 
#sideMenu,
Line 35: Line 36:
 
}
 
}
 
#HQ_page p {
 
#HQ_page p {
−
     font-family: proxima-novabold,"Arial",Helvetica,sans-serif;
+
     font-family: proxima-nova,"Arial",Helvetica,sans-serif;
 
     font-size: 19px;
 
     font-size: 19px;
 
     text-align: justify;
 
     text-align: justify;
Line 101: Line 102:
 
     transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 
     transition: all 1.35s cubic-bezier(0.19, 1, 0.22, 1);
 
}
 
}
−
#accordion a:link,a:visited,a:hover,a:active{
 
−
text-decoration: none;
 
−
outline: none;
 
−
}
 
−
#accordion .panel{
 
−
border: none;
 
−
box-shadow: none;
 
−
border-radius: 0;
 
−
margin: 0 0 15px 10px;
 
−
background:none;
 
−
}
 
−
#accordion .panel-heading{
 
−
padding: 0;
 
−
border-radius: 30px;
 
−
}
 
−
#accordion .panel-title a{
 
−
display: block;
 
−
padding: 12px 20px 12px 50px;
 
−
background: #491A06;
 
−
font-size: 18px;
 
−
font-weight: 600;
 
−
color: #fff;
 
−
border: 0px solid transparent;
 
−
border-radius: 30px;
 
−
position: relative;
 
−
transition: all 0.3s ease 0s;
 
−
width: 400px;
 
−
margin: auto;
 
−
 
−
}
 
−
#accordion .panel-title a.collapsed{
 
−
background: #180903;
 
−
color: #9D9D99;
 
−
border: 0px solid black;
 
−
width: 400px;
 
−
margin: auto;
 
−
}
 
−
.panel-default>.panel-heading{
 
−
background: none;
 
−
}
 
−
#accordion .panel-title a:after,
 
−
#accordion .panel-title a.collapsed:after{
 
−
content: "\f107";
 
−
font-family: fontawesome;
 
−
width: 55px;
 
−
height: 55px;
 
−
line-height: 55px;
 
−
border-radius: 50%;
 
−
background: #361105;
 
−
font-size: 25px;
 
−
color: #fff;
 
−
text-align: center;
 
−
border: 0px solid transparent;
 
−
box-shadow: 0 3px 10px rgba(0, 0, 0, 0.58);
 
−
position: absolute;
 
−
top: -5px;
 
−
left: -20px;
 
−
transition: all 0.3s ease 0s;
 
−
}
 
−
#accordion .panel-title a.collapsed:after{
 
−
content: "\f105";
 
−
background: #180903;
 
−
color: #C1C0BF;
 
−
border: 0px solid #ddd;
 
−
box-shadow: none;
 
−
}
 
−
#accordion .panel-body{
 
−
padding: 20px 25px 10px 9px;
 
−
background: transparent;
 
−
font-size: 14px;
 
−
color: #DEDEDE;
 
−
line-height: 25px;
 
−
border-top: none;
 
−
position: relative;
 
−
}
 
−
#accordion .panel-body p{
 
−
padding-left: 25px;
 
−
border-left: 1px dashed #DEDEDE;
 
−
}
 
−
 
−
.page_container div
 
−
{
 
−
padding: 10px 10px;
 
−
}
 
  
 
</style>
 
</style>
 
</head>
 
</head>
 
<body>
 
<body>
−
<img src="https://static.igem.org/mediawiki/2017/b/be/NJU_China_iGEM_2017_tPep1.tiff" alt="">
 
 
     <div id="wrapper">
 
     <div id="wrapper">
 
         <div class="overlay"></div>
 
         <div class="overlay"></div>
Line 222: Line 138:
 
                     </ul>  
 
                     </ul>  
 
                 </li>
 
                 </li>
−
                <li>
+
                <li>
 
                     <a href="https://2017.igem.org/Team:NJU-China/Basic_Part"><i class="fa fa-fw fa-plus"></i> Parts </a>  
 
                     <a href="https://2017.igem.org/Team:NJU-China/Basic_Part"><i class="fa fa-fw fa-plus"></i> Parts </a>  
−
                 </li>
+
                 </li>               <li class="dropdown">
−
                <li class="dropdown">
+
 
                   <a href="https://2017.igem.org/Team:NJU-China/Notebook" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Notebook <span class="caret"></span></a>
 
                   <a href="https://2017.igem.org/Team:NJU-China/Notebook" class="dropdown-toggle" data-toggle="dropdown"><i class="fa fa-fw fa-plus"></i> Notebook <span class="caret"></span></a>
 
                   <ul class="dropdown-menu" role="menu">
 
                   <ul class="dropdown-menu" role="menu">
Line 257: Line 172:
 
             <ul>
 
             <ul>
 
                 <li>
 
                 <li>
−
                     <a href="#Team" data-number="1">
+
                     <a href="#BCL2" data-number="1">
 
                         <span class="cd-dot"></span>
 
                         <span class="cd-dot"></span>
−
                         <span class="cd-label">Team</span>
+
                         <span class="cd-label">BCL2</span>
 
                     </a>
 
                     </a>
 
                 </li>
 
                 </li>
 
                 <li>
 
                 <li>
−
                     <a href="#Advisors" data-number="2">
+
                     <a href="#tPEP" data-number="2">
 
                         <span class="cd-dot"></span>
 
                         <span class="cd-dot"></span>
−
                         <span class="cd-label">Advisors</span>
+
                         <span class="cd-label">tPEP</span>
−
                    </a>
+
−
                </li>
+
−
                <li>
+
−
                    <a href="#Instructors" data-number="3">
+
−
                        <span class="cd-dot"></span>
+
−
                        <span class="cd-label">Instructors</span>
+
 
                     </a>
 
                     </a>
 
                 </li>
 
                 </li>
Line 277: Line 186:
 
         </nav>         
 
         </nav>         
 
         <!-- Page Content -->
 
         <!-- Page Content -->
 +
       
 
<div id="page-content-wrapper">
 
<div id="page-content-wrapper">
 
           <button type="button" class="hamburger is-closed animated fadeInLeft" data-toggle="offcanvas">
 
           <button type="button" class="hamburger is-closed animated fadeInLeft" data-toggle="offcanvas">
Line 284: Line 194:
 
           </button>
 
           </button>
 
         <div class="projecttop">
 
         <div class="projecttop">
 +
           
 
         </div>
 
         </div>
 
         <div class="page_container">
 
         <div class="page_container">
−
         <div id="Team" class="first" style="padding: 50px 0;">
+
         <div id="BCL2" class="first" style="padding: 50px 0;">
 
         <div id="page_edge1">
 
         <div id="page_edge1">
 
         </div>
 
         </div>
−
             <h2>Team</h2>
+
             <h2>BCL2- siRNAs design</h2>
 
             <div class="container">
 
             <div class="container">
−
            <div class="row teamwindow" style="text-align: center;">
+
                <div class="row">
−
Team leader: Zhou Yu
+
                        BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
−
            <br />
+
                        <br />
−
Team members: Gui Yijun, Liang Chenxi, Liu Hengxin, Li Kaiming, Luo Qi, Sun Xuedi, Wu Jincheng, Zhang Zhihui
+
BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
−
            <p></p>
+
<br />
−
           
+
BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
−
            </div>
+
<br />
−
 
+
BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
−
            <div class="row teamwindow" >
+
                </div>
−
                <div class="col-md-offset-1 col-md-10">
+
                <div class="row">
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
                    These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.                  
−
                        <div class="panel panel-default">
+
                </div>                                                          
−
                            <div class="panel-heading" role="tab" id="headingOne">
+
            </div>  
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseOne" aria-expanded="true" aria-controls="collapseOne">
+
−
                                        Leading the team
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseOne" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingOne">
+
−
                                <div class="panel-body">
+
−
                                    <p>Zhou Yu founded the team and recruited the members. He allocated assignments to us everyone based on our strengths and interests. There is no doubt that his outstanding leadership ensured everything that needed to be done would get done.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
 
+
−
<div class="row teamwindow">
+
−
                <div class="col-md-offset-1 col-md-10">
+
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
−
                        <div class="panel panel-default">
+
−
                            <div class="panel-heading" role="tab" id="headingTwo">
+
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseTwo" aria-expanded="true" aria-controls="collapseTwo">
+
−
                                        Experiment
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseTwo" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingTwo">
+
−
                                <div class="panel-body">
+
−
                                    <p>Every one of us has participated in experiments.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
 
+
−
<div class="row teamwindow">
+
−
                <div class="col-md-offset-1 col-md-10">
+
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
−
                        <div class="panel panel-default">
+
−
                            <div class="panel-heading" role="tab" id="headingThree">
+
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseThree" aria-expanded="true" aria-controls="collapseThree">
+
−
                                        Wiki
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseThree" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingThree">
+
−
                                <div class="panel-body">
+
−
                                    <p>Liu Hengxin worked on the establishment and the art design of the website. Luo Qi, Zhang Zhihui, Li Kaiming, Gui Yijun and Wu Jincheng participated in web copywriting.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
 
+
−
<div class="row teamwindow">
+
−
                <div class="col-md-offset-1 col-md-10">
+
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
−
                        <div class="panel panel-default">
+
−
                            <div class="panel-heading" role="tab" id="headingFour">
+
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseFour" aria-expanded="true" aria-controls="collapseFour">
+
−
                                        Poster
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseFour" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingFour">
+
−
                                <div class="panel-body">
+
−
                                    <p>Liang Chenxi, Luo Qi and Gui Yijun was responsible for writing the texts in our poster, yet Liu Hengxin and Liang Chenxi were in charge of the design of it. They cooperated very well.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="row teamwindow">
+
−
                <div class="col-md-offset-1 col-md-10">
+
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
−
                        <div class="panel panel-default">
+
−
                            <div class="panel-heading" role="tab" id="headingFive">
+
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseFive" aria-expanded="true" aria-controls="collapseFive">
+
−
                                        Human practice
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseFive" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingFive">
+
−
                                <div class="panel-body">
+
−
                                    <p>Gui Yijun, Liang Chenxi, Wu Jincheng, Zhou Yu and our instructor Chen Xi all went to the interview in the hospital with professionals. Liu Hengxin analyzed the data online obtained through web-crawling technique to dig into people’s attitude towards weight-losing. All of us made questionaires and distributed them out. Gui Yijun, Liang Chenxi, Luo Qi and Zhou Yu went to the CCiC held by Fujian Agriculture and Foresty University, where they got acquainted with other teams’ projects and learned a lot.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
 
+
−
<div class="row teamwindow">
+
−
                <div class="col-md-offset-1 col-md-10">
+
−
                    <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true">
+
−
                        <div class="panel panel-default">
+
−
                            <div class="panel-heading" role="tab" id="headingSix">
+
−
                                <h4 class="panel-title">
+
−
                                    <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapseSix" aria-expanded="true" aria-controls="collapseSix">
+
−
                                        Presentation
+
−
                                    </a>
+
−
                                </h4>
+
−
                            </div>
+
−
                            <div id="collapseSix" class="panel-collapse collapse in" role="tabpanel" aria-labelledby="headingSix">
+
−
                                <div class="panel-body">
+
−
                                    <p>Liang Chenxi, Luo Qi and Gui Yijun made the speech PPT and will give the presentations during the competition altogether.
+
−
                                    </p>
+
−
                                </div>
+
−
                            </div>
+
−
                        </div>                 
+
−
                    </div>
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
 
         </div>
 
         </div>
−
 
+
         <div id="tPEP" class="second" style="padding: 50px 0;">
−
 
+
−
         <div id="Advisors" class="second" style="padding: 50px 0;">
+
 
             <div id="page_edge2">
 
             <div id="page_edge2">
 
             </div>         
 
             </div>         
−
             <h2>Instructors</h2>
+
             <h2>tPEP - lamp 2b fusion protein’s coding DNA fragment</h2>
 
             <div class="container">
 
             <div class="container">
−
            <div class="row">
+
                <div class="row">
−
            Chen Xi: He is an amazing and inspiring teacher. Thanks to his encouragement, we are eager to put forward innovative ideas and voice our own opinions about the ongoing work. Besides, what impresses us most is that he helps us patiently whenever we have trouble with our projects. He offers so much support and help, from the construction of the whole experimental frame to the references we choose. And I believe that’s why our project went well.
+
                    tPEP is a peptide (CKGGRAKDC ) targeted to adipose tissue as the ligand of adipocytes’ prohibitin, whilst lamp 2b is a integrin for exosomes. This part is artificially designed to create a fusion protein, tPep at the outward end of lamp 2b. With the assistance of such proteins, exosomes are capable of carrying siRNAs precisely towards adipose tissues. When the tPep binds the prohibitin of the adipocyte and an exosome’ membrane merge into the adipocyte’s, it’s time for siRNAs to act.                
−
            <br />
+
                </div>
−
            <br />
+
                <div class="row" style="text-align: center;">
−
            Chenyu Zhang: Professor Zhang is well-known for his research and development work about microRNAs. He provided us with experimental instruments and equipment. What’s more, he gave the guidance on the human practice and had contacted relevant authorities to guarantee all the activities in the plan could be on the rail. All of us feel very grateful for that.
+
                    <img src="https://static.igem.org/mediawiki/2017/c/cc/NJU_China_iGEM_2017_parts_fig1.png" alt="" style="text-align: center;" style="width:130%;">                  
−
            </div>
+
                </div>
−
            </div>
+
                <div class="row">
−
            <h2>Advisors</h2>
+
                    We package BCL2-siRNAs into exosomes by transfecting HEK293 cells with a plasmid expressing BCL2-siRNA and then collect siRNA-encapsulated exosomes. When we inject the modified exosomes into the bloodstream, exosomes will specifically identify adipocytes and fuse with them under the direction of the tPep. Once siRNAs make their entrance into adipocytes, they cause the degradation of BCL2 mRNA via base-paring. Subsequently, adipocytes’ apoptosis increase.
−
<div class="container">
+
                    <br />
−
            <div class="row">
+
                    To ensure the interference efficacy of BCL2 siRNA, four siRNA sequences targeting different sites of BCL2 mRNA were designed. After we transfected them into the mouse adipocytes, we could detect efficient knock-down of BCL2. Among these four sequences, BCL2-siRNA-2 exhibits the most powerful efficacy.
−
            Yuchen Liu , Yujing Zhang ,Li Jing
+
                </div>
−
            </div>
+
                <div class="row" style="text-align: center;">
−
            </div>           
+
                    <img src="https://static.igem.org/mediawiki/2017/1/11/NJU_China_iGEM_2017_parts_fig2.png" alt="" style="width: 50%;">
−
        </div>
+
                    <img src="https://static.igem.org/mediawiki/2017/a/a8/NJU_China_iGEM_2017_parts_fig3.png" alt=""style="width: 50%;">
−
        <div id="Instructors" class="third" style="padding: 50px 0;">
+
                </div>
−
            <div id="page_edge3">
+
                <div class="row">
−
            </div>
+
                    To prove the targeting property of tPep exosomes, we co-incubated them respectively with 3T3L1 cells (mouse adipose tissues) and C2C12 (mouse myoblasts). Also we set parallel experiments using exosomes without tPep-lamp 2b fusion protein. It was thrilling to see only tPep exosomes accumulated in the 3T3L1 cells while the other groups’ results were contrary. This fully illustrates tPep exosomes can target precisely to the adipose tissues.
−
            <h2 style="color: black;"> Acknowledgement </h2>
+
                </div>                  
−
<div class="container">
+
                </div>
−
            <div class="row">
+
                <div class="row"  style="text-align: center;">
−
            It has been a long way for NJU-China from organizing the team to writing this. We would like to express our most sincere gratitude to every individual and institute that helped us during the valuable 257 days:
+
                    <img src="https://static.igem.org/mediawiki/2017/e/e4/NJU_China_iGEM_2017_parts_fig4.png" alt="" style="width: 50%;">
−
            <br />
+
                </div>
−
Thank Prof. Zhang Chenyu and Prof. Chen Xi for their unwavering support who helped the revision of the idea. Thank our advisors Liu Minghui and Wang Yanbo for their assistance on our experiments. Thank our instructor Zhou Yu and Gao Haidong for their invaluable input on the whole project.  
+
          </div>
−
<br />
+
    </div>
−
Thanks for the funding support from M3 lab, Department of Life Science and Office of Academic Affairs of Nanjing University, who provided the laboratory and required material involved in the experiments of our project. Thank NJU Advanced Institution for Life Science and Jiangsu Engineering Center for MicroRNA Biology and Technology for the technical support. Thank Nanjing Drum-tower Hospital and Tianjin Medical University Cancer Hospital for providing the opportunity of human practice.
+
−
            </div>
+
−
            </div>            
+
−
        </div>
+
 
     </div>
 
     </div>
−
     <div id="NJU-CHINA" class="foot" style="padding: 10px 0;background-color: black;color: white;">   
+
     <div id="InterLab" class="foot" style="padding: 10px 0;background-color: black;color: white;">   
 
             <div class="container">
 
             <div class="container">
 
                 <div class="row">
 
                 <div class="row">
Line 476: Line 253:
 
                     </div>
 
                     </div>
 
                     <div class="col-sm-8 col-md-8">
 
                     <div class="col-sm-8 col-md-8">
−
                         <a href="https://2017.igem.org/Team:NJU-China" class="set_1_btn Vbtn-1" style="float: right;;margin: 10px 200px 0;"> <svg>
+
                         <a href="https://2017.igem.org/Team:NJU-China/InterLab" class="set_1_btn Vbtn-1" style="float: right;;margin: 10px 200px 0;"> <svg>
 
                         <rect x="0" y="0" fill="none" width="100%" height="100%"></rect>
 
                         <rect x="0" y="0" fill="none" width="100%" height="100%"></rect>
 
                         </svg> READ MORE </a>  
 
                         </svg> READ MORE </a>  
Line 486: Line 263:
 
<!--page-->
 
<!--page-->
 
</div>
 
</div>
−
    <!-- /#wrapper -->
+
<!-- /#wrapper -->
 
      
 
      
−
 
 
     <script src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-1110-min?action=raw&ctype=text/javascript" type="text/javascript"></script>
 
     <script src="https://2017.igem.org/Team:NJU-China/Javascript:jquery-1110-min?action=raw&ctype=text/javascript" type="text/javascript"></script>
 
     <script src="https://2017.igem.org/Team:NJU-China/Javascript:bootstrap-min-js?action=raw&ctype=text/javascript" type="text/javascript"></script>
 
     <script src="https://2017.igem.org/Team:NJU-China/Javascript:bootstrap-min-js?action=raw&ctype=text/javascript" type="text/javascript"></script>
−
 
 
     <script type="text/javascript">
 
     <script type="text/javascript">
 
         $(document).ready(function () {
 
         $(document).ready(function () {
Line 522: Line 297:
 
         });
 
         });
 
     </script>
 
     </script>
−
 
 
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 13:21, 27 October 2017

PROJECT

BCL2- siRNAs design

BCL2-si RNA – 1 sequence: CCGGGAGAACAGGGTATGATA
BCL2-si RNA – 2 sequence: TACGAGTGGGATGCTGGAGAT
BCL2-si RNA – 3 sequence: GTGGATGACTGAGTACCTGAA
BCL2-si RNA – 4 sequence: CTGCATCACTCTGGGTGCATA
These four parts are artificially designed RNA strands that function as the silencing tool for BCL2 gene’s expression through base-pairing with corresponding mRNAs. BCL2 protein is anti-apoptotic, mainly located in the cytoplasm side of the nuclear membrane, the endoplasmic reticulum and the outer membrane of mitochondria. By muting BCL2 gene’s expression, we can induce more cells’ apoptosis theoretically. We design four sequences and have a DNA synthesis company produce plasmids with codes inserted for each of them.

tPEP - lamp 2b fusion protein’s coding DNA fragment

tPEP is a peptide (CKGGRAKDC ) targeted to adipose tissue as the ligand of adipocytes’ prohibitin, whilst lamp 2b is a integrin for exosomes. This part is artificially designed to create a fusion protein, tPep at the outward end of lamp 2b. With the assistance of such proteins, exosomes are capable of carrying siRNAs precisely towards adipose tissues. When the tPep binds the prohibitin of the adipocyte and an exosome’ membrane merge into the adipocyte’s, it’s time for siRNAs to act.
We package BCL2-siRNAs into exosomes by transfecting HEK293 cells with a plasmid expressing BCL2-siRNA and then collect siRNA-encapsulated exosomes. When we inject the modified exosomes into the bloodstream, exosomes will specifically identify adipocytes and fuse with them under the direction of the tPep. Once siRNAs make their entrance into adipocytes, they cause the degradation of BCL2 mRNA via base-paring. Subsequently, adipocytes’ apoptosis increase.
To ensure the interference efficacy of BCL2 siRNA, four siRNA sequences targeting different sites of BCL2 mRNA were designed. After we transfected them into the mouse adipocytes, we could detect efficient knock-down of BCL2. Among these four sequences, BCL2-siRNA-2 exhibits the most powerful efficacy.
To prove the targeting property of tPep exosomes, we co-incubated them respectively with 3T3L1 cells (mouse adipose tissues) and C2C12 (mouse myoblasts). Also we set parallel experiments using exosomes without tPep-lamp 2b fusion protein. It was thrilling to see only tPep exosomes accumulated in the 3T3L1 cells while the other groups’ results were contrary. This fully illustrates tPep exosomes can target precisely to the adipose tissues.

NJU-CHINA

READ MORE