Tochingyuet (Talk | contribs) |
Tochingyuet (Talk | contribs) |
||
Line 77: | Line 77: | ||
<p style="font-family: roboto;font-size:115%;"> | <p style="font-family: roboto;font-size:115%;"> | ||
<center><img src="https://static.igem.org/mediawiki/2017/d/dc/CUHK_toeholdstructure.jpg" width="50%" height="auto"></center> | <center><img src="https://static.igem.org/mediawiki/2017/d/dc/CUHK_toeholdstructure.jpg" width="50%" height="auto"></center> | ||
− | The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. | + | The upper picture showed the general structure of our toehold switch (For detailed structure, please visit our <a href="https://2017.igem.org/Team:Hong_Kong-CUHK/Model"> modelling page</a>). mRFP(E1010) was chosen as the reporter of our toehold switches because it is very distinguishable by naked eyes while at the same time it can be quantified by measuring the fluorescence signal using a plate reader. The switch sequence generated by our program was linked with promoter(J23100) and reporter sequence. The trigger sequences was linked with promoter(J23100). Switches and triggers DNA were synthesized by IDT’s sponsored gBlock synthesis service. The gBlocks were used as template and amplified by PCR. The bands with correct size were gel-purified. We inserted the purified PCR products into pSB4C5 (for switch) or pSB1K3 (for trigger) using restriction cut and ligation. Sequencing results confirmed all 30 constructs were cloned. |
+ | |||
+ | Due to safety and budget concern, partial sequence of the viral gene was used. Below listed the partial sequence we used: | ||
+ | <div class="some-padding"></div> | ||
+ | <div class="some-padding"></div> | ||
+ | <div class="some-padding"></div> | ||
+ | <div class="some-padding"></div> | ||
+ | <div class="panel-group" id="accordion" role="tablist" aria-multiselectable="true"> | ||
+ | <div class="panel panel-default"> | ||
+ | <div class="panel-heading" role="tab" id="P0"> | ||
+ | <h4 class="panel-title"> | ||
+ | <a role="button" data-toggle="collapse" data-parent="#accordion" href="#P0-collapse" aria-expanded="false" aria-controls="P0-collapse"> | ||
+ | <div> | ||
+ | <div class="col-md-11">Click here to view trigger sequences </div><div class="col-md-1"><i class="fa fa-arrow-down fa-10" aria-hidden="true"></i></div> | ||
+ | </div> | ||
+ | </a> | ||
+ | </h4> | ||
+ | |||
+ | </div> | ||
+ | <div id="P0-collapse" class="panel-collapse collapse" role="tabpanel" aria-labelledby="P0"> | ||
+ | <div class="panel-body"> | ||
+ | <ol> | ||
+ | |||
+ | <table width="100%"> | ||
+ | |||
+ | <tr> | ||
+ | <th>Respective switch</th> | ||
+ | <th>Trigger sequence</th> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td>PB2-1</td> | ||
+ | <td>AAACAUUGAAAAUAAGAGUACAUGAAGGAUAUGAGGAAUUCACAAUGGUUGGGCGAAGAGCAACAGCCAUUCUAAGGAAAGCAACCAGA | ||
+ | <br>AGACUGAUCCAACUGAUAGUGAGUGGGAAAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>PB2-2</td> | ||
+ | <td>CAAGGCAACCAAGAGGCUUACGGUGCUUGGGAAGGAUGCAGGUACAUUGAUGGAAGACCCGGACGAGGGAACAGCAGGAGUGGAAUCU | ||
+ | <br>GCAGUAUUGAGGGGAUUUCUGAUUCUGGGCAAUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>PB2-3</td> | ||
+ | <td>AGAGUUAGUAAAAUGGGAGUAGAUGAAUAUUCCAGCACUGAGAGAGUGGUCGUGAGUAUUGAUCGUUUCUUGAGGGUCCGAGACCAG | ||
+ | <br>AGGGGAAACGUACUCCUGUCUCCCGAAGAGGUUUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | |||
+ | <tr> | ||
+ | <td>H5-1</td> | ||
+ | <td>UAGGGAUAAUGCAAAGGAGCUUGGUAACGGUUGUUUCGAGUUCUAUCACAGAUGUGAUAAUGAAUGUAUGGAAAGUGUAAGAAACGG | ||
+ | <br>AACGUAUGACUACCCUCAAUAUUCAGAAGAAGCUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>H5-2</td> | ||
+ | <td>AGUGGAGAAAAUCAAUCCAGCCAAUGACCUCUGUUAUCCAGGGAAUUUCAACGACUAUGAAGAACUGAAACACCUAUUGAGCAGAAUAA | ||
+ | <br>ACCAUUUUGAGAAAAUUCAGAUCAUUCCCAAUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>H5-3</td> | ||
+ | <td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGGGCUAUAGAUGGAGUCACCAAUAAGGUCAAUUC | ||
+ | <br>GAUCAUUGACAAAAUGAACACUCAGUUUGAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N1-1</td> | ||
+ | <td>CAUCAUAGCAACGAGCAGGGGAGUGGGUACGCUGCAGACAAAGAAUCCACUCAAAGGGCUAUAGAUGGAGUCACCAAUAAGGUCAAUUC | ||
+ | <br>GAUCAUUGACAAAAUGAACACUCAGUUUGAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N1-2</td> | ||
+ | <td>GUUUUCAUUUAAAUACGGCAAUGGUGUUUGGAUCGGGAGAACCAAAAGCACUAAUUCCAGGAGCGGCUUUGAAAUGAUUUGGGACCCA | ||
+ | <br>AAUGGGUGGACUGGAACGGACAGUAGCUUUUCUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N1-3</td> | ||
+ | <td>AGAAGAUAAUAACCAUCGGAUCAAUCUGUAUGGUAAUUGGGAUAGCUAGCUUAAUGUUACAAAUUGGAAACAUAAUCUCAAUAUGGAU | ||
+ | <br>CAGUCAUUCAAUUCAGACAGGGAACCAAUGCCUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>H7-1</td> | ||
+ | <td>ACACCAGAAUGCACAGGGAGAGGGAACUGCUGCAGAUUACAAAAGCACUCAAUCGGCAAUUGAUCAAAUAACAGGGAAAUUAAACCGGC | ||
+ | <br>UUAUAGCAAAAACCAACCAACAAUUUGAGUUUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>H7-2</td> | ||
+ | <td>ACACAUUAACUGAAAGAGGAGUGGAAGUCGUCAAUGCAACUGAAACGGUGGAACGAACAAACAUCCCCCGGAUCUGCUCAAAAGGGAAA | ||
+ | <br>AGGACAGUUGAUCUCGGUCAAUGUGGACUCCUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>H7-3</td> | ||
+ | <td>AGUGGCUACAAAGAUGUGAUACUUUGGUUUAGCUUCGGGGCAUCAUGUUUCAUACUUCUAGCCAUUGUAAUGGGCCUUGUCUUCAUA | ||
+ | <br>UGUGUAAAGAAUGGAAACAUGCGGUGCACUAUUUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N9-1</td> | ||
+ | <td>UUAGUCACAAGAGAACCCUAUGUUUCAUGCAACCCAGAUGAAUGCAGGUUCUAUGCUCUCAGCCAAGGAACAACAAUCAGAGGGAAACA | ||
+ | <br>CUCAAACGGUACAAUACACGAUAGGUCCCAGUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N9-2</td> | ||
+ | <td>AAUAACUUAACUAAAGGGCUCUGUACUAUAAAUUCGUGGCACAUAUAUGGGAAAGACAAUGCAGUAAGAAUUGGAGAAAGCUCGGAUGU | ||
+ | <br>UUUAGUCACAAGAGAACCCUAUGUUUCAUGCUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | <tr> | ||
+ | <td>N9-3</td> | ||
+ | <td>ACUACUUUAAAGAGGGGAAAAUAUUGAAAUGGGAGUCUCUGACUGGAACUGCUAAGCACAUUGAAGAAUGCUCAUGUUACGGGGAACGA | ||
+ | <br>ACAGGGAUUACCUGCACAUGCAAGGACAAUUUAGCGGCCGCUGCAGCUCGAG</td> | ||
+ | |||
+ | |||
+ | </tr> | ||
+ | |||
+ | |||
+ | |||
+ | </table> | ||
+ | |||
+ | </ol> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
<br> | <br> | ||
<br> | <br> | ||
Line 116: | Line 237: | ||
<p style="font-family: roboto;font-size:115%;"> | <p style="font-family: roboto;font-size:115%;"> | ||
These two backbones with different Ori and antibiotic resistance genes were used because they will be used in the following experiments. Two co-transformed plasmids should not have the same type of origin of replication (Ori), or otherwise, they will compete for the replication machinery and affect the copy number(4). A higher copy number is chosen for the trigger plasmid to ensure trigger expression is in excess in cells. In addition, having two different antibiotic resistance genes avoid dropping out of either one of the plasmids during selection. | These two backbones with different Ori and antibiotic resistance genes were used because they will be used in the following experiments. Two co-transformed plasmids should not have the same type of origin of replication (Ori), or otherwise, they will compete for the replication machinery and affect the copy number(4). A higher copy number is chosen for the trigger plasmid to ensure trigger expression is in excess in cells. In addition, having two different antibiotic resistance genes avoid dropping out of either one of the plasmids during selection. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
<br> | <br> | ||
<br> | <br> |
Revision as of 07:56, 29 October 2017