Difference between revisions of "Team:BOKU-Vienna/Experiments"

Line 212: Line 212:
 
<p style="text-align: justify;">The proof of concept D.I.V.E.R.T. cassette for use in <em>E. coli</em> contains a beta-lactamase gene (referred to as <em>amp<sup>R</sup></em>) disrupted by a self-splicing intron in reverse orientation (<em>Figure 1</em>; details on intron design can be found <a href="#ribozyme" class="page-scroll">here</a>. Upon transcription from promoter 1 (P1) the mRNA carries <em>amp<sup>R</sup></em> in sense direction which leads to non‑functional protein as the ribozyme won&rsquo;t splice due to being reversely oriented. Upon transcription from inducible promoter 2 (P2) the mRNA carries the beta-lactamase gene in antisense direction enabling the ribozyme to splice itself out. The spliced RNA should then be reverse transcribed and reintegrated into the genome replacing the original copy leading to functional beta-lactamase. Hence, only full completion of the D.I.V.E.R.T. cycle should yield ampicillin resistant cells. The D.I.V.E.R.T. cassette was synthesized as a single gBlock by IDT and inserted into a Backbone 3 of our Golden Gate standard (<a href="#BB3_02" class="bgscroll">BB3_02</a>). Instead of a GOI the gBlock contains a spacer sequence that can be replaced by any CDS in another Golden Gate reaction (with BpiI). Since the cassette was intended to be integrated we picked a strong constitutive promoter as P1 (BBa_J23100) to maintain high expression levels although the GOI would be present only in a single copy. However, all the backbones of our Golden Gate standard featured the high-copy pUC origin of replication leading to substantial stress on the cells during cloning of constructs containing strong constitutive promoters. To accommodate to this challenge we changed P1 to weaker BBa_23108 (<a href="#BB3_09" class="bgscroll">BB3_09</a>). Inserting the disrupted beta-lactamase gene with FRT sites at both ends (FRTwt upstream, FRT3<sup>5</sup> downstream) into BB3_09 gave <a href="#BB3_43" class="bgscroll"> BB3_43</a>. For P2 we selected a stronger version of the arabinose-inducible pBAD promoter (BBa_K206000).</p>
 
<p style="text-align: justify;">The proof of concept D.I.V.E.R.T. cassette for use in <em>E. coli</em> contains a beta-lactamase gene (referred to as <em>amp<sup>R</sup></em>) disrupted by a self-splicing intron in reverse orientation (<em>Figure 1</em>; details on intron design can be found <a href="#ribozyme" class="page-scroll">here</a>. Upon transcription from promoter 1 (P1) the mRNA carries <em>amp<sup>R</sup></em> in sense direction which leads to non‑functional protein as the ribozyme won&rsquo;t splice due to being reversely oriented. Upon transcription from inducible promoter 2 (P2) the mRNA carries the beta-lactamase gene in antisense direction enabling the ribozyme to splice itself out. The spliced RNA should then be reverse transcribed and reintegrated into the genome replacing the original copy leading to functional beta-lactamase. Hence, only full completion of the D.I.V.E.R.T. cycle should yield ampicillin resistant cells. The D.I.V.E.R.T. cassette was synthesized as a single gBlock by IDT and inserted into a Backbone 3 of our Golden Gate standard (<a href="#BB3_02" class="bgscroll">BB3_02</a>). Instead of a GOI the gBlock contains a spacer sequence that can be replaced by any CDS in another Golden Gate reaction (with BpiI). Since the cassette was intended to be integrated we picked a strong constitutive promoter as P1 (BBa_J23100) to maintain high expression levels although the GOI would be present only in a single copy. However, all the backbones of our Golden Gate standard featured the high-copy pUC origin of replication leading to substantial stress on the cells during cloning of constructs containing strong constitutive promoters. To accommodate to this challenge we changed P1 to weaker BBa_23108 (<a href="#BB3_09" class="bgscroll">BB3_09</a>). Inserting the disrupted beta-lactamase gene with FRT sites at both ends (FRTwt upstream, FRT3<sup>5</sup> downstream) into BB3_09 gave <a href="#BB3_43" class="bgscroll"> BB3_43</a>. For P2 we selected a stronger version of the arabinose-inducible pBAD promoter (BBa_K206000).</p>
 
<p><u>Builing the helper construct</u><br>
 
<p><u>Builing the helper construct</u><br>
<p style="text-align: justify;">The helper construct for <em>E. coli</em> (<a href="#BB3_01" class="bgscroll"> BB3_01</a>) was to be created from 3 fragments:</p>
+
<p style="text-align: justify;">The helper construct for <em>E. coli</em> (<a href="#BB3_01" class="bgscroll">BB3_01</a>) was to be created from 3 fragments:</p>
 
<p>
 
<p>
 
<ul class="ulclass">
 
<ul class="ulclass">

Revision as of 20:41, 31 October 2017

Experiments

V

Overview

Like most iGEM teams we picked a project maybe a little too ambitious to be executed in just 4 months' worth of lab work. Given enough time we could have built D.I.V.E.R.T. step by step: first finding a setting for efficient reverse transcription and reintegration prior to combining the optimized components and trying to translate the results to other host organisms in the end. Anyhow, we had to resort to a different strategy to get the most out of the time and resources we had to our hands by following both a scientific/systematic as well as a “hope for a lucky shot” approach. On the systematic side of things we wanted to lay a foundation for potential future work by trying to find decent priming conditions for reverse transcription with MMLV RT in E. coli (see here). In terms of reintegration we are confident that the well-established FLP/FRT-mediated recombination system would do the job. However, as mentioned in the theory section, FRT sites are palindromic and form stable hairpins possibly impairing transcription (and reverse transcription). To assess the severity of this potential problem we conducted terminator strength measurements with an FRT site in sense and antisense orientation (see here).

Besides this more systematic approach we still wanted to take our chances by building a D.I.V.E.R.T. cassette as well as a helper construct (carrying the RT, FLP and the primer cassettes) according to the best of our knowledge and see whether it worked. We attempted to do this for both S. cerevisiae and E. coli. (see here)

As described in the theory section, our proof of concept assay involves an intron oriented in antisense direction in perspective to the GOI and in sense direction in perspective to the retroelement that is only spliced out of the retroelement mRNA ultimately yielding selectable colonies. Since there is no splicing in prokaryotes we had to find and adopt a self-splicing ribozyme to implement this assay in E. coli (see here).

The proof of concept assay requires the D.I.V.E.R.T. cassette to be bidirectional (as an additional advantage this also prevents the RT from bumping into ribosomes in E. coli) resulting in a somewhat more intricate genetic construct (see here, figure 1) that would have been troublesome to create via classic cloning techniques and better suited for gene synthesis. As most regulatory sequences (promoters and terminators) available for S. cerevisiae are rather long (~200 to 750 bp) we turned to relatively recently published short synthetic regulatory elements1–3 to keep the synthesized construct short. The synthetic galactose-inducible minimal promoter we used (sequence retrieved from 3) was characterized and sent to iGEM to expand the range of inducible yeast promoters available in the registry (see here).

Details on the experiments conducted in the course of the generation of our CRISPR/Cas9 plug and play plasmids can be found here.

Our shot at D.I.v.e.r.t.

As argued in the theory section there are several options available for accomplishing the main processes necessary for completing the D.I.V.E.R.T. cycle (i.e. reverse transcription and recombination). Lacking the time to systematically optimize the different components we still wanted to try our luck by designing the system in a way that deemed most promising in the light of the information we had gathered during the planning phase. The experimental as well as genetic construct designs for yeast and E. coli are described below. For both hosts we chose to use RNA oligonucleotides transcribed in trans to prime reverse transcription and the FLP/FRT recombinase system for reintegration.

E. Coli

The plan
For our D.I.V.E.R.T. approach we planned on integrating 2 constructs into the E. coli chromosome: the D.I.V.E.R.T. cassette and a helper construct carrying the components required for reverse transcription and reintegration. Both integration cassettes were flanked with terminators to insulate them from nearby genomic transcription. As integration loci we picked IS6 from Bassalo et al.4 for the D.I.V.E.R.T. cassette and lacZ for the helper construct. Homologies measured 200 bp per arm outside of which we placed BsmBI recognition sites for scarless release of the fragment to be integrated from the Golden Gate backbone it was constructed in.

Building the D.I.V.E.R.T. cassette


Figure 1: Features of the E. coli D.I.V.E.R.T. cassette and proof of concept assay (T, P, PBS, RBS, FRT, ampR correspond to terminator, promoter, primer binding site, ribosomal binding site, FRT site, beta-lactamase)


The proof of concept D.I.V.E.R.T. cassette for use in E. coli contains a beta-lactamase gene (referred to as ampR) disrupted by a self-splicing intron in reverse orientation (Figure 1; details on intron design can be found here. Upon transcription from promoter 1 (P1) the mRNA carries ampR in sense direction which leads to non‑functional protein as the ribozyme won’t splice due to being reversely oriented. Upon transcription from inducible promoter 2 (P2) the mRNA carries the beta-lactamase gene in antisense direction enabling the ribozyme to splice itself out. The spliced RNA should then be reverse transcribed and reintegrated into the genome replacing the original copy leading to functional beta-lactamase. Hence, only full completion of the D.I.V.E.R.T. cycle should yield ampicillin resistant cells. The D.I.V.E.R.T. cassette was synthesized as a single gBlock by IDT and inserted into a Backbone 3 of our Golden Gate standard (BB3_02). Instead of a GOI the gBlock contains a spacer sequence that can be replaced by any CDS in another Golden Gate reaction (with BpiI). Since the cassette was intended to be integrated we picked a strong constitutive promoter as P1 (BBa_J23100) to maintain high expression levels although the GOI would be present only in a single copy. However, all the backbones of our Golden Gate standard featured the high-copy pUC origin of replication leading to substantial stress on the cells during cloning of constructs containing strong constitutive promoters. To accommodate to this challenge we changed P1 to weaker BBa_23108 (BB3_09). Inserting the disrupted beta-lactamase gene with FRT sites at both ends (FRTwt upstream, FRT35 downstream) into BB3_09 gave BB3_43. For P2 we selected a stronger version of the arabinose-inducible pBAD promoter (BBa_K206000).

Builing the helper construct

The helper construct for E. coli (BB3_01) was to be created from 3 fragments:

  • • gBlock 1: upstream lacZ homology, insulating terminators, cassette for transcription of primer 1
  • BB2_08: pBAD-RT-FLP. RT and FLP were obtained via IDT gBlocks, cloned into BB1s and combined to a bicistronic cassette using PCRs and Golden Gate.
  • • gBlock 2: cassette for transcription of primer 2, insulating terminators, downstream lacZ homology

The design allowed for subsequent exchange of the primer cassettes using BpiI (primer 1) or AscI/AflII (primer 2). To ensure defined 3’ ends the primers were attached to the HDV self-cleaving ribozyme. The sequence was taken from Gao et al.6

To our surprise, we had a really hard time obtaining positive colonies in the final cloning step of BB3_01. After having tried everything in our repertoire (lower regeneration/cultivation temepratures, pre-ligation of the fragments prior to insertion into the isolated empty backbone) without success, subsequent investigations revealed that the primer+HDV expression cassettes – which were featuring BBa_J23102, another rather strong constitutive promoter – were quite toxic for E. coli. While showing reduced growth carrying plasmids with only one primer cassette, the cells would not grow at all when both cassettes were present on the same plasmid. Again we had to resort to a weaker promoter (also BBa_J23105) to obtain positive clones (BB3_35).

Ready for integration - but not ready to integrate

With plasmids carrying both constructs at our hands we were set to finally integrate. However, our plug and play CRISPR/Cas9 was not (details in the CRISPR section). We had fatally underestimated the toxicity of leaky gene regulation when both the gene for Cas9 as well as for a functional sgRNA are present in the same cell. Hence, it took several generations of CRISPR plasmids to come up with a solution that was not too toxic for cells to grow in liquid culture but still lethal enough to screen for recombinants when induced.

So, we had to set aside the idea of integration and started to think about trying plasmid‑borne D.I.V.E.R.T. We already had everything we needed on 2 plasmids, but those shared the same origin of replication potentially leading to plasmid loss or other adverse events. To tackle this problem we amplified the origin of pSIM57 (the only origin from another compatibility group available to as at the time; details on pSIM5 can be found in the CRISPR section) and used it to build another backbone that was employed in the “speziale” plasmid series.

The final test

An overnight culture of E. coli DH10B carrying BB3_35sp. (LINK) and BB3_43 was diluted to an OD of 1 and induced with 0.2 % arabinose. 100 µL of cells were plated on LB Amp+ (100 µg/mL) after 6 and after 20 hours. Unfortunately, no colonies emerged. Our approach had failed.

X
X
X
X
X
X

tRNA Priming

test

FRT Terminaton strength

For measurement of the FRT-sequences' terminator strength we went with an adapted version of the protocol developed by Cassie Huang in Tom Knight's lab. From their experiments we took their plasmid for calibration, BBa_I13515. This plasmid contains a promoter, followed by two consecutive genes for GFP and RFP expression and finally a terminator. If a terminator is inserted in between GFP and RFP, the amount of expressed RFP is decreased relative to the amount of expressed GFP. This can be measured via fluorescence and the terminator strength can be calculated with the following formula (1) from Jason Kelly in Drew Endy's lab:

In formula (1) RFPterm and GFPterm represent the number of fluorescence units from RFP and GFP respectively with the tested terminator in-between and RFPcontrol and GFPcontrol were taken from cultures containing the original plasmid BBa_I13514.

To test the terminator strength of our FRT-sequence, we created four different plasmids from BBa_I13415 as template (click to see the plasmid maps):

  • FRT: With the FRT-sequence in between GFP and RFP
  • TRF: With the inverted FRT-sequence in-between
  • RNDM With a random sequence the same size as the FRT-sequence1
  • B1001 With the terminator BBa_B1001 in-between, as positive control of termination

X
X
X
X
X

The plasmids were created as follows. First, a BsmBI-recognition site inside the CmR gene was removed via site-directed mutagenesis. From that template, primers were designed to anneal alongside the space between the genes for GFP and RFP. Annexed to those primers were the respective halves of the target inserts, as well as BsmBI-fusion sites. These primers were used for PCR; the linear PCR-products were then digested with BsmBI and ligated with T4-ligase, resulting in circular plasmids containing our inserts at the desired position.

To test the terminator strength, aforementioned plasmids were transformed in E. coli DH10B and selected on agar plates containing chloramphenicol. From those plates, colonies were used to inoculate the pre-cultures for our determination - test tubes with 1 mL LB-medium and chloramphenicol, shaken overnight at 180 rpm and 37°C. For main-cultures we used test tubes containing 1 mL LB-medium with chloramphenicol, inoculated to an OD600 of 0.1 from the pre-cultures. After 2h inoculation time, protein expression was induced with addition of arabinose to a concentration of 0.1% and after 10h inoculation time, cells were harvested for fluorescence measurement.

Each plasmid was cultured in triplets. Measurements were done using a Tecan i-control infinite 200 plate reader device. Culture broth was transferred to Nunclon 96 Flat Bottom Black well plates. Fluorescence measurements were done at 488 nm excitation wavelength and 530 nm emission wavelength for GFP-quantification as well as 531 nm excitation wavelength and 650 nm emission wavelength for RFP-quantification. Gain was set to 60. Results can be seen below:

Table 1: Results from the fluorescence measurements and calculation of the terminator efficiency
Figure 1: Terminator efficiencies of our tested sequences.



As a conclusion, we can see that some unknown factor is influencing our measurements, since the inserted random sequence shows a terminator efficiency of around 0.5. This may be due to issues with mRNA stability or some other factor, however, the exact reason would have to be investigated further. What still can be seen from our results is, that the FRT sequence shows clear termination activity -but only if read in one direction.

[1]:The random sequence was tested as an additional control for the calibration. This is the sequence: GGTCGCGAGTACCTGAACTAAGGCTCCGGACAGGACTATATACTAAGG

self-splicing ribozyme

and the antibiotic resistance gene

Design

Selection of a self-splicing ribozyme:
For the proof of concept for D.I.V.E.R.T. an antibiotic resistance with an intron on the lagging strand is required. While in yeast there are plenty of well-described introns to choose from, in E. coli information is more rare. However, scientists already discovered group I and group II introns working in prokaryotes as well. For example, the Tetrahymena group I intron, or self-splicing ribozyme, is proven to exhibit splicing activity in vivo in E. coli without the expression of additional supporting proteins1. In contrast to other self-splicing ribozymes the Tetrahymena group I intron can easily be engineered to cut itself scarlessly. For the exact recognition of the splicing sites intron-exon pairing sequences are present in the wild type mRNA. The most important of these regions are called P1 and P10 (paired region 1 and 10)2. P1 determines the 5’ end of the self-splicing ribozyme and contains P1ex, which has a considerable influence on the splicing activity. P10 pairs with an exon sequence close to the 3’ end and is therefore signalling the 3’ end of the intron. Although P1 and P10 mark opposite ends of the intron, they are both located in the same region and it is worth noticing that P1 and P10 can overlap.


Figure 1: Design of the precursor mRNA. Exon bases are written in lowercase, the Tetrahymena group I intron bases in capital letters. A part of the P1 region is complementary to the 5’ exon sequence determining the 5’ end of the intron, whereas the P10 region is determining the 3’ end.


Selection of an antibiotic resistance:
For the Tetrahymena group I intron Guo et al. proposed in their publication3 that the 5’ adjacent exon sequence of the mRNA should consist of CUCUCU. Concerning this and the requirement of the intron being on the lagging strand we were looking for an antibiotic resistance with AGAGAG (reverse complementary to CUCUCU). We finally chose an ampicillin resistance, a β-lactamase5, which exhibits AGAGAA approximately in the middle of the gene4. By introducing a silent mutation (A357G) the desired 5’ adjacent exon sequence could be obtained. Furthermore, a BsaI recognition site (T718, C719, T720) was silently mutated to comply with our Golden Gate-cloning standard.

Design of the self-splicing ribozyme:
When the Tetrahymena group I intron is inserted into a foreign gene, the adjustment of P1 and P10 are crucial for the preservation of the self-splicing ability: The P10 region was exchanged for bases complementary to the 3’ adjacent exon sequence of the new β-lactamase gene. Because P1ex and P10 are overlapping, P1 was altered as well. Additionally, as Guo et al. suggests3, a non-complementary base pair was introduced in the P1ex sequence to promote splicing activity.


Figure 2: Design of the precursor mRNA of the β-lactamase gene with the engineered Tetrahymena intron . Exon bases are written in lowercase, intron bases in capital letters. The β-lactamase sequence is reverse complementary due to the proof of concept setup. P1 as well as P10 were altered in the process of the design.


Experiments & Results

Proof of self-splicing:
To test the functionality of the engineered self-splicing Tetrahymena group I intron with the adjacent β-lactamase exon sequence, it was cloned into an expression vector and transformed into E. coli. The total mRNA was then purified and and a cDNA synthesis was performed using gene specific primer. For enhancing the amount of detectable DNA a PCR with was done afterwards. A gel electrophoresis was performed where both, spliced, and unspliced DNA was visible.


Figure 3: The sample was loaded on a agarose gel. After 40 min at 130 V two bands were visible. One 1248 bp long represents the unspliced mRNA, the second, 835 bp long, represents the spliced mRNA.


The 835 bp band was cut out and cleaned up. By performing a PCR the DNA was multiplied and subsequently sent for sequencing, which confirmed the self-splicing activity exactly as it was intended during the design.

Ampicillin resistance:
For the proof of concept a functional ampicillin resistance gene is required and, since the recombination is FLP/FRT mediated, a FRT sequence is introduced after the start and stop codon. Therefore, after Met 16 additional amino acids are expressed at the N-terminus of the ampicillin resistance gene. To test if the ampicillin resistance is still functional, this modified gene is cloned into an expression vector. After subsequent transformation into chemical competent E. Coli DH10b, cells are plated on LB low salt agar with 100 µg/mL ampicillin concentration. After an overnight incubation ampicillin resistant colonies were visible. For verification a colony was picked and its plasmid was purified and the instert sequenced.



[1]: Waring RB, Ray JA, Edwards SW, Scazzocchio C, Davies RW. The Tetrahymena rRNA intron self-splices in E. coli: in vivo evidence for the importance of key base-paired regions of RNA for RNA enzyme function. Cell. 1985 Feb;40(2):371-80.

[2]: Burke JM, Cech TR, Davies RW, Schweyen RJ, Shub DA, Szostak JW, Tabak HF. Structural conventions for group I introns. Nucleic Acids Res. 1987 Sep 25; 15(18): 7217–7221.

[3]: Guo F, Cech TR. In vivo selection of better self-splicing introns in Escherichia coli: the role of the P1 extension helix of the Tetrahymena intron. RNA. 2002 May;8(5):647-58.

[4]: Zhou W, Wang Y, Lin J. Functional cloning and characterization of antibiotic resistance genes from the chicken gut microbiome.Appl Environ Microbiol. 2012 Apr;78(8):3028-32. doi: 10.1128/AEM.06920-11. Epub 2012 Jan 27.

CRISPR assisted integration

test