Zhuangpeiyue (Talk | contribs) |
Zhuangpeiyue (Talk | contribs) |
||
Line 167: | Line 167: | ||
<p>Figure 4. Blank subtraction and correction of fluorescence measurement.</p> | <p>Figure 4. Blank subtraction and correction of fluorescence measurement.</p> | ||
<p>Table 8.Raw data of Fl/Abs600.</p> | <p>Table 8.Raw data of Fl/Abs600.</p> | ||
− | <table class=" | + | <table class="small"> |
<tr><th>FI/OD600</th><td colspan="2">Neg. Control</td><td colspan="2">Pos. Control</td><td colspan="2">Device 1</td><td colspan="2">Device 2</td><td colspan="2">Device 3</td><td colspan="2">Device 4</td><td colspan="2">Device 5</td><td colspan="2">Device 6</td></tr> | <tr><th>FI/OD600</th><td colspan="2">Neg. Control</td><td colspan="2">Pos. Control</td><td colspan="2">Device 1</td><td colspan="2">Device 2</td><td colspan="2">Device 3</td><td colspan="2">Device 4</td><td colspan="2">Device 5</td><td colspan="2">Device 6</td></tr> | ||
<tr><th></th><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td></tr> | <tr><th></th><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td><td>Colony 1</td><td>Colony 2</td></tr> |
Revision as of 11:37, 28 September 2017
JNFLS
Interlab
Methods
Background
The interlab is aimed to create reliable and repeatable measurement data and standardize the measurement of fluorescence in labs around the world by testing replicability of data, thus achieving to support the engineering of biological experiment. This academic community prevents the disadvantages of difference in experiment by providing a detailed protocol and data analysis method. Interlab has become one of the largest interlaboratory study worldwide in synthetic biology, hitherto. The data collected from the previous studies is summarized in a presentation iGEM 2016 Interlab Results Presentation. This time it is done by following the same protocols designed for a plate reader and a flow cytometer that will produce data in same units everywhere so it can be compared and analysed. Our team decided to test both protocols to measure the fluorescence.
Materials
Plasmids used
Positive Control Device: I20270 in pSB1C3 (Located in Kit Plate 6, well 20B)
Negative Control Device: R0040 in pSB1C3 (Located in Kit Plate 6, well 20D)
• Test Device 1: J23101+I13504 in pSB1C3 (Located in Kit Plate 6, well 20F)
• Test Device 2: J23106+I13504 in pSB1C3 (Located in Kit Plate 6, well 20H)
• Test Device 3: J23117+I13504 in pSB1C3 (Located in Kit Plate 6, well 20J)
• Test Device 4: J23101.BCD2.E0040.B0015 in pSB1C3 (Located in Kit Plate 6, well 20L)
• Test Device 5: J23106.BCD2.E0040.B0015 in pSB1C3 (Located in Kit Plate 6, well 20N)
• Test Device 6: J23117.BCD2.E0040.B0015 in pSB1C3 (Located in Kit Plate 6, well 20P)
Strain used
• Escherichia coli strain DH5α
Materials
• 1ml LUDOX
• H20
• 96 well plate
• fluorescein
• 10ml 1xPBS
• LB (Luria Bertani) media
• Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH - working stock 25 ug/mL)
• 50 ml Falcon tube
• Incubator at 37°C
• 1.5 ml eppendorf tubes
• Ice bucket with ice
• Pipettes
Machines
• Thermo Multiskan FC
• BERTHOLD TECHNOLOGIES LB940Mith
Protocol
Calibration Protocols
Cell measurement protocol
Result
Sequencing
• Positive Control :BBa_I20270
• Negative Control :BBa_R0040
• Test Device 1 :BBa_J364000
• Test Device 2 :BBa_J364001
• Test Device 3 :BBa_J364002
• Test Device 4 :BBa_J364003
• Test Device 5 :BBa_J364004
• Test Device 6 :BBa_J364005
> BBa_I20270 Part-only sequence (919 bp)
ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_R0040 Part-only sequence (54 bp)
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac
> BBa_J364000 Part-only sequence (918 bp)
tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_J364001 Part-only sequence (918 bp)
tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_J364002 Part-only sequence (918 bp)
ttgacagctagctcagtcctagggattgtgctagctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_J364003 Part-only sequence (990 bp)
tttacagctagctcagtcctaggtattatgctagctactagaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcttactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_J364004 Part-only sequence (990 bp)
tttacggctagctcagtcctaggtatagtgctagctactagaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcttactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
> BBa_J364005 Part-only sequence (990 bp)
ttgacagctagctcagtcctagggattgtgctagctactagaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcttactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
Data
OD600 Reference Point
Table 1. OD600 Reference Point.
LUDOX-HS40 | H2O | |
---|---|---|
Replicate 1 | 0.0497 | 0.0483 |
Replicate 2 | 0.0493 | 0.0463 |
Replicate 3 | 0.0518 | 0.0492 |
Replicate 4 | 0.0516 | 0.047 |
Arith. Mean | 0.0506 | 0.0477 |
Corrected Abs600 | 0.0026667 | |
Reference OD600 | 0.0425 | |
OD600/Abs600 | 15.9375 |
Fluorescein Standard Curve
Table 2. Data of Fluorescein Standard Curve.
uM Fluorescein | 50.00 | 25 | 12.5 | 6.25 | 3.125 | 1.5625 | 0.78125 | 0.390625 | 0.195313 | 0.097656 | 0.048828 | 0 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Replicate 1 | 1937386 | 1040680 | 592161 | 322379 | 163819 | 86765 | 42958 | 22216 | 11739 | 5925 | 3079 | 444 |
Replicate 2 | 1859453 | 1115787 | 617759 | 316051 | 158096 | 82081 | 42161 | 21509 | 11052 | 5854 | 3048 | 444 |
Replicate 3 | 1874906 | 1099274 | 611612 | 327265 | 156925 | 77801 | 40314 | 19642 | 10255 | 5430 | 2655 | 373 |
Replicate 4 | 1893953 | 1082973 | 639359 | 340346 | 172348 | 86573 | 44775 | 21540 | 11446 | 6076 | 3351 | 414 |
Arith. Mean | 1891425 | 1084679 | 615222.8 | 326510.3 | 162797 | 83305 | 42552 | 21226.75 | 11123 | 5821.25 | 3033.25 | 418.75 |
Arith. Std.Dev. | 33733.71 | 32246.67 | 19441.13 | 10303.09 | 7043.812 | 4260.032 | 1850.053 | 1105.718 | 643.4931 | 276.7735 | 286.5593 | 33.61919 |
Normalization
Table 3. Normalization.
sample | Abs600 Reading | Volume of Preloading Culture | Volume of Preloading Media |
---|---|---|---|
positive control | 0.090625 | 6.441223833 | 3.558776167 |
negative control | 0.0985875 | 5.126561999 | 4.873438001 |
device 1 | 0.09785 | 5.225342913 | 4.774657087 |
device 2 | 0.10105 | 4.822182037 | 5.177817963 |
device 3 | 0.103175 | 4.587155963 | 5.412844037 |
device 4 | 0.0987375 | 5.106926269 | 4.893073731 |
device 5 | 0.1183625 | 3.402083776 | 6.597916224 |
device 6 | 0.0985 | 5.138086063 | 4.861913937 |
media+chl | 0.059575 |
Cell Measurement
Table 4. Raw data of Abs600 measurement.
Abs600 Raw Readings: | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 | LB + Chlor (blank) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | |
Hour 0: | 0.09155 | 0.0897 | 0.090325 | 0.10685 | 0.104875 | 0.090825 | 0.09655 | 0.10555 | 0.1096 | 0.09675 | 0.107025 | 0.09045 | 0.13085 | 0.105875 | 0.1069 | 0.0901 | 0.0664 | 0.059575 |
Hour 2: | 0.1793 | 0.1855 | 0.10325 | 0.16325 | 0.10525 | 0.11365 | 0.17545 | 0.15035 | 0.202875 | 0.184825 | 0.1497 | 0.1019 | 0.19725 | 0.177475 | 0.1877 | 0.160825 | 0.0683 | 0.05675 |
Hour 4: | 0.2421 | 0.246575 | 0.134175 | 0.249425 | 0.117225 | 0.208075 | 0.23985 | 0.161875 | 0.4247 | 0.25865 | 0.230525 | 0.124025 | 0.25595 | 0.240925 | 0.244225 | 0.24665 | 0.06815 | 0.06885 |
Hour 6: | 0.3424 | 0.288625 | 0.208925 | 0.35995 | 0.133325 | 0.360225 | 0.37615 | 0.20765 | 0.58355 | 0.3692 | 0.303125 | 0.16655 | 0.36025 | 0.284425 | 0.291575 | 0.3055 | 0.0779 | 0.064775 |
Table 5. Blank subtraction and correction of Abs600 measurement.
OD600-Background | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | |
Hour 0: | 0.02515 | 0.0233 | 0.023925 | 0.04045 | 0.038475 | 0.024425 | 0.03015 | 0.03915 | 0.0432 | 0.03035 | 0.040625 | 0.02405 | 0.06445 | 0.039475 | 0.0405 | 0.0237 |
Hour 2: | 0.1129 | 0.1191 | 0.03685 | 0.09685 | 0.03885 | 0.04725 | 0.10905 | 0.08395 | 0.136475 | 0.118425 | 0.0833 | 0.0355 | 0.13085 | 0.111075 | 0.1213 | 0.094425 |
Hour 4: | 0.1757 | 0.180175 | 0.067775 | 0.183025 | 0.050825 | 0.141675 | 0.17345 | 0.095475 | 0.3583 | 0.19225 | 0.164125 | 0.057625 | 0.18955 | 0.174525 | 0.177825 | 0.18025 |
Hour 6: | 0.276 | 0.222225 | 0.142525 | 0.29355 | 0.066925 | 0.293825 | 0.30975 | 0.14125 | 0.51715 | 0.3028 | 0.236725 | 0.10015 | 0.29385 | 0.218025 | 0.225175 | 0.2391 |
Figure 3. Blank subtraction and correction of Abs600 measurement.
Table 6. Raw data of fluorescence measurement.
Raw fluorescence | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 | LB + Chlor (blank) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | |
Hour 0: | 11978.75 | 12054.25 | 13919.25 | 14055.25 | 12311.5 | 13868.5 | 17252.5 | 14736.75 | 12430.25 | 12286.5 | 14287.5 | 13227.5 | 12238.25 | 12178.25 | 11854.5 | 12076.75 | 11317.25 | 11138.25 |
Hour 2: | 12564 | 12755.75 | 16652 | 22236.5 | 15541.5 | 15458.5 | 24010.25 | 17610.75 | 13101.5 | 12591.75 | 20517.75 | 14232 | 14340.5 | 14186.5 | 12589.5 | 12354.75 | 10681.75 | 10787.5 |
Hour 4: | 13356.25 | 13479.75 | 21582.75 | 31126.25 | 13257.75 | 20684.25 | 28890.5 | 18862.25 | 14835 | 13921.5 | 28713.5 | 15357.25 | 15024.5 | 15387.5 | 13588.5 | 13468.25 | 11143.25 | 11640.5 |
Hour 6: | 14065.75 | 13709.75 | 27002.75 | 39536.5 | 14482 | 27169.5 | 38477 | 22481 | 17517.5 | 14774.75 | 32347.5 | 17138.75 | 16798.5 | 15973.25 | 14512 | 14396 | 11572.25 | 11271.75 |
Table 7. Blank substraction and correction of fluorescence measurement.
fluorescence-Background | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | |
Hour 0: | 661.5 | 737 | 2602 | 2738 | 994.25 | 2551.25 | 5935.25 | 3419.5 | 1113 | 969.25 | 2970.25 | 1910.25 | 921 | 861 | 537.25 | 759.5 |
Hour 2: | 1246.75 | 1438.5 | 5334.75 | 10919.25 | 4224.25 | 4141.25 | 12693 | 6293.5 | 1784.25 | 1274.5 | 9200.5 | 2914.75 | 3023.25 | 2869.25 | 1272.25 | 1037.5 |
Hour 4: | 2039 | 2162.5 | 10265.5 | 19809 | 1940.5 | 9367 | 17573.25 | 7545 | 3517.75 | 2604.25 | 17396.25 | 4040 | 3707.25 | 4070.25 | 2271.25 | 2151 |
Hour 6: | 2748.5 | 2392.5 | 15685.5 | 28219.25 | 3164.75 | 15852.25 | 27159.75 | 11163.75 | 6200.25 | 3457.5 | 21030.25 | 5821.5 | 5481.25 | 4656 | 3194.75 | 3078.75 |
Figure 4. Blank subtraction and correction of fluorescence measurement.
Table 8.Raw data of Fl/Abs600.
FI/OD600 | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | Colony 1 | Colony 2 | |
Hour 0: | 0.0363656 | 0.0436894 | 0.1610903 | 0.1046872 | 0.0371617 | 0.2434395 | 0.3112388 | 0.1224077 | 0.0351709 | 0.0459574 | 0.1034099 | 0.1136499 | 0.0257567 | 0.0291739 | 0.0207388 | 0.0473831 |
Hour 2: | 0.015015 | 0.0165508 | 0.1993033 | 0.1555274 | 0.1629687 | 0.1344471 | 0.1612764 | 0.1036844 | 0.0178552 | 0.0149248 | 0.1559002 | 0.1161702 | 0.0335034 | 0.0354444 | 0.0141051 | 0.0152842 |
Hour 4: | 0.0159176 | 0.016459 | 0.2081384 | 0.1484984 | 0.0537376 | 0.0917684 | 0.1392104 | 0.1085667 | 0.0134581 | 0.018553 | 0.1457091 | 0.0972347 | 0.0276245 | 0.0320685 | 0.017551 | 0.0165957 |
Hour 6: | 0.0136599 | 0.014732 | 0.1650095 | 0.1317819 | 0.0655606 | 0.0739985 | 0.1257605 | 0.108465 | 0.0163216 | 0.016774 | 0.1236002 | 0.0795852 | 0.0257259 | 0.0296143 | 0.0193078 | 0.017636 |
Table 9. Raw data of average
Raw data of average | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 |
---|---|---|---|---|---|---|---|---|
Hour 0: | 0.04002752 | 0.132888796 | 0.140300608 | 0.216823275 | 0.040564166 | 0.108529872 | 0.027465311 | 0.034060932 |
Hour 2: | 0.015782922 | 0.177415362 | 0.148707896 | 0.132480415 | 0.016390008 | 0.108529872 | 0.034473902 | 0.014694671 |
Hour 4: | 0.016188308 | 0.178318419 | 0.072753021 | 0.123888542 | 0.016005559 | 0.108529872 | 0.029846506 | 0.01707336 |
Hour 6: | 0.014195916 | 0.148395679 | 0.069779519 | 0.117112747 | 0.016547803 | 0.108529872 | 0.027670075 | 0.018471905 |
Table 10. Raw data of SD
Raw data of SD | Neg. Control | Pos. Control | Device 1 | Device 2 | Device 3 | Device 4 | Device 5 | Device 6 |
---|---|---|---|---|---|---|---|---|
Hour 0: | 0.015079549 | 0.05186329 | 0.107849912 | 0.07821561 | 0.008373059 | 0.02479548 | 0.008997379 | 0.021020162 |
Hour 2: | 0.002464455 | 0.011865598 | 0.047550627 | 0.014623325 | 0.00337995 | 0.029521958 | 0.005492679 | 0.003828995 |
Hour 4: | 0.001357521 | 0.009555002 | 0.012588667 | 0.006161179 | 0.00202254 | 0.011469346 | 0.004159737 | 0.002278645 |
Hour 6: | 0.002069122 | 0.029215462 | 0.005424471 | 0.012271926 | 0.003021193 | 0.00655286 | 0.003027256 | 0.002185333 |
Figure 5. Average level of devices.