Difference between revisions of "Team:Kyoto/Experiments"
| Line 11: | Line 11: | ||
ul.material ul{ | ul.material ul{ | ||
list-style:none; | list-style:none; | ||
| + | } | ||
| + | table{ | ||
| + | color:#000000; | ||
| + | border-collapse:collapse; | ||
| + | border-left:1px solid #000000; | ||
| + | border-top:1px solid #000000; | ||
| + | margin-top:30px; | ||
| + | } | ||
| + | |||
| + | th{ | ||
| + | border-right:1px solid #ffffff; | ||
| + | border-bottom:1px solid #ffffff; | ||
| + | padding:8px; | ||
| + | background-color:#556c14; | ||
| + | color:#ffffff; | ||
| + | } | ||
| + | |||
| + | td{ | ||
| + | border-right:1px solid #000000; | ||
| + | border-bottom:1px solid #000000; | ||
| + | padding:8px; | ||
} | } | ||
| Line 47: | Line 68: | ||
</ul> | </ul> | ||
</header> | </header> | ||
| − | + | <h1>Material&Methods</h1> | |
<ul class="material"> | <ul class="material"> | ||
<li><a href="#Parts">1.Parts</a></li> | <li><a href="#Parts">1.Parts</a></li> | ||
| Line 53: | Line 74: | ||
<li><a href="#Materials">3.Materials</a></li> | <li><a href="#Materials">3.Materials</a></li> | ||
<ul> | <ul> | ||
| − | <li><a href="#Kit">3-1 | + | <!----------------------------------------------------------BLOCK Contents-2 Materials PY------------------------------------------------> |
| − | + | <li><a href="#Kit">3-1 Kit</a></li> | |
| − | + | <li><a href="#Restriction Enzyme">3-2 Restriction Enzyme</a></li> | |
| − | + | <li><a href="#Polymerase">3-3 Polymerase</a></li> | |
| − | + | <li><a href="#DNA ligase">3-4 DNA ligase</a></li> | |
| − | + | <li><a href="#Marker">3-5 Marker</a></li> | |
| − | + | <li><a href="#Organism">3-6 Organism</a></li> | |
| − | + | <li><a href="#Antibiotics">3-7 Antibiotics</a></li> | |
| − | + | <li><a href="#Equipment">3-8 Equipment</a></li> | |
| − | + | <li><a href="#Backbone">3-9 Backbone</a></li> | |
| − | + | <li><a href="#Buffer">3-10 Buffer</a></li> | |
| − | + | <li><a href="#SDSPAGE&Westernblotting">3-11 SDSPAGE&Westernblotting</a></li> | |
| − | + | <li><a href="#B.xylophilus Experiment">3-12 B.xylophilus Experiment</a></li> | |
| − | + | <!--------------------------------------------------------- BLOCK Contents-2 Materials END-----------------------------------------------------------> | |
| − | + | </ul> | |
| − | + | </li> | |
| − | + | <li><a href="#methods">4 Methods</a> | |
| − | + | <ul> | |
| − | + | ||
| − | + | <!--------------------------------------------------------- BLOCK Contents-3 Methods PY------------------------------------------------------------> | |
| − | + | <li><a href="#Miniprep">4-1 Miniprep</a></li> | |
| − | + | <li><a href="#Gel Extraction and PCR purification">4-2 Gel Extraction and PCR purification</a></li> | |
| − | + | <li><a href="#Restriction Enzyme Digestion">4-3 Restriction Enzyme Digestion</a></li> | |
| − | + | <li><a href="#Ligation">4-4 Ligation</a></li> | |
| − | + | <li><a href="#Transformation">4-5 Transformation</a></li> | |
| − | + | <li><a href="#PCR">4-6 PCR</a></li> | |
| − | + | <li><a href="#Sequencing">4-7 Sequencing</a></li> | |
| − | + | <li><a href="#RT-PCR">4-8 RT-PCR</a></li> | |
| − | + | <li><a href="#RTqPCR">4-9 RTqPCR</a></li> | |
| − | + | <li><a href="#Western blotting (Sample preparation of S. cerevisiae)">4-10 Western blotting (Sample preparation of S. cerevisiae)</a></li> | |
| − | + | <li><a href="#Western blotting (Basic protocol)">4-11 Western blotting (Basic protocol)</a></li> | |
| − | + | <li><a href="#Culture using yeasts and measurement">4-12 Culture using yeasts and measurement</a></li> | |
| − | + | <li><a href="#The way of taking photos">4-13 The way of taking photos</a></li> | |
| − | + | <li><a href="#Methods of taking movies">4-14 Methods of taking movies</a></li> | |
| − | + | <li><a href="#Way of making agar pad">4-15 Way of making agar pad</a></li> | |
| − | + | <li><a href="#Soaking">4-16 Soaking</a></li> | |
| − | + | <!--------------------------------------------------------- BLOCK Contents-3 Methods END------------------------------------------------------------> | |
| − | + | </li> | |
| − | + | </ul> | |
| − | + | <!-- ###################################################### BLOCK Contents END #################################################--> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | <!-----------------------------------------------------BLOCK Parts--------------------------------------------------------------> | |
| − | + | <h1 id="parts">Parts</h1> | |
| − | + | <h5><a href="https://2016.igem.org/Team:Kyoto/Basic_Part" target="brank">Basic Parts</a></h5> | |
| − | + | <h5><a href="https://2016.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h5> | |
| − | + | <!-----------------------------------------------------BLOCK Parts END----------------------------------------------------------> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | <!------------------------------------------------------BLOCK primer PY----------------------------------------------------------><!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Primer List">Primer List</h2> | |
| − | + | <div class="example"> | |
| − | + | <table width="20px"> | |
| − | + | <tr><th>primer name</th><th class="example">sequence</th><th>Length</th><th>Tm</th><th>GC%</th><th>Designer</th><th>Manufacturer</th></tr><tr><td>tropomyosinF</td><td>GATCGAGAAGGACAACGCCC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinT7R</td><td>TAATACGACTCACTATAGGGCTTGTTTTCTCCGGC<br>TTCGG</td><td>40</td><td>79</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinT7F</td><td>TAATACGACTCACTATAGGGGATCGAGAAGGACAA<br>CGCCC</td><td>40</td><td>79</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>tropomyosinR</td><td>CTTGTTTTCTCCGGCTTCGG</td><td>20</td><td>66</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1F</td><td>GACTTTTCGTGCGTCTTCGG</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1T7R</td><td>TAATACGACTCACTATAGGGCCCGGTTGAAAAGCA<br>AGTGT</td><td>40</td><td>78</td><td>45</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1T7F</td><td>TAATACGACTCACTATAGGGGACTTTTCGTGCGTC<br>TTCGG</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>top-1R</td><td>CCCGGTTGAAAAGCAAGTGT</td><td>20</td><td>64</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gF</td><td>GCAAAGGTTGCCGGTAAGAC</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gT7R</td><td>TAATACGACTCACTATAGGGGACGGCAGAGGCCAA<br>CTTTA</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gT7F</td><td>TAA<br>TACGACTCACTATAGGGGCAAAGGTTGCCGGT<br>AAGAC</td><td>40</td><td>77</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>eef-1gR</td><td>GACGGCAGAGGCCAACTTTA</td><td>20</td><td>64</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbF</td><td>GGACTTTGGTCGTTGTCCCA</td><td>20</td><td>63</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbT7R</td><td>TAATACGACTCACTATAGGGTCCACAGCGTCCTTC<br>AAGTC</td><td>40</td><td>75</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbT7F</td><td>TAATACGACTCACTATAGGGGGACTTTGGTCGTTG<br>TCCCA</td><td>40</td><td>78</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>asbR</td><td>TCCACAGCGTCCTTCAAGTC</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinF-2</td><td>TGGAGGGTGATCTCGTCCAT</td><td>20</td><td>62</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinT7R-2</td><td>TAATACGACTCACTATAGGG CAAGGGGGATGGTT<br>GGTCTC</td><td>41</td><td>78</td><td>49</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinT7F-2</td><td>TAATACGACTCACTATAGGG TGGAGGGTGATCTC<br>GTCCAT</td><td>41</td><td>76</td><td>46</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proteinR-2</td><td>CAAGGGGGATGGTTGGTCTC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>actinF</td><td>AATGGCTCCGGTATGTGCAA</td><td>20</td><td>65</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>actinR</td><td>TGGTGGTGAAAGAGTAGCCG</td><td>20</td><td>62</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaF</td><td>CCTACAAGAACGTGGTCGGT</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaT7R</td><td>TAATACGACTCACTATAGGGTGTGAGTGCTCGCAA<br>ACTGT</td><td>40</td><td>75</td><td>45</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaT7F</td><td>TAATACGACTCACTATAGGGCCTACAAGAACGTGG<br>TCGGT</td><td>40</td><td>76</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3zetaR</td><td>TGTGAGTGCTCGCAAACTGT</td><td>20</td><td>60</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proF</td><td>TCTCGGTCGCCTACAAGAAC</td><td>20</td><td>61</td><td>55</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proT7R</td><td>TAATACGACTCACTATAGGGCCAGTCTCTCCCGTC<br>TCGTT</td><td>40</td><td>77</td><td>50</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proT7F</td><td>TAATACGACTCACTATAGGGTCTCGGTCGCCTACA<br>AGAAC</td><td>40</td><td>75</td><td>48</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>14-3-3proR</td><td>CCAGTCTCTCCCGTCTCGTT</td><td>20</td><td>62</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1F</td><td>TCGGAGACGGTTGTGTGAAGATG</td><td>23</td><td>66</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1T7R</td><td> TAATACGACTCACTATAGGGCAAGCACGGGTTGA<br>ATGGGT</td><td>41</td><td>79</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1T7F</td><td>TAATACGACTCACTATAGGGTCGGAGACGGTTGTG<br>TGAAGATG</td><td>43</td><td>77</td><td>47</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>AK1R</td><td>CAAGCACGGGTTGAATGGGT</td><td>20</td><td>66</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2F</td><td>TCCGAATCATGGCGAGAACC</td><td>20</td><td>66</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2T7R</td><td>TAATACGACTCACTATAGGGCATGCCGGTCAACGG<br>ATAGT</td><td>40</td><td>78</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2T7F</td><td>TAATACGACTCACTATAGGGTCCGAATCATGGCGA<br>GAACC</td><td>40</td><td>78</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>longAK2R</td><td>CATGCCGGTCAACGGATAGT</td><td>20</td><td>64</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2F</td><td>CCGTTTTGGATTTGTCGCGT</td><td>20</td><td>67</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2T7R</td><td>TAATACGACTCACTATAGGGTCGATCTTCTTGACC<br>GTCGC</td><td>40</td><td>77</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2T7F</td><td>TAATACGACTCACTATAGGGCCGTTTTGGATTTGT<br>CGCGT</td><td>40</td><td>79</td><td>45</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>shortAK2R</td><td>TCGATCTTCTTGACCGTCGC</td><td>20</td><td>64</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-1F</td><td>cccCGAATTCccccattatctt</td><td>22</td><td>68</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-1R</td><td>CTCCCACACCAGCATCCAA</td><td>19</td><td>63</td><td>58</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-2F</td><td>AAGCTGGGCGCCACTTT</td><td>17</td><td>64</td><td>59</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-2R</td><td>CAAGTCGTTGCTGAAGAAACATTTCAC</td><td>27</td><td>66</td><td>41</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-3F</td><td>ACTCGGCGTCCGGAG</td><td>15</td><td>61</td><td>73</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gal1-3R</td><td>tacccTGCAGgggagc</td><td>16</td><td>59</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-1F</td><td>tctagaggatccccCGAATTC</td><td>21</td><td>63</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-1R</td><td>CCGTTGACCGGCATGct</td><td>17</td><td>65</td><td>65</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-2F</td><td>AATCCGCTGTGGCCGC</td><td>16</td><td>66</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-2R</td><td>AACCACCTTCTTCGCACAGAAC</td><td>22</td><td>63</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-3F</td><td>GACGTCCTTGGTGAAATGTTTC</td><td>22</td><td>61</td><td>45</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>gpd-3R</td><td>gggaaaaccctggcgttac</td><td>19</td><td>64</td><td>58</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK21</td><td>CCTCCACAAAGGCCTCTCCT</td><td>20</td><td>64</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK22</td><td>CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG</td><td>35</td><td>70</td><td>34</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK23</td><td>ATTTATTGGAGAAAGATAACATATCATACTTTCCC</td><td>35</td><td>66</td><td>29</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK24</td><td>AACCTTTATTGTGTGCACACTCAAAC</td><td>26</td><td>63</td><td>38</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK25</td><td>GATAATATAAAGATGGGCAGCAGCCATCAT</td><td>30</td><td>69</td><td>40</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK26</td><td>CCAATAAATCTATTCTTTAGCTCCTGACTCCAATA<br>TTGTA</td><td>40</td><td>70</td><td>32</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK27</td><td>ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT</td><td>35</td><td>81</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK28</td><td>GAATTCCTGCAGCCCAACCTTTATTGTGTGCACAC<br>TCAAAC</td><td>41</td><td>80</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK60</td><td>GTGTAGGCCTCGGCATCCG</td><td>19</td><td>67</td><td>68</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK61</td><td>TAATACGACTCACTATAGGGGTGGAGAGGGTGAAG<br>GTGATG</td><td>41</td><td>77</td><td>49</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK62</td><td>TAATACGACTCACTATAGGGTGCCATGTGTAATCC<br>CAGCAG</td><td>41</td><td>77</td><td>46</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK81</td><td>atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTG<br>G</td><td>36</td><td>75</td><td>50</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK82</td><td>GCCCCCTGCAtGCCCTCC</td><td>18</td><td>72</td><td>78</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK83</td><td>GCGCAGGAGGGCaTGCAGG</td><td>19</td><td>73</td><td>74</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK84</td><td>gtACTAGTgCTTTATATTATCAATATTTGTGTTTG<br>TGGAGGGGGGGG</td><td>47</td><td>77</td><td>40</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK85</td><td>GGGTCGCGGATCCgaaCtcATGG</td><td>23</td><td>75</td><td>65</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK86</td><td>CGCTTCTTCCTGCCATgaGttcGGA</td><td>25</td><td>74</td><td>56</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK87</td><td>atgtatTCTAGAcaatgggcagcagccatc</td><td>30</td><td>71</td><td>47</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK88</td><td>gtACTAGTgCTATTCTTTAGCTCCTGACTCCA</td><td>32</td><td>66</td><td>44</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK89</td><td>AAT CTA GAA GCG GCC GCA CAC GCT TT<br>TTC</td><td>38</td><td>77</td><td>39</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK90</td><td>GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAG<br>CTC</td><td>38</td><td>73</td><td>50</td><td>Dou</td><td>Macrogen Japan Corp</td></tr><tr><td>IK91</td><td>ccgcaaaatcaggtgtgttg</td><td>20</td><td>63</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK92</td><td>tatctttaccaattagtttcaatgtttagtaagg</td><td>34</td><td>63</td><td>26</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK93</td><td>AATGACGCTGACGGTACAGG</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK94</td><td>ATGCCCCAGACTGTGAGTTG</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK95</td><td>ggttgtgtgaagatgaccgc</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK96</td><td>tcttcagcagggacttgcag</td><td>20</td><td>62</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK97</td><td>agcgttcaactagcagacca</td><td>20</td><td>59</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK98</td><td>agggcagattgtgtggacag</td><td>20</td><td>61</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK99</td><td>TGGCGAGAACCACCTTCTTC</td><td>20</td><td>63</td><td>55</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK100</td><td> GCTCCCTGGTTGAACGTGTA</td><td>21</td><td>61</td><td>52</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK21-2</td><td>CCTCCACAAAGGCCTCTCCT</td><td>20</td><td>64</td><td>60</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK22-2</td><td>CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG</td><td>35</td><td>70</td><td>34</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK121</td><td>GCCTCTCCTGGGGTTTGAG</td><td>19</td><td>63</td><td>63</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK122</td><td>CTCCACAAACACAAATATTGATAATATAAAGatgg<br>gcagc</td><td>40</td><td>73</td><td>35</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK129</td><td>CCTCCACAAACACAAATATTGATAATATAAAGatg<br>ggcagcagccatcat</td><td>50</td><td>80</td><td>38</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK130</td><td>GGAAAGTATGATATGTTATCTTTCTCCAATAAATC<br>TATTCTTTAGCTCCTGACTCCAATATTGTA</td><td>65</td><td>77</td><td>31</td><td>Ohara</td><td>Macrogen Japan Corp</td></tr><tr><td>IK101</td><td>atgtcttctagagcggtaggt</td><td>21</td><td>56</td><td>48</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK102</td><td>cctgattttgcggccgcatccgtcgaaactaagttctgg</td><td>39</td><td>85</td><td>54</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK103</td><td>aacttagtttcgacggat gcggccgcaaaatcag<br>g</td><td>36</td><td>83</td><td>50</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK104</td><td>gcACTAGTtgaagcttctctatct</td><td>24</td><td>56</td><td>42</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK105</td><td>atgtcttctagagccccattatcttagcctaaaaaaacc</td><td>39</td><td>73</td><td>38</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK106</td><td>cctgattttgcggccgcctccatggtggcggc</td><td>32</td><td>90</td><td>69</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr><tr><td>IK107</td><td>cccgccgccaccatggaggcggccgcaaaatcagg</td><td>35</td><td>94</td><td>71</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr></table> | |
| − | + | </div> <!-- Table end --> | |
| − | + | ||
| − | + | <!------------------------------------------------------BLOCK primer.py END----------------------------------------------------------> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | <h1 id="materials">Materials</h1> | |
| − | + | ||
| − | + | <!------------------------------------------------------BLOCK TableMaker PY------------------------------------------------------><!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Kit">Kit</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>Wizard® SV Gel and PCR</td><td>Promega</td></tr><tr><td>FastGene™Plasmid Mini Kit</td><td>NIPPON Genetics Co.,Ltd</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Restriction Enzyme">Restriction Enzyme</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>EcoRI</td><td>TaKaRa, Promega</td></tr><tr><td>PstI</td><td>TaKaRa, Promega</td></tr><tr><td>SpeI</td><td>TaKaRa, Promega</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Polymerase">Polymerase</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>KAPA™HiFi HotStart ReadyMix (2x)</td><td>KAPABIOSYSTEMS</td></tr><tr><td>KAPA2G™ Fast HotStart ReadyMix with dye (2x)</td><td>KAPABIOSYSTEMS</td></tr><tr><td>KAPATaq™EXtra HotStart ReadyMix with dye</td><td>KAPABIOSYSTEMS</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "DNA ligase">DNA ligase</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Marker">Marker</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>1kb DNA Ladder</td><td>TaKaRa</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Organism">Organism</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>E.coli DH5α Genotype</td><td>TaKaRa</td></tr><tr><td>E.coli BL21(DE3)pLysS Competent Cells</td><td>Promega</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Antibiotics">Antibiotics</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Equipment">Equipment</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name </th><th>Supplier</th></tr><tr><td>BioPhotometer</td><td>eppendorf</td></tr><tr><td>LABO SHAKER</td><td>BIO CRAFT</td></tr><tr><td>CO2 INCUBATOR</td><td>SANYO</td></tr><tr><td>Pipette Controller</td><td>Biohit Midi Plus</td></tr><tr><td>MiniCentrifuge Model GMC-060</td><td>LMS CO.,LTD.</td></tr><tr><td>HIGH-SPEED REFRIGERATED CENTRIFUGE</td><td>TOMY</td></tr><tr><td>HIGH-PRESSURE STEAM STERILIZER</td><td>TOMY</td></tr><tr><td>VOTEX-GENE2</td><td>Scientific Industryes</td></tr><tr><td>Scanning Electron Miniscope TM1000s</td><td>HITACHI</td></tr><tr><td>Fluorescence Microscope BX61N-34-FL-1-D</td><td>OLYMPUS</td></tr><tr><td>SCIECE IMAGING SYSTEM LAS-3000</td><td>Fuji film</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Backbone">Backbone</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>pSB1C3</td><td>iGEM registry</td></tr><tr><td>pSB1A2</td><td>iGEM registry</td></tr><tr><td>pSB3C5</td><td>iGEM registry</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "Buffer">Buffer</h2> | |
| − | + | <table> | |
| − | + | <tr><th>Name</th><th>Supplier</th></tr><tr><td>Sodium Carbonate</td><td>Wako</td></tr><tr><td>Sodium Bicarbonate</td><td>Wako</td></tr><tr><td>Methanol(99.5%)</td><td>Wako</td></tr><tr><td>Sodium Chloride</td><td>Wako</td></tr><tr><td>SDS</td><td>nacalai tesque</td></tr><tr><td>Trisaminomethane</td><td>nacalai tesque</td></tr><tr><td>Potassium dihydrogenphosphste</td><td>SIGAMA-ALDRICH</td></tr><tr><td>Potassium Chloride</td><td>Wako</td></tr><tr><td>Glycine</td><td>Wako</td></tr><tr><td>Agar, Powder</td><td>Wako</td></tr><tr><td>Agarose XP</td><td>Wako</td></tr><tr><td>10% Hydrochloric Acid</td><td>Wako</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "SDSPAGE&Westernblotting">SDSPAGE&Westernblotting</h2> | |
| − | + | <table> | |
| − | + | <tr><th>IMMOBILON - P Blotting Sandwiches</th><th>Immobilon</th></tr><tr><td>REAL GEL PLATE (10%)</td><td>BIO CRAFT</td></tr><tr><td>BE-210(SDSPAGE)</td><td>BIO CRAFT</td></tr><tr><td>BE-330</td><td>BIO CRAFT</td></tr><tr><td>Amersham ECL Anti-Mouse IgG</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Anti-rabbit IgG</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Prime Blocking Reagent</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Prime WB Detection Reagent</td><td>GE healthcare</td></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | <!-- Table Generated by TableMaker.py Author: OHAD --> | |
| − | + | <h2 id = "B.xylophilus Experiment">B.xylophilus Experiment</h2> | |
| − | + | <table> | |
| − | + | <tr></tr><tr></tr><tr></tr><tr></tr><tr></tr><tr></tr><tr></tr><tr></tr> | |
| − | + | </table> | |
| − | + | <!-- Table end --> | |
| − | + | ||
| − | + | <!------------------------------------------------------BLOCK TableMaker.py END------------------------------------------------------> | |
| − | + | ||
| − | + | ||
| − | + | <h1 id="methods">Methods</h1> | |
| − | + | <!------------------------------------------------------BLOCK Methods PY----------------------------------------------------------------> | |
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Miniprep">Miniprep</h2> | |
| − | + | <p> | |
| − | + | Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols. | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Gel Extraction and PCR purification">Gel Extraction and PCR purification</h2> | |
| − | + | <p> | |
| − | + | Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols. | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Restriction Enzyme Digestion">Restriction Enzyme Digestion</h2> | |
| − | + | <p> | |
| − | + | Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols. | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Ligation">Ligation</h2> | |
| − | + | <p> | |
| − | + | Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Transformation">Transformation</h2> | |
| − | + | <ol> | |
| − | + | <li>Thaw competent cells on ice</li> | |
| − | + | <li>Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes</li> | |
| − | + | <li>Keep them in heating block for 45 seconds, then cool on ice for 2 minutes</li> | |
| − | + | <li>Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C</li> | |
| − | + | <li>Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C</li> | |
| − | + | </ol> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "PCR">PCR</h2> | |
| − | + | <p> | |
| − | + | PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Sequencing">Sequencing</h2> | |
| − | + | <p> | |
| − | + | We outsourced the sequencing to Macrogen | |
| − | + | </p> | |
| − | + | <p> | |
| − | + | http://www.macrogen-japan.co.jp/cap_seq_0203.php | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "RT-PCR">RT-PCR</h2> | |
| − | + | <p> | |
| − | + | We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol. | |
| − | + | </p> | |
| − | + | <p> | |
| − | + | RT-PCR was performed using ~~~ according to the manufacturer's protocol. | |
| − | + | </p> | |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "RTqPCR">RTqPCR</h2> | |
| − | + | <p> | |
| − | + | ???????? | |
| − | < | + | </p> |
| − | + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | |
| − | + | ||
| − | + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | |
| − | + | <h2 id = "Western blotting (Sample preparation of S. cerevisiae)">Western blotting (Sample preparation of S. cerevisiae)</h2> | |
| − | + | <ol> | |
| + | <li>Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0</li> | ||
| + | <li>Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes</li> | ||
| + | <li>Centrifuge 5000rpm for 1min and remove the supernatant</li> | ||
| + | <li>Resuspend with 30ul of SDS sample buffer </li> | ||
| + | <li>Heat samples for 10min at 100°C using block incubater</li> | ||
| + | <li>Vortex well</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "Western blotting (Basic protocol)">Western blotting (Basic protocol)</h2> | ||
| + | <ol> | ||
| + | <li>Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)</li> | ||
| + | <li>Soak the gel in transfer buffer</li> | ||
| + | <li>Soak PVDF membrane in 100% methanol for 30 sec</li> | ||
| + | <li>Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min</li> | ||
| + | <li>Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode</li> | ||
| + | <li>Transfer the proteins from the gel to the membrane with 100 mA for 1 h</li> | ||
| + | <li>Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h</li> | ||
| + | <li>Wash for 5 min 3 times with TBST</li> | ||
| + | <li>Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h</li> | ||
| + | <li>Wash for 5 min 3 times with TBST</li> | ||
| + | <li>Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h</li> | ||
| + | <li>Wash for 5 min 3 times with TBST</li> | ||
| + | <li>Drain excess wash buffer from the washed membrane and place on flat surface, protein side up</li> | ||
| + | <li>Add detection reagent onto the membrane, covering all of the membrane</li> | ||
| + | <li>Incubate for 5 minutes at room temperature</li> | ||
| + | <li>Drain off excess detection reagent by dabbing with Kimwipe</li> | ||
| + | <li>Place the sample in the CCD camera compartment and record the images</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "Culture using yeasts and measurement">Culture using yeasts and measurement</h2> | ||
| + | <ol> | ||
| + | <li>Prepare medium put on 3.5 cm plate.</li> | ||
| + | <li>Drop liquid-cultured yeasts on the center of medium.</li> | ||
| + | <li>Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.</li> | ||
| + | <li>Pipette suspension including nematodes on the medium.</li> | ||
| + | <li>Culture it at 25 ℃</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "The way of taking photos">The way of taking photos</h2> | ||
| + | <ol> | ||
| + | <li>Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.</li> | ||
| + | <li>Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.</li> | ||
| + | <li>Suck out 12ul of water on the medium and drop it on microscope slide.</li> | ||
| + | <li>Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "Methods of taking movies">Methods of taking movies</h2> | ||
| + | <ol> | ||
| + | <li>Make agar pad.</li> | ||
| + | <li>Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.</li> | ||
| + | <li>Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.</li> | ||
| + | <li>Snap microscope slide with the finger and reach suspension to the center of agarose medium.</li> | ||
| + | <li>Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "Way of making agar pad">Way of making agar pad</h2> | ||
| + | <ol> | ||
| + | <li>Make medium of 2% agar and sterlize by autoclave.</li> | ||
| + | <li>Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.</li> | ||
| + | <li>After the medium sodifies, reveal slowly covered slide glass.</li> | ||
| + | <li>Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days. </li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
| + | <h2 id = "Soaking">Soaking</h2> | ||
| + | <ol> | ||
| + | <li>Soak B. xylophilus in 50μl of 2μg /μl dsRNA solution.</li> | ||
| + | <li>Shake nematode suspensions lightly (200rpm) for 4 hours at 20℃</li> | ||
| + | <li>Wash nematodes in DDW several times and allow them to recover at 20℃ in distilled water.</li> | ||
| + | <li>Observe and record their morphology, locomotion, and mortality at 4, 8, 12, 24, 36, 48, and 60 hours.</li> | ||
| + | <li>Score juveniles/adults as being dead if they did not move.</li> | ||
| + | </ol> | ||
| + | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| + | |||
| + | <!------------------------------------------------------BLOCK Methods.py END -----------------------------------------------------------> | ||
| + | </div> | ||
| + | </div> | ||
| + | |||
| + | </p> | ||
| + | <!-- | ||
| + | NewPP limit report | ||
| + | CPU time usage: 0.007 seconds | ||
| + | Real time usage: 0.007 seconds | ||
| + | Preprocessor visited node count: 9/1000000 | ||
| + | Preprocessor generated node count: 42/1000000 | ||
| + | Post‐expand include size: 41/2097152 bytes | ||
| + | Template argument size: 0/2097152 bytes | ||
| + | Highest expansion depth: 2/40 | ||
| + | Expensive parser function count: 0/100 | ||
| + | --> | ||
| + | |||
| + | <!-- Saved in parser cache with key 2017_igem_org:pcache:idhash:1170-0!*!*!*!*!*!* and timestamp 20171027171725 and revision id 271514 | ||
| + | --> | ||
| + | </div> <div class="visualClear"></div> | ||
| + | </div> | ||
| + | </div> | ||
| + | |||
| + | </div> | ||
| + | |||
| + | <!-- Side Menubar --> | ||
| + | <div id="sideMenu"> | ||
| + | <a href="https://2017.igem.org"> | ||
| + | <div id="home_logo" > | ||
| + | <img src="https://static.igem.org/mediawiki/2017/b/bf/HQ_menu_logo.jpg"> | ||
| + | </div> | ||
| + | </a> | ||
| + | |||
| + | <div style="clear:both; height:5px;"></div> | ||
| + | |||
| + | <div id="menuDisplay"></div> <!- Menu will be loaded here -> | ||
| + | </div> | ||
| + | |||
| + | <!-- Pop_Why Div is definded here --> | ||
| + | <div class="pop_why_cover"></div> | ||
| + | |||
| + | <div class="pop_why_box" > | ||
| + | <div class="pop_close">× </div> | ||
| + | <div class="pop_why_content"><h3> Loading ... </h3></div> | ||
| + | </div> | ||
| + | </div> | ||
| + | </body> | ||
</html> | </html> | ||
Revision as of 07:19, 28 October 2017
Material&Methods
- 1.Parts
- 2.Primer list
- 3.Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDSPAGE&Westernblotting
- 3-12 B.xylophilus Experiment
- 4 Methods
- 4-1 Miniprep
- 4-2 Gel Extraction and PCR purification
- 4-3 Restriction Enzyme Digestion
- 4-4 Ligation
- 4-5 Transformation
- 4-6 PCR
- 4-7 Sequencing
- 4-8 RT-PCR
- 4-9 RTqPCR
- 4-10 Western blotting (Sample preparation of S. cerevisiae)
- 4-11 Western blotting (Basic protocol)
- 4-12 Culture using yeasts and measurement
- 4-13 The way of taking photos
- 4-14 Methods of taking movies
- 4-15 Way of making agar pad
- 4-16 Soaking
Parts
Basic Parts
Composite Parts
Primer List
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| tropomyosinT7R | TAATACGACTCACTATAGGGCTTGTTTTCTCCGGC TTCGG | 40 | 79 | 48 | Fukuda | Macrogen Japan Corp |
| tropomyosinT7F | TAATACGACTCACTATAGGGGATCGAGAAGGACAA CGCCC | 40 | 79 | 50 | Fukuda | Macrogen Japan Corp |
| tropomyosinR | CTTGTTTTCTCCGGCTTCGG | 20 | 66 | 55 | Fukuda | Macrogen Japan Corp |
| top-1F | GACTTTTCGTGCGTCTTCGG | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| top-1T7R | TAATACGACTCACTATAGGGCCCGGTTGAAAAGCA AGTGT | 40 | 78 | 45 | Fukuda | Macrogen Japan Corp |
| top-1T7F | TAATACGACTCACTATAGGGGACTTTTCGTGCGTC TTCGG | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| top-1R | CCCGGTTGAAAAGCAAGTGT | 20 | 64 | 50 | Fukuda | Macrogen Japan Corp |
| eef-1gF | GCAAAGGTTGCCGGTAAGAC | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| eef-1gT7R | TAATACGACTCACTATAGGGGACGGCAGAGGCCAA CTTTA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| eef-1gT7F | TAA TACGACTCACTATAGGGGCAAAGGTTGCCGGT AAGAC | 40 | 77 | 48 | Fukuda | Macrogen Japan Corp |
| eef-1gR | GACGGCAGAGGCCAACTTTA | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
| asbF | GGACTTTGGTCGTTGTCCCA | 20 | 63 | 55 | Fukuda | Macrogen Japan Corp |
| asbT7R | TAATACGACTCACTATAGGGTCCACAGCGTCCTTC AAGTC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
| asbT7F | TAATACGACTCACTATAGGGGGACTTTGGTCGTTG TCCCA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
| asbR | TCCACAGCGTCCTTCAAGTC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinF-2 | TGGAGGGTGATCTCGTCCAT | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinT7R-2 | TAATACGACTCACTATAGGG CAAGGGGGATGGTT GGTCTC | 41 | 78 | 49 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinT7F-2 | TAATACGACTCACTATAGGG TGGAGGGTGATCTC GTCCAT | 41 | 76 | 46 | Fukuda | Macrogen Japan Corp |
| 14-3-3proteinR-2 | CAAGGGGGATGGTTGGTCTC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| actinF | AATGGCTCCGGTATGTGCAA | 20 | 65 | 50 | Fukuda | Macrogen Japan Corp |
| actinR | TGGTGGTGAAAGAGTAGCCG | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaF | CCTACAAGAACGTGGTCGGT | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaT7R | TAATACGACTCACTATAGGGTGTGAGTGCTCGCAA ACTGT | 40 | 75 | 45 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaT7F | TAATACGACTCACTATAGGGCCTACAAGAACGTGG TCGGT | 40 | 76 | 48 | Fukuda | Macrogen Japan Corp |
| 14-3-3zetaR | TGTGAGTGCTCGCAAACTGT | 20 | 60 | 50 | Fukuda | Macrogen Japan Corp |
| 14-3-3proF | TCTCGGTCGCCTACAAGAAC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
| 14-3-3proT7R | TAATACGACTCACTATAGGGCCAGTCTCTCCCGTC TCGTT | 40 | 77 | 50 | Fukuda | Macrogen Japan Corp |
| 14-3-3proT7F | TAATACGACTCACTATAGGGTCTCGGTCGCCTACA AGAAC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
| 14-3-3proR | CCAGTCTCTCCCGTCTCGTT | 20 | 62 | 60 | Fukuda | Macrogen Japan Corp |
| AK1F | TCGGAGACGGTTGTGTGAAGATG | 23 | 66 | 52 | Yoshimoto | Macrogen Japan Corp |
| AK1T7R | TAATACGACTCACTATAGGGCAAGCACGGGTTGA ATGGGT | 41 | 79 | 46 | Yoshimoto | Macrogen Japan Corp |
| AK1T7F | TAATACGACTCACTATAGGGTCGGAGACGGTTGTG TGAAGATG | 43 | 77 | 47 | Yoshimoto | Macrogen Japan Corp |
| AK1R | CAAGCACGGGTTGAATGGGT | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
| longAK2F | TCCGAATCATGGCGAGAACC | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
| longAK2T7R | TAATACGACTCACTATAGGGCATGCCGGTCAACGG ATAGT | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
| longAK2T7F | TAATACGACTCACTATAGGGTCCGAATCATGGCGA GAACC | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
| longAK2R | CATGCCGGTCAACGGATAGT | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
| shortAK2F | CCGTTTTGGATTTGTCGCGT | 20 | 67 | 50 | Yoshimoto | Macrogen Japan Corp |
| shortAK2T7R | TAATACGACTCACTATAGGGTCGATCTTCTTGACC GTCGC | 40 | 77 | 48 | Yoshimoto | Macrogen Japan Corp |
| shortAK2T7F | TAATACGACTCACTATAGGGCCGTTTTGGATTTGT CGCGT | 40 | 79 | 45 | Yoshimoto | Macrogen Japan Corp |
| shortAK2R | TCGATCTTCTTGACCGTCGC | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
| gal1-1F | cccCGAATTCccccattatctt | 22 | 68 | 50 | Yoshimoto | Macrogen Japan Corp |
| gal1-1R | CTCCCACACCAGCATCCAA | 19 | 63 | 58 | Yoshimoto | Macrogen Japan Corp |
| gal1-2F | AAGCTGGGCGCCACTTT | 17 | 64 | 59 | Yoshimoto | Macrogen Japan Corp |
| gal1-2R | CAAGTCGTTGCTGAAGAAACATTTCAC | 27 | 66 | 41 | Yoshimoto | Macrogen Japan Corp |
| gal1-3F | ACTCGGCGTCCGGAG | 15 | 61 | 73 | Yoshimoto | Macrogen Japan Corp |
| gal1-3R | tacccTGCAGgggagc | 16 | 59 | 69 | Yoshimoto | Macrogen Japan Corp |
| gpd-1F | tctagaggatccccCGAATTC | 21 | 63 | 52 | Yoshimoto | Macrogen Japan Corp |
| gpd-1R | CCGTTGACCGGCATGct | 17 | 65 | 65 | Yoshimoto | Macrogen Japan Corp |
| gpd-2F | AATCCGCTGTGGCCGC | 16 | 66 | 69 | Yoshimoto | Macrogen Japan Corp |
| gpd-2R | AACCACCTTCTTCGCACAGAAC | 22 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
| gpd-3F | GACGTCCTTGGTGAAATGTTTC | 22 | 61 | 45 | Yoshimoto | Macrogen Japan Corp |
| gpd-3R | gggaaaaccctggcgttac | 19 | 64 | 58 | Yoshimoto | Macrogen Japan Corp |
| IK21 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK22 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
| IK23 | ATTTATTGGAGAAAGATAACATATCATACTTTCCC | 35 | 66 | 29 | Yoshimoto | Macrogen Japan Corp |
| IK24 | AACCTTTATTGTGTGCACACTCAAAC | 26 | 63 | 38 | Yoshimoto | Macrogen Japan Corp |
| IK25 | GATAATATAAAGATGGGCAGCAGCCATCAT | 30 | 69 | 40 | Yoshimoto | Macrogen Japan Corp |
| IK26 | CCAATAAATCTATTCTTTAGCTCCTGACTCCAATA TTGTA | 40 | 70 | 32 | Yoshimoto | Macrogen Japan Corp |
| IK27 | ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT | 35 | 81 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK28 | GAATTCCTGCAGCCCAACCTTTATTGTGTGCACAC TCAAAC | 41 | 80 | 46 | Yoshimoto | Macrogen Japan Corp |
| IK60 | GTGTAGGCCTCGGCATCCG | 19 | 67 | 68 | Yoshimoto | Macrogen Japan Corp |
| IK61 | TAATACGACTCACTATAGGGGTGGAGAGGGTGAAG GTGATG | 41 | 77 | 49 | Yoshimoto | Macrogen Japan Corp |
| IK62 | TAATACGACTCACTATAGGGTGCCATGTGTAATCC CAGCAG | 41 | 77 | 46 | Yoshimoto | Macrogen Japan Corp |
| IK81 | atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTG G | 36 | 75 | 50 | Dou | Macrogen Japan Corp |
| IK82 | GCCCCCTGCAtGCCCTCC | 18 | 72 | 78 | Dou | Macrogen Japan Corp |
| IK83 | GCGCAGGAGGGCaTGCAGG | 19 | 73 | 74 | Dou | Macrogen Japan Corp |
| IK84 | gtACTAGTgCTTTATATTATCAATATTTGTGTTTG TGGAGGGGGGGG | 47 | 77 | 40 | Dou | Macrogen Japan Corp |
| IK85 | GGGTCGCGGATCCgaaCtcATGG | 23 | 75 | 65 | Dou | Macrogen Japan Corp |
| IK86 | CGCTTCTTCCTGCCATgaGttcGGA | 25 | 74 | 56 | Dou | Macrogen Japan Corp |
| IK87 | atgtatTCTAGAcaatgggcagcagccatc | 30 | 71 | 47 | Dou | Macrogen Japan Corp |
| IK88 | gtACTAGTgCTATTCTTTAGCTCCTGACTCCA | 32 | 66 | 44 | Dou | Macrogen Japan Corp |
| IK89 | AAT CTA GAA GCG GCC GCA CAC GCT TT TTC | 38 | 77 | 39 | Dou | Macrogen Japan Corp |
| IK90 | GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAG CTC | 38 | 73 | 50 | Dou | Macrogen Japan Corp |
| IK91 | ccgcaaaatcaggtgtgttg | 20 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK92 | tatctttaccaattagtttcaatgtttagtaagg | 34 | 63 | 26 | Yoshimoto | Macrogen Japan Corp |
| IK93 | AATGACGCTGACGGTACAGG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK94 | ATGCCCCAGACTGTGAGTTG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK95 | ggttgtgtgaagatgaccgc | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK96 | tcttcagcagggacttgcag | 20 | 62 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK97 | agcgttcaactagcagacca | 20 | 59 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK98 | agggcagattgtgtggacag | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK99 | TGGCGAGAACCACCTTCTTC | 20 | 63 | 55 | Yoshimoto | Macrogen Japan Corp |
| IK100 | GCTCCCTGGTTGAACGTGTA | 21 | 61 | 52 | Yoshimoto | Macrogen Japan Corp |
| IK21-2 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
| IK22-2 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
| IK121 | GCCTCTCCTGGGGTTTGAG | 19 | 63 | 63 | Ohara | Macrogen Japan Corp |
| IK122 | CTCCACAAACACAAATATTGATAATATAAAGatgg gcagc | 40 | 73 | 35 | Ohara | Macrogen Japan Corp |
| IK129 | CCTCCACAAACACAAATATTGATAATATAAAGatg ggcagcagccatcat | 50 | 80 | 38 | Ohara | Macrogen Japan Corp |
| IK130 | GGAAAGTATGATATGTTATCTTTCTCCAATAAATC TATTCTTTAGCTCCTGACTCCAATATTGTA | 65 | 77 | 31 | Ohara | Macrogen Japan Corp |
| IK101 | atgtcttctagagcggtaggt | 21 | 56 | 48 | Yoshimoto | Macrogen Japan Corp |
| IK102 | cctgattttgcggccgcatccgtcgaaactaagttctgg | 39 | 85 | 54 | Yoshimoto | Macrogen Japan Corp |
| IK103 | aacttagtttcgacggat gcggccgcaaaatcag g | 36 | 83 | 50 | Yoshimoto | Macrogen Japan Corp |
| IK104 | gcACTAGTtgaagcttctctatct | 24 | 56 | 42 | Yoshimoto | Macrogen Japan Corp |
| IK105 | atgtcttctagagccccattatcttagcctaaaaaaacc | 39 | 73 | 38 | Yoshimoto | Macrogen Japan Corp |
| IK106 | cctgattttgcggccgcctccatggtggcggc | 32 | 90 | 69 | Yoshimoto | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
Materials
Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
Restriction Enzyme
| Name | Supplier |
|---|---|
| EcoRI | TaKaRa, Promega |
| PstI | TaKaRa, Promega |
| SpeI | TaKaRa, Promega |
Polymerase
| Name | Supplier |
|---|---|
| KAPA™HiFi HotStart ReadyMix (2x) | KAPABIOSYSTEMS |
| KAPA2G™ Fast HotStart ReadyMix with dye (2x) | KAPABIOSYSTEMS |
| KAPATaq™EXtra HotStart ReadyMix with dye | KAPABIOSYSTEMS |
DNA ligase
| Name | Supplier |
|---|
Marker
| Name | Supplier |
|---|---|
| 1kb DNA Ladder | TaKaRa |
Organism
| Name | Supplier |
|---|---|
| E.coli DH5α Genotype | TaKaRa |
| E.coli BL21(DE3)pLysS Competent Cells | Promega |
Antibiotics
| Name | Supplier |
|---|
Equipment
| Name | Supplier |
|---|---|
| BioPhotometer | eppendorf |
| LABO SHAKER | BIO CRAFT |
| CO2 INCUBATOR | SANYO |
| Pipette Controller | Biohit Midi Plus |
| MiniCentrifuge Model GMC-060 | LMS CO.,LTD. |
| HIGH-SPEED REFRIGERATED CENTRIFUGE | TOMY |
| HIGH-PRESSURE STEAM STERILIZER | TOMY |
| VOTEX-GENE2 | Scientific Industryes |
| Scanning Electron Miniscope TM1000s | HITACHI |
| Fluorescence Microscope BX61N-34-FL-1-D | OLYMPUS |
| SCIECE IMAGING SYSTEM LAS-3000 | Fuji film |
Backbone
| Name | Supplier |
|---|---|
| pSB1C3 | iGEM registry |
| pSB1A2 | iGEM registry |
| pSB3C5 | iGEM registry |
Buffer
| Name | Supplier |
|---|---|
| Sodium Carbonate | Wako |
| Sodium Bicarbonate | Wako |
| Methanol(99.5%) | Wako |
| Sodium Chloride | Wako |
| SDS | nacalai tesque |
| Trisaminomethane | nacalai tesque |
| Potassium dihydrogenphosphste | SIGAMA-ALDRICH |
| Potassium Chloride | Wako |
| Glycine | Wako |
| Agar, Powder | Wako |
| Agarose XP | Wako |
| 10% Hydrochloric Acid | Wako |
SDSPAGE&Westernblotting
| IMMOBILON - P Blotting Sandwiches | Immobilon |
|---|---|
| REAL GEL PLATE (10%) | BIO CRAFT |
| BE-210(SDSPAGE) | BIO CRAFT |
| BE-330 | BIO CRAFT |
| Amersham ECL Anti-Mouse IgG | GE healthcare |
| Amersham ECL Anti-rabbit IgG | GE healthcare |
| Amersham ECL Prime Blocking Reagent | GE healthcare |
| Amersham ECL Prime WB Detection Reagent | GE healthcare |
B.xylophilus Experiment
Methods
Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
Gel Extraction and PCR purification
Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.
Restriction Enzyme Digestion
Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.
Ligation
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's
Transformation
- Thaw competent cells on ice
- Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
- Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
- Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C
- Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C
PCR
PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols
Sequencing
We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php
RT-PCR
We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.
RT-PCR was performed using ~~~ according to the manufacturer's protocol.
RTqPCR
????????
Western blotting (Sample preparation of S. cerevisiae)
- Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0
- Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes
- Centrifuge 5000rpm for 1min and remove the supernatant
- Resuspend with 30ul of SDS sample buffer
- Heat samples for 10min at 100°C using block incubater
- Vortex well
Western blotting (Basic protocol)
- Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)
- Soak the gel in transfer buffer
- Soak PVDF membrane in 100% methanol for 30 sec
- Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
- Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
- Transfer the proteins from the gel to the membrane with 100 mA for 1 h
- Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
- Wash for 5 min 3 times with TBST
- Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
- Add detection reagent onto the membrane, covering all of the membrane
- Incubate for 5 minutes at room temperature
- Drain off excess detection reagent by dabbing with Kimwipe
- Place the sample in the CCD camera compartment and record the images
Culture using yeasts and measurement
- Prepare medium put on 3.5 cm plate.
- Drop liquid-cultured yeasts on the center of medium.
- Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.
- Pipette suspension including nematodes on the medium.
- Culture it at 25 ℃
The way of taking photos
- Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.
- Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.
- Suck out 12ul of water on the medium and drop it on microscope slide.
- Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.
Methods of taking movies
- Make agar pad.
- Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.
- Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.
- Snap microscope slide with the finger and reach suspension to the center of agarose medium.
- Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.
Way of making agar pad
- Make medium of 2% agar and sterlize by autoclave.
- Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.
- After the medium sodifies, reveal slowly covered slide glass.
- Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days.
Soaking
- Soak B. xylophilus in 50μl of 2μg /μl dsRNA solution.
- Shake nematode suspensions lightly (200rpm) for 4 hours at 20℃
- Wash nematodes in DDW several times and allow them to recover at 20℃ in distilled water.
- Observe and record their morphology, locomotion, and mortality at 4, 8, 12, 24, 36, 48, and 60 hours.
- Score juveniles/adults as being dead if they did not move.
