Difference between revisions of "Team:ColumbiaNYC/Basic Part"

Line 18: Line 18:
 
       <div class="col-lg-12 text-center">
 
       <div class="col-lg-12 text-center">
 
         <img style="width: 60%;" src="https://static.igem.org/mediawiki/2017/0/09/Columbia_university_basicparts.jpg" alt="">
 
         <img style="width: 60%;" src="https://static.igem.org/mediawiki/2017/0/09/Columbia_university_basicparts.jpg" alt="">
−
         <p>{{ColumbiaNYC_navbar}}
+
         <p>Adapted from Addgene pLKO.1 - TRC Cloning Vector</p>
−
 
+
−
          <html>
+
−
 
+
−
          <body id="page-top">
+
−
 
+
−
            <!-- Full Width Jumbotron Header -->
+
−
            <div class="jumbotron">
+
−
              <div class="container">
+
−
                <h1>Basic Parts</h1>
+
−
                <p>Lorem ipsum dolor sit amet, consectetur adipisicing elit. Sint, explicabo dolores ipsam aliquam inventore
+
−
                  corrupti.</p>
+
−
              </div>
+
−
            </div>
+
−
 
+
−
            <!-- Page Content -->
+
−
            <div class="container">
+
−
              <div class="row">
+
−
                <div class="col-lg-12 text-center">
+
−
                  <img style="width: 60%;" src="https://static.igem.org/mediawiki/2017/0/09/Columbia_university_basicparts.jpg" alt="">
+
−
                  <p>Adapted from Addgene pLKO.1 - TRC Cloning Vector</p>
+
−
                </div>
+
−
 
+
−
                <div class="col-lg-6 col-md-12 text-center">
+
−
                  <h2>BBa_K2412000</h2>
+
−
                  <a href="http://parts.igem.org/Part:BBa_K2412000">iGEM BioBrick Link</a>
+
−
                  <p>This part encodes an shRNA that can successfully knock down expression of eGFP.</p>
+
−
                  <table class="table table-condensed table-hover">
+
−
                    <thead>
+
−
                      <tr>
+
−
                        <th></th>
+
−
                      </tr>
+
−
                    </thead>
+
−
                    <tbody>
+
−
                      <tr>
+
−
                        <td>
+
−
                          >BBa_K2412000 Part-only sequence (53 bp) gcaagctgaccctgaagttcatttcaagagaatgaacttcagggtcagcttgc
+
−
                        </td>
+
−
                      </tr>
+
−
                    </tbody>
+
−
                  </table>
+
−
                </div>
+
−
                <div class="col-lg-6 col-md-12 text-center">
+
−
                  <h2>BBa_K2412002</h2>
+
−
                  <a href="http://parts.igem.org/Part:BBa_K2412002">iGEM BioBrick Link</a>
+
−
                  <p>This is an shRNA that knocks down EGFR in cancer cells.</p>
+
−
                  <table class="table table-condensed table-hover">
+
−
                    <thead>
+
−
                      <tr>
+
−
                        <th></th>
+
−
                      </tr>
+
−
                    </thead>
+
−
                    <tbody>
+
−
                      <tr>
+
−
                        <td>
+
−
                          >BBa_K2412002 Part-only sequence (63 bp) aagcaacatctccgaaagccaacaaggttcaagagaccttgttggctttcggagatgttgctt
+
−
                        </td>
+
−
                      </tr>
+
−
                    </tbody>
+
−
                  </table>
+
−
                </div>
+
−
              </div>
+
−
 
+
−
            </div>
+
−
 
+
−
          </body>
+
−
 
+
−
          </html>
+
−
 
+
−
          {{ColumbiaNYC_footer}}
+
−
        </p>
+
 
       </div>
 
       </div>
  

Revision as of 05:55, 31 October 2017

Basic Parts

Lorem ipsum dolor sit amet, consectetur adipisicing elit. Sint, explicabo dolores ipsam aliquam inventore corrupti.

Adapted from Addgene pLKO.1 - TRC Cloning Vector

BBa_K2412000

iGEM BioBrick Link

This part encodes an shRNA that can successfully knock down expression of eGFP.
>BBa_K2412000 Part-only sequence (53 bp) gcaagctgaccctgaagttcatttcaagagaatgaacttcagggtcagcttgc

BBa_K2412002

iGEM BioBrick Link

This is an shRNA that knocks down EGFR in cancer cells.
>BBa_K2412002 Part-only sequence (63 bp) aagcaacatctccgaaagccaacaaggttcaagagaccttgttggctttcggagatgttgctt