Difference between revisions of "Team:Tel-Hai/Notebook"

Line 30: Line 30:
 
<p class="c-orange">Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.</p>
 
<p class="c-orange">Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/f/f4/T--Tel-Hai--dana-in-the-lab.JPG" alt="dana in the lab">
+
<div class="image-caption-box">
<small>Fig.1- Dana having fun with Brett colonies in the lab</small>
+
<img src="https://static.igem.org/mediawiki/2017/f/f4/T--Tel-Hai--dana-in-the-lab.JPG" alt="dana in the lab">
 +
<small>Fig.1- Dana having fun with Brett colonies in the lab</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 49: Line 51:
 
<p class="c-blue">Transformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 
<p class="c-blue">Transformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig2.JPG" alt="Plasmid map of pRS306 / pRS316 – with enzymes sites">
+
<div class="image-caption-box">
<small>Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.</small>
+
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig2.JPG" alt="Plasmid map of pRS306 / pRS316 – with enzymes sites">
 +
<small>Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 61: Line 65:
 
<p class="c-orange">Sample was sawn on YEPD selective Brett plates for colony isolation.</p>
 
<p class="c-orange">Sample was sawn on YEPD selective Brett plates for colony isolation.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/6/60/T--Tel-Hai--Fig3.JPG" alt="Brett colonies, YEPD plates. The colonies grew over 3 days at 30 celsius">
+
<div class="image-caption-box">
<small>Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30&#8451;</small>
+
<img src="https://static.igem.org/mediawiki/2017/6/60/T--Tel-Hai--Fig3.JPG" alt="Brett colonies, YEPD plates. The colonies grew over 3 days at 30 celsius">
 +
<small>Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30&#8451;</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 111: Line 117:
 
<p class="c-orange">Further examination of Brett's presence - a positive result in the gel</p>
 
<p class="c-orange">Further examination of Brett's presence - a positive result in the gel</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig4.JPG" alt="Fig.4- 2% Gel electrophoresis">
+
<div class="image-caption-box">
<small>Fig.4- 2% Gel electrophoresis, colony PCR with primers for Brett (NLS, PB2, DB, RUX). For the Brett the band is as expected. For negative control, we used S.Cerevisae, and no band appeared. <br>It indicates that the primers work as planned and do not respond to non-Brett strains</small>
+
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig4.JPG" alt="Fig.4- 2% Gel electrophoresis">
 +
<small>Fig.4- 2% Gel electrophoresis, colony PCR with primers for Brett (NLS, PB2, DB, RUX). For the Brett the band is as expected. For negative control, we used S.Cerevisae, and no band appeared. <br>It indicates that the primers work as planned and do not respond to non-Brett strains</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 130: Line 138:
 
<p class="c-blue">Miniprep for pRS306 + pRS316 continued by restriction digestion with NsiI and BamHI enzymes- to verify the plasmid. As seen in fig.5, after digestion we received 3.5 kb band and 0.8 kb band in uc and the c lanes, respectively.</p>
 
<p class="c-blue">Miniprep for pRS306 + pRS316 continued by restriction digestion with NsiI and BamHI enzymes- to verify the plasmid. As seen in fig.5, after digestion we received 3.5 kb band and 0.8 kb band in uc and the c lanes, respectively.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig5.JPG" alt="Fig.5- 1% Gel electrophoresis">
+
<div class="image-caption-box">
<small>Fig.5- 1% Gel electrophoresis. M1- GeneRuler 1 kb plus (Thermo Fisher), M2- GeneRuler 100 bp plus (Thermo Fisher). UC- uncut plasmid, C- cut plasmid with NsiI and BamHI.</small>
+
<img src="https://static.igem.org/mediawiki/2017/6/65/T--Tel-Hai--Fig5.JPG" alt="Fig.5- 1% Gel electrophoresis">
 +
<small>Fig.5- 1% Gel electrophoresis. M1- GeneRuler 1 kb plus (Thermo Fisher), M2- GeneRuler 100 bp plus (Thermo Fisher). UC- uncut plasmid, C- cut plasmid with NsiI and BamHI.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 188: Line 198:
 
<p class="c-purple">PCR for miracullin and gel, electrophoresis and gel extraction<br>As we can see in Fig.7, we got the PCR product as expected. We save the products for ligation</p>
 
<p class="c-purple">PCR for miracullin and gel, electrophoresis and gel extraction<br>As we can see in Fig.7, we got the PCR product as expected. We save the products for ligation</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/0/00/T--Tel-Hai--Fig6.JPG" alt="Fig 6- agarose gel 1%, PCR products and gel extraction">
+
<div class="image-caption-box">
<small>Fig 6- agarose gel 1%, PCR products and gel extraction. 1 – PCR products, 2- Extraction from gel, 3- product after clean-up.</small>
+
<img src="https://static.igem.org/mediawiki/2017/0/00/T--Tel-Hai--Fig6.JPG" alt="Fig 6- agarose gel 1%, PCR products and gel extraction">
 +
<small>Fig 6- agarose gel 1%, PCR products and gel extraction. 1 – PCR products, 2- Extraction from gel, 3- product after clean-up.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 212: Line 224:
 
<p class="c-purple">Ligation products HXT7+Miraculin tested at agarose gel. As seem in Fig 8- ligation succeed, new band around 1300. Products transformed to TOP-10 bacteria.</p>
 
<p class="c-purple">Ligation products HXT7+Miraculin tested at agarose gel. As seem in Fig 8- ligation succeed, new band around 1300. Products transformed to TOP-10 bacteria.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/4/4d/T--Tel-Hai--Fig7.JPG" alt="Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.">
+
<div class="image-caption-box">
<small>Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.</small>
+
<img src="https://static.igem.org/mediawiki/2017/4/4d/T--Tel-Hai--Fig7.JPG" alt="Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.">
 +
<small>Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 268: Line 282:
 
</tbody>
 
</tbody>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/d/d2/T--Tel-Hai--Fig8.JPG" alt="Fig.8- 1.5% Gel electrophoresis">
+
<div class="image-caption-box">
<small>Fig.8- 1.5% Gel electrophoresis, colony PCR with specific primers for protox and beta. Positive results are shown.</small>
+
<img src="https://static.igem.org/mediawiki/2017/d/d2/T--Tel-Hai--Fig8.JPG" alt="Fig.8- 1.5% Gel electrophoresis">
 +
<small>Fig.8- 1.5% Gel electrophoresis, colony PCR with specific primers for protox and beta. Positive results are shown.</small>
 +
</div>
 
</p>
 
</p>
 
</table>
 
</table>
Line 279: Line 295:
 
<p class="c-green">We checked the primers with empty plasmid, to verify that they indeed specific and that they don’t make false positive response.  We ran the empty plasmid (with no insert) with protox primers, the empty plasmid with beta primers, positive plasmid with protox, and positive plasmid with beta.</p>
 
<p class="c-green">We checked the primers with empty plasmid, to verify that they indeed specific and that they don’t make false positive response.  We ran the empty plasmid (with no insert) with protox primers, the empty plasmid with beta primers, positive plasmid with protox, and positive plasmid with beta.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/c/c1/T--Tel-Hai--Fig9.JPG" alt="Fig.9 – 1.5% gel electrophoresis...">
+
<div class="image-caption-box">
<small>Fig.9 – 1.5% gel electrophoresis, 1- pRS306 + primes  for protox, 2- pRS306 + primers for beta, 3- pRS306 + Insert (protox) + primes protox, 4- pRS306 + Insert (Beta) + primers beta. We got positive results, the protox around 210 bp and the beta around 130 bp. The plasmid does not react with the primers.</small>
+
<img src="https://static.igem.org/mediawiki/2017/c/c1/T--Tel-Hai--Fig9.JPG" alt="Fig.9 – 1.5% gel electrophoresis...">
 +
<small>Fig.9 – 1.5% gel electrophoresis, 1- pRS306 + primes  for protox, 2- pRS306 + primers for beta, 3- pRS306 + Insert (protox) + primes protox, 4- pRS306 + Insert (Beta) + primers beta. We got positive results, the protox around 210 bp and the beta around 130 bp. The plasmid does not react with the primers.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 286: Line 304:
 
<p class="c-green">Miniprep for the colonies that appeared, continued by restriction digestion with EcoRI and SpeI enzymes</p>
 
<p class="c-green">Miniprep for the colonies that appeared, continued by restriction digestion with EcoRI and SpeI enzymes</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/7/7f/T--Tel-Hai--Fig10.JPG" alt="Fig. 10- 1% gel electrophoresis...">
+
<div class="image-caption-box">
<small>Fig. 10- 1% gel electrophoresis, negative results except sample number 8 (protox) that we see band around 2000 bp, as we expected.</small>
+
<img src="https://static.igem.org/mediawiki/2017/7/7f/T--Tel-Hai--Fig10.JPG" alt="Fig. 10- 1% gel electrophoresis...">
 +
<small>Fig. 10- 1% gel electrophoresis, negative results except sample number 8 (protox) that we see band around 2000 bp, as we expected.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 324: Line 344:
 
</table>
 
</table>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/9/92/T--Tel-Hai--Fig11.JPG" alt="Fig.11- 1.5% Gel electrophoresis...">
+
<div class="image-caption-box">
<small>Fig.11- 1.5% Gel electrophoresis, colony PCR with primers for alpha and miraculin. For positive control for each gene, we took the gene itself to see that the primers respond to the gene. For negative control, we took the empty plasmid and made the reaction with the primers. We got the band is as expect in alpha and negative result in miraculin.</small>
+
<img src="https://static.igem.org/mediawiki/2017/9/92/T--Tel-Hai--Fig11.JPG" alt="Fig.11- 1.5% Gel electrophoresis...">
 +
<small>Fig.11- 1.5% Gel electrophoresis, colony PCR with primers for alpha and miraculin. For positive control for each gene, we took the gene itself to see that the primers respond to the gene. For negative control, we took the empty plasmid and made the reaction with the primers. We got the band is as expect in alpha and negative result in miraculin.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 335: Line 357:
 
<p class="c-blue">We numbered the beta and protox colonies in order to conduct specific and universal primer on all of them. In addition, we made restriction digestion with EcoRI and SpeI enzymes. In every test, protox sample number 3 appears to have a positive result and the rest is negative - we took this sample and inoculum into bacteria.</p>
 
<p class="c-blue">We numbered the beta and protox colonies in order to conduct specific and universal primer on all of them. In addition, we made restriction digestion with EcoRI and SpeI enzymes. In every test, protox sample number 3 appears to have a positive result and the rest is negative - we took this sample and inoculum into bacteria.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/c/cb/T--Tel-Hai--Fig12.JPG" alt="Fig.12- 1% gel electrophoresis...">
+
<div class="image-caption-box">
<small>Fig.12- 1% gel electrophoresis. a: 1-5 pRS306+protox with specific primers, (-) negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 14-18 pRS306+protox with universal primers (M13 f + M13 R). <br>b: 8-12 pRS306+beta with specific primers, (-)negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 19-23 pRS306+beta with universal primers (M13). <br>c: 40-44 pRS306+protox cut with EcoRI and SpeI enzymes, 45-50 pRS306+beta cut with EcoRI and SpeI enzymes.</small>
+
<img src="https://static.igem.org/mediawiki/2017/c/cb/T--Tel-Hai--Fig12.JPG" alt="Fig.12- 1% gel electrophoresis...">
 +
<small>Fig.12- 1% gel electrophoresis. a: 1-5 pRS306+protox with specific primers, (-) negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 14-18 pRS306+protox with universal primers (M13 f + M13 R). <br>b: 8-12 pRS306+beta with specific primers, (-)negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 19-23 pRS306+beta with universal primers (M13). <br>c: 40-44 pRS306+protox cut with EcoRI and SpeI enzymes, 45-50 pRS306+beta cut with EcoRI and SpeI enzymes.</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>
Line 351: Line 375:
 
<p class="c-blue">Yeast colonies appeared and tested by using PCR with universal primers (M13 F + M13 R). As seen in fig.13, after PCR reaction we received band around 2000 bp in plate number 1+2 with pRS306+KP6_protox. Just as we expected because the gene is 1900bp and the primers add another 100/200 bases.</p>
 
<p class="c-blue">Yeast colonies appeared and tested by using PCR with universal primers (M13 F + M13 R). As seen in fig.13, after PCR reaction we received band around 2000 bp in plate number 1+2 with pRS306+KP6_protox. Just as we expected because the gene is 1900bp and the primers add another 100/200 bases.</p>
 
<p>
 
<p>
<img src="https://static.igem.org/mediawiki/2017/c/cb/T--Tel-Hai--Fig13.JPG" alt="Fig.13- 1% gel electrophoresis...">
+
<div class="image-caption-box">
<small>Fig.13- 1% gel electrophoresis, M1- GeneRuler 1 kb plus (Thermo Fisher), 1- plate number one, 2- plate number 2, 3- plate number 3, 4- control with pRS316 (empty plasmid).</small>
+
<img src="https://static.igem.org/mediawiki/2017/c/cb/T--Tel-Hai--Fig13.JPG" alt="Fig.13- 1% gel electrophoresis...">
 +
<small>Fig.13- 1% gel electrophoresis, M1- GeneRuler 1 kb plus (Thermo Fisher), 1- plate number one, 2- plate number 2, 3- plate number 3, 4- control with pRS316 (empty plasmid).</small>
 +
</div>
 
</p>
 
</p>
 
</li>
 
</li>

Revision as of 18:14, 31 October 2017

Notebook & Result

Red - working on RF cloning

Green - working on new genes

Blue - working on yeast cells

Orange - working on Brett

Purple - working on improve BioBrick

27.8.17

  • S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.

  • Isolation streak of Brett on selection medium- specific YEPD media.

29.8.17

  • Colonies from Brett isolation appeared.

  • Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.

    dana in the lab Fig.1- Dana having fun with Brett colonies in the lab

30.8.17

  • We got pRS306/316 from Dr. Itay Onn.

  • Transformation into TOP-10 competent cells:

    • Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol)

    • Transformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.

      Plasmid map of pRS306 / pRS316 – with enzymes sites Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.

  • A new sample of Brett was tested:

  • Sample was sawn on YEPD selective Brett plates for colony isolation.

    Brett colonies, YEPD plates. The colonies grew over 3 days at 30 celsius Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃

  • Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.

    Table 1 - Brett primers, designed in Prof. Martin Goldway lab
    Primer name Sequence Product size Detection target
    Rux (specific for Brett) DBRUX F: ggatgggtgcacctggtttacac
    DBRUX R: GAAGGGCCACATTCACGAACCCC
    96 bp 28S rRNA
    DB (specific for Brett) DB394 R: acgaggaacgggc
    DB90 F: actagagagaggag
    300 bp 28S rRNA
    PB2 (specific for Brett) PB2: AGAGTGAGGGGATAATGA
    ITS 4B: tcctccgcttattgatatgc
    132 bp 28S rRNA
    NLS (universal) NL1: GCCATATCAATAAGCGGAGGAAA
    LS2: attcccaaacaatcaactcgactc
    250 bp large subunit ribosomal RNA gene

4.9.17

  • Further examination of Brett's presence - a positive result in the gel

    Fig.4- 2% Gel electrophoresis Fig.4- 2% Gel electrophoresis, colony PCR with primers for Brett (NLS, PB2, DB, RUX). For the Brett the band is as expected. For negative control, we used S.Cerevisae, and no band appeared.
    It indicates that the primers work as planned and do not respond to non-Brett strains

  • Preparation of starter and streaking for Brett, for future work

5.9.17

  • Isolation streak of Brett on liquid YEPD media, temperature 37℃ and 30 ℃. (30℃ showed better growth with more colonies).

6.9.17

  • Miniprep for pRS306 + pRS316 continued by restriction digestion with NsiI and BamHI enzymes- to verify the plasmid. As seen in fig.5, after digestion we received 3.5 kb band and 0.8 kb band in uc and the c lanes, respectively.

    Fig.5- 1% Gel electrophoresis Fig.5- 1% Gel electrophoresis. M1- GeneRuler 1 kb plus (Thermo Fisher), M2- GeneRuler 100 bp plus (Thermo Fisher). UC- uncut plasmid, C- cut plasmid with NsiI and BamHI.

  • Preparation of starter and streaking for Brett, for future work

10.9.17

  • Preparation of liquid LB, preparation of LB agar plates + AMP

  • New genes received from IDT: KP6, STS, 4CL, TAL, Miraculin. We started RF cloning.

12.9.17

  • Continued RF cloning protocol. PCR product stroke at LB-AMP plates, O/N growth.

13.9.17

  • Colonies appeared, we did DNA extraction and purification, and checked them with restriction enzymes. Negative results- no band appeared.

14.9.17

  • Preparation of additional series DPNL from RF products, electroporation transformation and streaking to LB + AMP media. O/N

    electroporation

27.9.17

  • Promoters received from IDT- TDH3, PGK1 and HXT7. We did the RF-cloning protocol.

  • BBa_K1033121 received from iGEM, we transformed the plasmid into TOP-10 bacteria.

28.9.17

  • Improvement of existing part – after we got the miracullin gene and isolated it from the pSB1C3 plasmid we wanted to add our HXT7poromoter (induced by low glucose levels). We designed primers for this procedure, as you can see here

    • PCR for HXT7 promoter, electrophoresis and gel extraction.

    • PCR for miracullin and gel, electrophoresis and gel extraction
      As we can see in Fig.7, we got the PCR product as expected. We save the products for ligation

      Fig 6- agarose gel 1%, PCR products and gel extraction Fig 6- agarose gel 1%, PCR products and gel extraction. 1 – PCR products, 2- Extraction from gel, 3- product after clean-up.

1.10.17

  • Colonies from RF cloning appeared (from 27.9.17). Negative results. Start again with all the genes and promoters.

  • New genes was ordered from IDT

  • Continue working on improving the biobrick. We took the products (HXT7+ Miraculin, from 28.9.17) and ligate O/N (first ligation- between promoter and gene).

2.10.17

  • Ligation products HXT7+Miraculin tested at agarose gel. As seem in Fig 8- ligation succeed, new band around 1300. Products transformed to TOP-10 bacteria.

    Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive. Fig 7- ligation results, agarose gel 1%. Only 3+4 wells seems positive.

8.10.17

  • New construct (HXT7+Miraculin) ligated to pSB1C3 + pRS306, and transformed.

  • RF cloning failed again. We decided to stop working with this method.

9.10.17

  • No colonies detected from HXT7_MIRACULIN +pSB1C3. We did the procedure again.

11-14.10.17- Succoth Holiday! (Jewish holiday)

16.10.17

  • New genes received from IDT: KP6_protox, KP6_beta. We made restriction digest with EcoRI and SpeI (for yeast plasmid pRS306/pRS316) enzymes, followed by ligation.

  • Heat shock transformation into TOP10 and isolation on LB+amp plate.

17.10.17

  • Colonies detected only from plasmid pRS306 and tested using PCR with specific primers that we designed (table 2) and ordered from Sigma-Aldrich. As seen in fig.8, after PCR reaction we received 210 bp band and 130 bp band in protox and the beta lanes, respectively. That was the expected outcome.

    Table 2- specific primers for the genes

    Fig.8- 1.5% Gel electrophoresis Fig.8- 1.5% Gel electrophoresis, colony PCR with specific primers for protox and beta. Positive results are shown.

    Primer name Sequence Product size
    ADH1 – protox Protox_f- AGACCGAGACCCGTTATGTG
    Protox_r- GTGGGTCTGGCTGACAATTT
    210 bp
    ADH_PK6_beta Beta_F- GCAGCATCGACAGCTTCATA
    Beta_R- GTGGGTCTGGCTGACAGTTT
    130 bp

18.10.17

  • We checked the primers with empty plasmid, to verify that they indeed specific and that they don’t make false positive response. We ran the empty plasmid (with no insert) with protox primers, the empty plasmid with beta primers, positive plasmid with protox, and positive plasmid with beta.

    Fig.9 – 1.5% gel electrophoresis... Fig.9 – 1.5% gel electrophoresis, 1- pRS306 + primes for protox, 2- pRS306 + primers for beta, 3- pRS306 + Insert (protox) + primes protox, 4- pRS306 + Insert (Beta) + primers beta. We got positive results, the protox around 210 bp and the beta around 130 bp. The plasmid does not react with the primers.

  • Miniprep for the colonies that appeared, continued by restriction digestion with EcoRI and SpeI enzymes

    Fig. 10- 1% gel electrophoresis... Fig. 10- 1% gel electrophoresis, negative results except sample number 8 (protox) that we see band around 2000 bp, as we expected.

19.10.17

  • New genes received from IDT: KP6_alpha, miraculin . We made restriction digest with EcoRI and SpeI enzymes, followed by ligation.

  • Heat shock transformation into TOP10 and isolation on LB+amp plate.

  • Colonies detected only from plasmid pRS306 and tested using PCR with specific primers that we designed and ordered (table 3) from Sigma-Aldrich. As seen in fig.11, after PCR reaction we received 153 bp band in KP6_alpha. With the miraculin, we got negative result.

    Table 3 - specific primers for the genes
    Primer name Sequence Product size
    ADH1 – alpha Alpha_f- ATGGGACAGGGAACGAGTTA
    Alpha_r- GCTAAGAGAACGGCAAGACA
    153 bp
    Miraculin Mir_F- CTTGACATTGATGGCGAGAA
    Mir_R- GGGTCTGTCGTGGTCAACTT
    148 bp

    Fig.11- 1.5% Gel electrophoresis... Fig.11- 1.5% Gel electrophoresis, colony PCR with primers for alpha and miraculin. For positive control for each gene, we took the gene itself to see that the primers respond to the gene. For negative control, we took the empty plasmid and made the reaction with the primers. We got the band is as expect in alpha and negative result in miraculin.

20.10.17

Cloning genes into yeast plasmid

  • We numbered the beta and protox colonies in order to conduct specific and universal primer on all of them. In addition, we made restriction digestion with EcoRI and SpeI enzymes. In every test, protox sample number 3 appears to have a positive result and the rest is negative - we took this sample and inoculum into bacteria.

    Fig.12- 1% gel electrophoresis... Fig.12- 1% gel electrophoresis. a: 1-5 pRS306+protox with specific primers, (-) negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 14-18 pRS306+protox with universal primers (M13 f + M13 R).
    b: 8-12 pRS306+beta with specific primers, (-)negative control pRS306 with specific primers, (+) positive control is original gene with specific primers. 19-23 pRS306+beta with universal primers (M13).
    c: 40-44 pRS306+protox cut with EcoRI and SpeI enzymes, 45-50 pRS306+beta cut with EcoRI and SpeI enzymes.

21.10.17

  • With the positive plasmid (pRS306 + protox), we did transformation into S.cerevisiae 3095 with URA- mutation and isolation on URA- plates, one plate for control with pRS316.

23.10.17

  • Yeast colonies appeared and tested by using PCR with universal primers (M13 F + M13 R). As seen in fig.13, after PCR reaction we received band around 2000 bp in plate number 1+2 with pRS306+KP6_protox. Just as we expected because the gene is 1900bp and the primers add another 100/200 bases.

    Fig.13- 1% gel electrophoresis... Fig.13- 1% gel electrophoresis, M1- GeneRuler 1 kb plus (Thermo Fisher), 1- plate number one, 2- plate number 2, 3- plate number 3, 4- control with pRS316 (empty plasmid).