Team:XMU-China/Experiments

2017.igem.org/Team:XMU-China/Experiments

Protocols

  • Molecular Cloning

  • 01. Transformation

    Requirements:
    —TransGen® Trans5α Chemically Competetent Cell
    —LB broth
    —iGEM DNA Distribution Kit Plates, Plasmid DNA or DNA ligation mix
    —LB agar plates containing 15-100μg/mL antibiotic of choice
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Nuclease-free 0.2mL PCR tubes
    —Water bath of 42°C
    —Shaking incubator of 37°C


    Before Starting (if you need plasmids from iGEM DNA Distribution Kit Plates):
    1. Punch a hole with a pipette tip through the foil cover into the corresponding well of the desired BioBrick part.
    2. Add 10μL sterile deionized water, pipette up and down several times.
    3. Transfer liquid from Step 2 into a 0.2 mL PCR tube.
    4. Repeat Steps 2-3 twice.
    5. Store liquid (BioBrick plasmid) at -20°C.


    Protocol:
    1. Add 5-10μL plasmid or ligation system into 50μL fresh competent cells, which is contained in 1.5mL centrifuge tube. Then mix gently.
    2. Incubate the tube on ice for 30 minutes.
    3. Heat shock in the water bath at 42°C for 45 seconds.
    4. Incubate on ice for 2 min.
    5. Add 450μL fresh LB broth into the tube.
    6. Incubate for 1 hour under the condition of 37°C, 200rpm using a shaking incubator.
    7. Spread 250μL liquid from Step6 on a LB agar plate, which contains appropriate antibiotics.
    8. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).

  • 02. Growing the Single Colonies from Agar Plates

    Requirements:
    —LB agar plate containing transformed bacterial colonies incubated overnight
    —LB broth
    —Antibiotics
    —50mL centrifuge tubes
    —Shaking incubator of 37°C


    Protocol:
    1. Add 10mL LB broth into a centrifuge tube, then add the appropriate antibiotic needed.
    2. Select the single colony using the pipette tip from the agar plate, which contains the bacterial cells. Then put the pipette tip into the tube from Step 1.
    3. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).

  • 03. Making Glycerol Stocks

    Materials and Equipments:
    —Bacterial culture
    —Glycerol
    —1.5mL cryogenic microtubes


    Protocol:
    1. Add 200µL glycerol into a cryogenic microtube.
    2. Pipet 800µL bacterial culture into glycerol in the cryogenic microtube from step 1 and mix by pipetting, save in -20°C freezer.
    3. This glycerol stock can be used whenever required, by just adding 10µL glycerol stock into 10mL LB broth.

  • 04. Plasmid Extraction

    Requirements:
    —Omega E.Z.N.A.® Plasmid Mini Kit II
    —100% ethanol
    —Isopropanol
    —Microcentrifuge capable of at least 13000 x g
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Sterile deionized water
    —Electric dry oven of 65°C
    —Water bath of 65°C


    Before Starting:
    —Heat sterile deionized water to 65°C using water bath
    —Add the vial of RNase A to the bottle of Solution I if there’s no mark on the bottle and store at 4°C
    —Add some 100% ethanol to the bottle of DNA Wash Buffer if there’s no mark on the bottle and store at room temperature
    —Add some isopropanol to the bottle of HBC Buffer if there’s no mark on the bottle and store at room temperature
    (The volume of ethanol and isopropanol is showed on the tag of the bottle)


    Protocol:
    1. Pellet 1.5mL bacteria in a clean 1.5mL microcentrifuge tube by centrifugation at 10,000 x g for 1 minute at room temperature. Decant or aspirate medium and discard.
    2. Add 250μL Solution I/RNase, pipet up and down to mix thoroughly. Complete resuspension of cell pellet is vital for obtaining good yields.
    3. Add 250µL Solution II and gently mix by inverting and rotating the tube several times to obtain a clear lysate. A 2 minutes incubation is necessary. Avoid vigorous mixing as this will shear chromosomal DNA and lower plasmid purity.
    4. Add 350µL Solution III and mix immediately by inverting the tube several times until a flocculent white precipitate forms. Incubate for 2 minutes.
    5. Centrifuge at maximum speed (≥13,000 x g) for 10 minutes at room temperature. A compact white pellet will form. Promptly proceed to the next step.
    6. Insert a HiBind® DNA Mini Column into a 2mL Collection Tube.
    7. Transfer 700µL cleared lysate from Step 5 CAREFULLY aspirating it into the HiBind® DNA Mini Column. Be careful not to disturb the pellet and that no cellular debris is transferred to the HiBind® DNA Mini Column.
    8. Centrifuge at maximum speed for 1 minute.
    9. Discard the filtrate and reuse the collection tube.
    10. Repeat Steps 7-9 until all cleared lysate has been transferred to the HiBind® DNA Mini Column.
    11. Add 500µL HBC Buffer.
    12. Centrifuge at maximum speed for 1 minute.
    13. Discard the filtrate and reuse the collection tube.
    14. Add 700µL DNA Wash Buffer.
    15. Centrifuge at maximum speed for 1 minute.
    16. Discard the filtrate and reuse the collection tube.
    17. Centrifuge the empty HiBind® DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.
    18. Transfer HiBind® DNA Mini Column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.
    19. Add 60mL sterile deionized water directly to the center of the column membrane.
    20. Let sit at room temperature for 2 minutes.
    21. Centrifuge at maximum speed for 1 minute.
    22. Store DNA at -20 °C

  • 05. Genomic DNA Extraction

    Requirements:
    —TransGen EasyPure® Bacteria Genomic DNA Kit
    —100% ethanol
    —70% ethanol (for Gram-positive bacterium)
    —Glass bead (for Actinobacillus)
    —Lysozyme (produced by Sangon Biotech®)
    —RNase A (produced by Takara®)
    —Proteinase K (produced by Takara®)
    —Microcentrifuge capable of at least 13,000 x g
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Sterile deionized water
    —Electric dry oven at 65°C
    —Water bath at 55°C and 65°C


    Before Starting:
    —Add 15mL 100% ethanol into BB11 if there’s no mark on the bottle and store at room temperature
    —Add 48mL 100% ethanol into WB11 if there’s no mark on the bottle and store at room temperature
    —Weight 4mg lysozyme in a microcentrifuge tube, and add 200μL RB11, store at 4°C
    —Heat sterile deionized water to 65°C using water bath


    Protocol:
    1. Pellet 1.5mL bacteria in a clean 1.5mL microcentrifuge tube by centrifugation at 12,000 x g for 1 minute at room temperature. Decant or aspirate medium and discard.
    2. Add 200μL RB11/lysozyme, pipet up and down to mix thoroughly. Incubate at 37°C for 60 minutes.
    3. Centrifuge at 10,000 x g for 1 minute. Discard the liquid.
    Note: For Gram-positive bacterium, a re-suspension using 70% ethanol before this step is needed. For Actinobacillus, it’s necessary to scatter the hyphostroma.
    4. Add 100μL LB11 and 20μL Proteinase K, pipet up and down to mix thoroughly.
    5. Incubate at 55°C for 15 minutes, shake the tube every 5 minutes.
    Note: If the liquid is not limpid, another 15 minutes incubation may be necessary.
    6. Add 20μL RNase A, mix thoroughly, and incubate at room temperature for 2 minutes.
    7. Add 400μL BB11, vortex 30 seconds.
    8. Transfer 700μL liquid from Step 7 into a Genomic Spin Column.
    9. Centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.
    10. Repeat Steps 8-9 until all liquid has been transferred to the Genomic Spin Column.
    11. Add 500μL CB11 into the Genomic Spin Column, centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.
    12. Repeat Step 11 once.
    13. Add 500μL WB11 into the Genomic Spin Column, centrifuge at 12,000 x g for 30 seconds, discard the filtrate and reuse the collection tube.
    14. Repeat Step 13 once.
    15. Centrifuge the empty Genomic Spin Column for 2 minutes at 12,000 x g to dry the column matrix.
    16. Transfer the column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.
    17. Add 75μL sterile deionized water into the column.
    18. Let sit at room temperature for 2 minutes.
    19. Centrifuge at 12,000 x g for 1 minute.
    20. Repeat Steps 17-19 once.
    21. Store DNA at -20 °C.

  • 06. DNA Gel Electrophoresis

    Requirements
    —50× TAE concentrate Solution (produced by Solarbio®)
    —Agarose (produced by Biowest®)
    —DNA dye (TransGen® GelStain)
    —100mL Erlenmeyer flask
    —Distilled water
    —Microwave oven
    —DNA samples
    —10× Loading buffer (produced by Takara®)
    —DNA marker (produced by TranGen®)
    —Electrophoresis instrument


    Before Starting:
    —Dilute 50× TAE concentrate Solution to 1× TAE buffer with distilled water
    —Add 10× loading buffer into marker and DNA samples. Loading buffer should occupy 10% of total volume.


    Protocol:
    1. Weigh 0.36g agarose in an Erlenmeyer flask.
    2. Add 30mL 1× TAE buffer into the flask from Step 1.
    3. Make agarose melt by microwave oven (medium-high heat, about 3 minutes).
    4. Add 3μL TransGen® GelStain, mix by shocking.
    5. Assemble gel pouring apparatus by inserting gate into slots.
    6. Pour agarose gel into the gel tray.
    7. Cool for 40 minutes to solidify the DNA agarose gel.
    8. Remove the pouring apparatus, put the gel into an electrophoresis instrument.
    9. Pipet marker and DNA samples which have been mixed with loading buffer into the slots.
    10. Turn on the electrophoresis instrument, set the working electric current at 75-100mA.
    11. Electrophoresis for 45-60 minutes.
    12. Turn off the instrument, take the gel into the gel formatter to take and save photos.

  • 07. Gel Extraction

    Requirements:
    —Omega E.Z.N.A.® Gel Extraction Kit
    —DNA agarose gel sliced from the electrophoresed gel
    —100% ethanol
    —Microcentrifuge capable of at least 13,000 x g
    —Nuclease-free 1.5 mL microcentrifuge tubes
    —Sterile deionized water
    —Electric dry oven of 55°C and 65°C
    —Water bath of 65°C


    Before starting:
    —Heat sterile deionized water to 65°C using water bath
    —Add 100mL 100% ethanol to the bottle of SPW Wash Buffer if there’s no mark on the bottle, store at room temperature


    Protocol:
    1. Put the gel slice in a clean 1.5mL microcentrifuge tube.
    2. Add Binding Buffer to fill the microcentrifuge tube from Step 1.
    3. Incubate at 55°C in a water bath, until the gel has completely melted. Shake the tube every 2-3 minutes.
    4. Insert a HiBind® DNA Mini Column in a 2mL Collection Tube.
    5. Add 700µL solution from Step 3 to the HiBind® DNA Mini Column.
    6. Centrifuge at 10,000 × g for 1 minute at room temperature.
    7. Discard the filtrate and reuse collection tube.
    8. Repeat Steps 5-7 until all of the sample has been transferred to the column.
    9. Add 300µL Binding Buffer.
    10. Centrifuge at maximum speed (≥13,000 x g) for 1 minute at room temperature.
    11. Discard the filtrate and reuse collection tube.
    12. Add 700µL SPW Wash Buffer.
    13. Centrifuge at maximum speed for 1 minute at room temperature.
    14. Discard the filtrate and reuse collection tube.
    15. Centrifuge the empty HiBind® DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.
    16. Transfer the HiBind® DNA Mini Column to a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.
    17. Add 35µL sterile deionized water directly to the center of the column membrane.
    18. Let sit at room temperature for 2 minutes.
    19. Centrifuge at maximum speed for 1 minute.
    20. Store DNA at -20°C.

  • 08. PCR

    Protocol:
    1. The choice of reaction system:



    2.The choice of PCR program:



    Note: x is the annealing temperature of the reaction, usually 5°C to 10°C lower than Tm of the primer.
    The calculation of Tm: Tm=4(G+C)+2(A+T)

  • 09. PCR Purification

    Requirements:
    —Omega E.Z.N.A.® Cycle Pure Kit
    —PCR product
    —100% ethanol
    —Microcentrifuge capable of at least 13,000 x g
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Sterile deionized water
    —Electric dry oven of 65°C
    —Water bath of 65°C


    Before Starting:
    —Heat sterile deionized water to 65°C using water bath
    —Add 100mL 100% ethanol to the bottle of DNA Wash Buffer if there’s no mark on the bottle and store at room temperature


    Protocol:
    1. Determine the volume of PCR product, and transfer the product into a clean 1.5mL microcentrifuge tube.
    2. Add 4-5 volumes CP Buffer. For PCR products smaller than 200bp, add 6 volumes CP Buffer.
    3. Vortex to mix thoroughly.
    4. Insert a HiBind® DNA Mini Column into a 2mL Collection Tube.
    5. Add the sample from Step 3 to the HiBind® DNA Mini Column.
    6. Centrifuge at maximum speed (≥13,000 x g) for 1 minute at room temperature.
    7. Discard the filtrate and reuse collection tube.
    8. Add 700µL DNA Wash Buffer.
    9. Centrifuge at maximum speed for 1 minute.
    10. Discard the filtrate and reuse collection minute.
    11. Centrifuge the empty HiBind® DNA Mini Column at maximum speed for 2 minutes to dry the column.
    12. Transfer the HiBind® DNA Mini Column into a clean 1.5mL microcentrifuge tube. Open the lid and put it in the electric dry oven for 10 minutes to volatilize alcohol.
    13. Add 40µL sterile deionized water directly to the center of column matrix.
    14. Let sit at room temperature for 2 minutes.
    15. Centrifuge at maximum speed for 1 minute.
    16. Store DNA at -20°C.

  • 10. Restriction Digest

    Requirements:
    —Plasmid DNA or PCR product
    —Restriction enzymes and buffers (produced by Takara Bio®)
    —Nuclease-free 0.2mL PCR tubes
    —Water bath at 37°C


    Protocol:
    1. Prepare reaction systems in a 0.2mL PCR tube according to the following table:



    Choose the buffer according to the following table:



    2. Incubate in the water bath at 37°C for 6-8 hours.

  • 11. Ligation

    Requirements:
    —Digested DNA
    —T4 ligase and buffer (produced by Takara Bio®)
    —Nuclease-free 0.2mL PCR tubes
    —Water bath at 16°C or fridge at 4°C


    Protocol:
    1.Prepare reaction systems in a 0.2mL PCR tube according to the following table:





    V1: insert
    V2: vector
    M: molar weight (size)
    C: conc. (ng/mL)
    2. Incubate in the water bath at 16°C for 6 hours or fridge at 4°C for 12 hours.

  • Characterization

  • 01. Transformation

    Requirements:
    —TransGen® BL21(DE3) Chemically Competetent Cell
    —LB broth
    —Expression plasmid containing coding sequence
    —LB agar plates containing 15-100μg/mL antibiotic of choice
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Water bath of 42°C
    —Shaking incubator of 37°C


    Protocol:
    1. Add 5-10μL plasmid into 50μL fresh competent cells, which is contained in 1.5mL centrifuge tube. Then mix gently.
    2. Incubate the tube on ice for 30 minutes.
    3. Heat shock in the water bath at 42°C for 45 seconds.
    4. Incubate on ice for 2 min.
    5. Add 450μL fresh LB broth into the tube.
    6. Incubate for 1 hour under the condition of 37°C, 200rpm using a shaking incubator.
    7. Spread 250μL liquid from Step6 on a LB agar plate, which contains appropriate antibiotics.
    8. Incubate overnight at 37°C (about 12 hours, no more than 16 hours).
    9. Growing the Single Colonies from Agar Plates (the same protocol as Molecular Cloning).

  • 02. Expression conditions

    Requirements:
    —TransGen® Trans5α Chemically Competetent Cell
    —LB broth
    —Plasmid DNA
    —LB agar plates containing 15-100μg/mL antibiotic of choice
    —Antibiotics
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Shaking incubator of 37°C
    —50mL centrifuge tubes
    —96-well plates
    —Tecan® Infinite M200pro microplate reader
    —Isopropyl β-D-1-thiogalactopyranoside
    —Decanal


    Protocol-Expression Temperature:
    1. Resuscitate the bacteria which contains T7+luxAB plasmid. Add 10μl-20μl bacteria to 4ml LB.
    2. Incubate at 37°C until the OD is measured between 0.6 and 0.8.
    3. Add 4μl IPTG inductor to each tubes. Incubate respectively at 30°C, 33°C and 37°C.
    4. After incubation, take out 1ml of each tube as background and measure the OD.
    5. Take out 1ml bacteria from each tube and add 10μl 1% decanal.
    6. Take out 100μl bacteria from each tube and put it in a white light-proof 96 hole for measuring.


    Protocol-Influence of the number of bacteria and the substrate quantity:
    1. Resuscitate the bacteria which contains T7+luxAB plasmid. Add 2ml bacteria to 300ml LB.
    2. Measure the OD value at different time, take out 4ml bacteria to a tube when the OD value is 0.6, 1.2, 1.8, 2.4, 3.0 and 3.6. Each condition is in quadruplicate.
    3. Add 4μl IPTG inductor to each tubes and incubate for 3 hours.
    4. After incubation, take out 1ml of each tube as background and measure the OD.
    5. Take out 1ml bacteria from each tube and add decanal as shown in the table below:



    6. Take out 100μl bacteria from each tube and put it in a white light-proof 96 hole for measuring.


    Protocol-The influence of induction time:
    1. Resuscitate the bacteria which contains T7+luxAB plasmid. Add 2ml bacteria to 300ml LB.
    2. Measure the OD value at different time, take out 4ml bacteria to a tube when the OD value is 0.6, 1.2, 1.8, 2.4, 3.0 and 3.6. Each condition is in triplicate.
    3. Add 4μl IPTG inductor to each tubes and incubate at 30℃ for 1 hour, 2 hours,3 hours.
    4. After incubation, take out 1ml of each tube as background and measure the OD.
    5. Take out 1ml bacteria from each tube and add 10μl 1% decanal.
    6. Take out 100μl bacteria from each tube and put it in a white light-proof 96 hole for measuring.


    Protocol-The influence of IPTG concentration:
    1. Resuscitate the bacteria which contains T7+luxAB plasmid. Add 2ml bacteria to 300ml LB.
    2. Measure the OD value at different time, take out 4ml bacteria to a tube when the OD value is 0.6, 1.2, 1.8, 2.4, 3.0 and 3.6. Each condition is in quintuplicate.
    3. Add respectively 4μl,8μl,12μl,16μl and 20μl IPTG inductor to each tubes and incubate at 30℃ for 3 hours.
    4. After incubation, take out 1ml of each tube as background and measure the OD.
    5. Take out 1ml bacteria from each tube and add 10μl 1% decanal.
    6. Take out 100μl bacteria from each tube and put it in a white light-proof 96 hole for measuring.

  • 03. Fluorescent Characterization Protocol

    Requirements:
    —TransGen® Trans5α Chemically Competetent Cell
    —LB broth
    —Plasmid DNA
    —LB agar plates containing 15-100μg/mL antibiotic of choice
    —Antibiotics
    —Arsenic standard solution
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Nuclease-free 0.2mL PCR tubes
    —Water bath of 42°C
    —Shaking incubator of 37°C
    —50mL centrifuge tubes
    —96-well plates
    —Tecan® Infinite M200pro microplate reader


    Protocol:
    1. Mix the metal ion sensing promoter + T7 RNA polymerase plasmid and T7 promoter + GFP plasmid together in the ratio of 1:1, transform the mixed plasmid on a LB agar plate which contains AMP and CM antibiotics.
    2. Incubate overnight at 37°C for 12 hours.
    3. Grow the Single Colonies from Agar Plates.
    4. Do a 1/750 dilution of cells into fresh media with AMP and CM antibiotics.
    5. Incubate at 37°C for 3 hours. Add arsenic standard solution by the concentration of 0 mmol/mL 、2.6mmol/ml、3.9mmol/ml、100mmol/ml. Each condition is in triplicate.
    6. Add 100 μl into each well into a 96 Well plate which is laid on the ice every thirty minutes.
    7. Continue sampling for 900 minutes.
    8. Measurements of absorbance and fluorescence:
    (1) OD 600
    Device: Plate Reader（Tecan Infinite M200pro） Wavelengths: 600 nm absorption.
    (2) Fluorescence (CFP and GFP)
    Device: Plate Reader（Tecan Infinite M200pro）, 96-well plates.
    Wavelengths: CFP:439 nm excitation, 476 nm emission; GFP: 485 nm excitation, 520 nm emission.

  • 04. Electrical Signal Characterization Protocol

    Requirements:
    —TransGen® Trans5α Chemically Competetent Cell
    —LB broth
    —Plasmid DNA
    —LB agar plates containing 15-100μg/mL antibiotic of choice
    —Antibiotics
    —Arsenic standard solution
    —Nuclease-free 1.5mL microcentrifuge tubes
    —Nuclease-free 0.2mL PCR tubes
    —Water bath of 42°C
    —Shaking incubator of 37°C
    —50mL centrifuge tubes
    —96-well plates
    —PAPG


    Protocol:
    1. Mix the metal ion sensing promoter + T7 RNA polymerase plasmid and T7 promoter + GFP plasmid together in the ratio of 1:1, transform the mixed plasmid on a LB agar plate which contains AMP and CM antibiotics.
    2. Incubate overnight at 37°C for 12 hours.
    3. Grow the Single Colonies from Agar Plates.
    4. Do a 1/750 dilution of cells into fresh media with AMP and CM antibiotics.
    5. Incubate at 37°C for 3 hours. Add arsenic standard solution by the concentration of 0 mmol/mL 、2.6mmol/ml、3.9mmol/ml、100mmol/ml. Each condition is in triplicate.
    6. Take out 1ml bacteria from tubes , add 4mg PAPG and incubate for 5 minutes each hour.
    7. Measure the electrical signal.

  • Addenda

  • 01. Antibiotics



    Note: All of these antibiotics are produced by SolarBio®.

  • 02. Culture Mediums



  • 03. Primers and Sequence

    Primers:
    1. VF2 and VR
    VF2: TGCCACCTGACGTCTAAGAA
    VR: ATTACCGCCTTTGAGTGAGC
    2. Formaldehyde dismutase
    Forward: GCTCTAGAATGGCCGGTAATAAAAGCGTCGTCTATC
    Reverse: CGCTGCAGACTAGTTCATTTATTCTTCAACATGCCATGC
    Note: Our primers are synthetized by Sangon Biotech®, Shanghai


    Sequence:
    Formaldehyde dismutase
    ATGGCCGGTAATAAAAGCGTCGTCTATCATGGGACCCGTGATCTTCGGGTTGAAACAGTTCCTTATCCCAAGCTTGAGCACAATAATCGAAAGCTTGAACATGCGGTGATTTTAAAGGTTGTATCAACAAATATTTGTGGTTCAGATCAACACATTTATCGTGGGCGCTTTATCGTTCCTAAAGGTCACGTGCTCGGGCACGAAATTACTGGGGAAGTGGTAGAAAAGGGCTCGGATGTCGAATTAATGGACATCGGCGATTTAGTGTCTGTGCCTTTTAATGTTGCGTGCGGGCGGTGCCGCAACTGTAAAGAGGCGCGATCTGACGTTTGTGAAAATAACCTGGTCAACCCAGATGCGGATTTAGGTGCCTTTGGCTTTGACTTGAAAGGGTGGTCTGGTGGTCAAGCTGAGTATGTTCTTGTTCCTTATGCTGACTATATGCTGCTCAAGTTTGGTGATAAAGAACAGGCGATGGAAAAAATAAAAGACCTGACGCTTATCTCAGATATTCTACCGACAGGTTTTCACGGTTGCGTTTCTGCTGGAGTGAAGCCAGGTAGCCATGTTTACATTGCAGGTGCAGGTCCAGTAGGACGTTGTGCGGCGGCGGGGGCGCGACTGTTAGGAGCGGCATGTGTGATCGTGGGCGACCAGAATCCTGAGCGCCTGAAGCTGCTATCTGATGCCGGTTTTGAAACGATCGACTTACGTAACTCTGCACCGCTGCGCGATCAGATTGATCAGATACTAGGTAAGCCGGAAGTCGACTGTGGTGTAGATGCGGTTGGTTTTGAAGCACATGGCCTTGGTGACGAAGCTAATACTGAGACGCCTAACGGTGCCCTAAATAGCCTCTTTGATGTAGTCCGAGCAGGTGGCGCAATCGGAATTCCGGGTATTTATGTAGGGAGCGACCCTGATCCTGTTAATAAAGATGCAGGGAGCGGACGCTTGCATCTTGACTTCGGCAAGATGTGGACAAAATCCATACGGATTATGACTGGAATGGCACCAGTGACAAACTACAATCGCCATCTGACCGAAGCAATACTTTGGGATCAAATGCCTTATTTGTCCAAGGTGATGAATATTGAAGTGATTACACTTGATCAAGCACCGGATGGGTATGCGAAATTCGATAAGGGGTCTCCCGCTAAGTTTGTTATCGATCCGCATGGCATGTTGAAGAATAAATGA

  • Why does my bank statement show multiple charges for one upgrade?

    Lorem ipsum dolor sit amet, consectetur adipisicing elit. Blanditiis provident officiis, reprehenderit numquam. Praesentium veritatis eos tenetur magni debitis inventore fugit, magnam, reiciendis, saepe obcaecati ex vero quaerat distinctio velit.

  • 5

  • Can I specify my own private key?

    Lorem ipsum dolor sit amet, consectetur adipisicing elit. Impedit quidem delectus rerum eligendi mollitia, repudiandae quae beatae. Et repellat quam atque corrupti iusto architecto impedit explicabo repudiandae qui similique aut iure ipsum quis inventore nulla error aliquid alias quia dolorem dolore, odio excepturi veniam odit veritatis. Quo iure magnam, et cum. Laudantium, eaque non? Tempore nihil corporis cumque dolor ipsum accusamus sapiente aliquid quis ea assumenda deserunt praesentium voluptatibus, accusantium a mollitia necessitatibus nostrum voluptatem numquam modi ab, sint rem.

  • How can I control if other search engines can link to my profile?

    Lorem ipsum dolor sit amet, consectetur adipisicing elit. Blanditiis provident officiis, reprehenderit numquam. Praesentium veritatis eos tenetur magni debitis inventore fugit, magnam, reiciendis, saepe obcaecati ex vero quaerat distinctio velit.

  • 6

  • What should I do if my order hasn't been delivered yet?

    Lorem ipsum dolor sit amet, consectetur adipisicing elit. Impedit quidem delectus rerum eligendi mollitia, repudiandae quae beatae. Et repellat quam atque corrupti iusto architecto impedit explicabo repudiandae qui similique aut iure ipsum quis inventore nulla error aliquid alias quia dolorem dolore, odio excepturi veniam odit veritatis. Quo iure magnam, et cum. Laudantium, eaque non? Tempore nihil corporis cumque dolor ipsum accusamus sapiente aliquid quis ea assumenda deserunt praesentium voluptatibus, accusantium a mollitia necessitatibus nostrum voluptatem numquam modi ab, sint rem.

  • When will my order ship?

    Lorem ipsum dolor sit amet, consectetur adipisicing elit. Blanditiis provident officiis, reprehenderit numquam. Praesentium veritatis eos tenetur magni debitis inventore fugit, magnam, reiciendis, saepe obcaecati ex vero quaerat distinctio velit.

Close