Team:BNDS China/Experiments
Experiment
Polymerase Chain Reaction (PCR)
We used Q5 DNA polymerase purchased form NEB for PCR. Below are the different groups and primers we used for amplifying gadR, gadC, gadA, and GFP insert sequences.
Bacterial Strains |
||
|---|---|---|
| Species | Strains | Description |
| Escherichia coli | DH5α | Cloning host |
| Escherichia coli | Nissle | Expression host |
Plasmids |
||
| ID | Antibiotic resistance | Description |
| Repressor Generator (RPG) | Ampicillin | Cloning & Expression vector |
| RPG-LacI-Ptac-RBS-gadR-RBS-gadC-RBS-gadA-terminator | Ampicillin | Expression plasmid carrying LacI, gadR, gadC, gadA from Lactobacillus brevis NCL912 and pTac from original RPG |
| RPG-LacI-Ptac-B0034-gadA-B0034-E0040-terminator | Ampicillin | Expression plasmid carrying LacI, gadA from Lactobacillus brevis NCL912 and pTac from original RPG. With super ribosomal binding site before gad A and GFP (Green Fluorescent Protein), respectively. |
| RPG-LacI-Ptac-B0034-gadA-Linker-Histag-terminator | Ampicillin | Expression plasmid with Overexpression of gadA with super ribosomal binding side under the control of a lactose inducible promoter from Lactobacillus brevis NCL912 and intending to exam expression of gadA using integrated polyhistidine-tag. |
| LacI-Ptac-B0034-gadA-Linker-E0040-terminator | Ampicillin | Expression plasmid with Overexpression of gadA with super ribosomal bonding side controlling with lactose inducible promoter and intending to exam expression of gadA using integrated fluorescent protein. |
Primers |
|||
|---|---|---|---|
| Primer ID | Sequences (5’ to 3’) | Amplification Size (bp) | Target Genes |
| ecRBS-1-gadR-F | ACCATAGATAAGAGTTTAATCGCAGatggaatcaagaacgaaggacattct | 644 | gadR |
| ecRBS-1-gadR-R | ccacTCTCTAATGTCCTCGCCGTGACGTttagacagataatacttgttgtttaaataa | ||
| ecRBS-1-gadC-F | ACGTCACGGCGAGGACATTAGAGAgtggatgaaaataagtctggacagcagattgatac | 1554 | gadC |
| ecRBS-1-gadC-R | TACCTGTTACCGTCGTAATGTGCGttacttagtttccttttccaatgattcatccg | ||
| ecRBS-13-gadA-F | CGCACATTACGACGGTAACAGGTAatgactaaacaggatcaggaaacgca | 1486 | gadA |
| RPG-gadA-R | ccattcgccattcaggttagttgtgaactgtcgtcttgttatcagtatccg | ||
| RPG-gadA-F | gttcacaactaacctgaatggcgaatggtaaGGTCTC | 4882 | RPG vector for gadRCA |
| ecRBS-1-RPG-R | ccatCTGCGATTAAACTCTTATCTATGGTATTATTTGTAGAGGCTGTTTCGTCCTCAC | ||
| ptac-gadA-F | acaattaaagaggagaaatactagatgactaaacaggatcaggaaacgcag | 1481 | gadA |
| gadA-GFP-R | CCACCGCCACCttagttgtgaactgtcgtcttgttatcagtatccg | ||
| gadA-GFP-F | cacaactaaGGTGGCGGTGGCtctatgcgtaaaggagaagaacttttcact | 1043 | GFP |
| GFP-RPG-R | ttgatgcctggACTAGTAGttattatttgtatagttcatccatgccatgtgtaatcc | ||
| RPG-GFP-F | taaCTACTAGTccaggcatcaaataaaacgaaaggctca | 4847 | RPG for old GFP construction |
| ptac-gadA-R | ctagtatttctcctctttaattgtgagcgctcacaattccacaca | ||
| gadA-RPG-F | ctCATCATCATCATCATCACtaaCTACTAGTccaggcatcaaataaaacgaaaggctca | 4791 | RPG for His-tag construction |
| ptac-gadA-R | ctagtatttctcctctttaattgtgagcgctcacaattccacaca | ||
| ptac-gadA-F | acaattaaagaggagaaatactagatgactaaacaggatcaggaaacgcag | 1500 | gadA |
| gadA-RPG-R | gTGATGATGATGATGATGagaGCCACCGCCACCgttgtgaactgtcgtcttgttatcagtatccg |
Q5 PCR Reaction system (50 μL) for gad R/gad C/gad A/GFP:
- Q5 Reaction Buffer (5x): 10 μL
- dNTP: 1 μL
- Forward Primer/ Reverse Primer :2.5 μL/2.5 μL
- Template (pUCIDT-GAD): 45ng
- Q5 DNA Polymerase: 0.5 μL
- ddH2O：33 μL
Q5 PCR Reaction system (50 μL) for the vector RPG
- Q5 Reaction Buffer (5x): 10 μL
- dNTP: 3 μL
- Forward Primer/ Reverse Primer :2.5 μL/2.5 μL
- Template (RPG): 45ng
- Q5 DNA Polymerase: 0.5 μL
- ddH2O：31 μL
Gibson Assembly
Since we had many segments, the success rate for Gibson assembly of 4 segments directly would be relatively low. Hence we chose to run Gibson Assembly twice. First, we conducted Gibson Assembly toward two groups of two segments. Then, we mixed the two Gibson Assembly reaction systems together.
| Group | Assembly 1 | Assembly 2 |
|---|---|---|
| RPG-gadR-gadC-gadA | RPG for RCA and gadR | gadC and gadA |
| RPG-A-GFP (old) | RPG for GFP (old) | gad A and GFP |
| RPG-A-linker-His tag | RPG and gad A with His-tag | N/A |
| RPG-A-linker-GFP | RPG-1 and GFP | RPG-2 and gadA |
Gibson Products Transformation
We transformed our Gibson products into competent E. coli DH5α cells.
Transformation system:
Positive control: 25 μL competent cell + 1 μL RPG
Negative control: 25 μL competent cell
Experiment group (with Gibson products): 50 μL competent cells + 2 μL Gibson products
Colony PCR
Gibson Assembly might cause a relatively high probability of false positive. In order to check whether the colony incorporated the targeted plasmid we expected, we ran colony PCR and used UV gel imaging to observe PCR product bands and then ran sequencing.
- Pick 6-10 colonies.
- Add 20 μL Amp+ liquid LB broth into 0.2 mL microfuge tube and add colonies, respectively. Then use 37°C shaker (with rotate speed 270r/min) to revive the bacteria for 1 hour.
Colony PCR Reaction System:
- Taq Mix: 12.5 μL
- Forward Primer/ Reverse Primer: 1 μL/1 μL
- Bacteria LB solution: 2 μL
- ddH2O: 10.5 μL
Plasmid Extraction
As the sequencing results were confirmed after comparing with the constructed plasmid, we in vitro cultured E. coli for 12 hours, then used the protocol of Axygen Mini-prepare Plasmid Extraction Kit to extract the RPG-gad R-gad C-gad A plasmid.
Plasmid Transformation
Since E. coli Nissle 1917 was not a conventionally used strain for synthetic biology, we decided to transform the desired plasmid instead of Gibson products into E. coli Nissle.
IPTG Induction for the First and Second Construction
We used the overnight (12 hours) incubated bacteria LB solution, diluted them 200x into Amp+ LB/M9 with 0.5 mM and 1mM IPTG, MSG (our substrate: sodium glutamate, 6 mL system), then we incubated them for 3 hours. After the incubation of 3 hours, E. coli Nissle 1917 would reach the early point of its exponential growth period. We then diluted the bacteria solution again 200x into Amp+ LB/M9 with 0.5 mM and 1mM IPTG, MSG(6 mL system) respectively and incubated 12 hours.
IPTG Induction for the Third Construction
The system and procedures were similar to that of IPTG Induction for the First and Second Construction, instead we used only a concentration of 1mM IPTG to induce bacteria. And since we planned to do the reaction between MSG and GAD outside our bacteria, we did not add MSG through the induction process.
Plate Reader Measurement for GFP Constructions
We measured the concentration of GFP using a Plate Reader to estimate the expression of gad A.
Plate Reader Measurement for GFP Constructions
We measured the concentration of GFP using a Plate Reader to estimate the expression of gad A.
Protein treatment for the first construction
We first added lysis buffer (pH=7.8) and PMSF (Phenylmethanesulfonyl fluoride) protease inhibitor to avoid enzymes in lysosome degrading our target protein - GAD enzyme. Then we used ultrasound cell disrupter to lyse our bacteria. After that, we ran SDS-PAGE to observe generally if there were correct protein bands at 55 kDa (The length of GAD is 54.8).
Protein treatment for the second construction
We did not treat the induced bacteria solution, and we measured GABA directly. (See details in “GABA Measurement”)
Protein Purification for the third construction (His-tag)
We first added lysis buffer (pH=7.8) and PMSF (Phenylmethanesulfonyl fluoride) protease inhibitor to avoid enzymes in lysosome degrading our target protein --- GAD enzyme. Then we used ultrasound cell disrupter to lyse our bacteria. After that, we suspend the bacteria solution on the nickel column, which would allow proteins to suspend on the column but not other molecules. Then we used imidazole to undergo competitive elution in order to elute our protein. After that, we used G250 (A type of Coomassie brilliant blue) to test whether the protein had been suspended on the column. At last, we ran SDS-PAGE to observe generally if there were correct band at 55 kDa (The length of GAD is 54.8).
The Reaction of the Third Construction
According to the result derived from our mathematic model, we prepared 3 acetic acid-sodium acetate buffers with pH=4.2, 4.4, 4.6 respectively. Then we added 2% MSG into the buffer and 800 μg GAD solution into the reaction system (20mL). After that, we incubated the reaction system with 100r/min and 37°C shaker for 3 hours.
GABA Measurement
We measured the induced bacteria LB solution directly via AAA (Amino Acid Analyzer). Before the measurement, we ran the GABA standard curve with pure GABA (concentration of 50, 100ppm and 200ppm, filtered before adding samples). After that, we used the ultrasound with ice to lyse the bacteria, then centrifuged products for 10 minutes with 4 °C. We diluted samples and transferred the solutions into the vial afterward.
