Team:Munich/Improve

Improved part:

The Tobacco Etch Virus (TEV) protease with 6x His-tag

The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV)¹.

or scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the BioBrick BBa_K1319008 by adding a 6x His-tag, which made it possible to purify this protease.

TEV protease cloning

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

p-TEV-His-fwd:	catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev:	catctagtatttctcctctttctctagtatctccc

5'-3' primers sequences

The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5&alpha for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.

The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.

AeBlue: The RNA strand in a specially designed RNA/DNA dimer is cut by Cas13a's collateral activity. After digestion, the interaction between the two strands is too weak to hold the dimer and it decays. We can then use the DNA-strand as template to translate the chromoprotein aeBlue.

Intein-Extein: By binding TEV-protease with a RNA-linker we can use Cas13a's collateral activity to regulate the protease's diffusion and use it to cleave a TEV tag separating the intein regions of a modified chromophore. After the first cleavage, the intein segment excises itself¹³, bringing together the halves of the chromophore. Only then is the chromophore functional and produces the colorimetric read-out.

Gold nanoparticles: Other than in the other two colorimetric readouts, aeB lue and Intein-Extein, the only protein involved in the gold nanoparticle (AuNP)-readout is Cas13a, like in our RNase Alert readout. This reduces the necessary fine tuning of the biochemical circuit to a minimum, favoring high robustness of the readout. Due to the phenomenon of Localized Surface Plasmon Resonance, AuNPs appear in a distinct color, ranging from intense red to blue, black and colorless. This property depends on particle size, shape, the immediate environment, and -most critical for our purpose- aggregation state¹⁴.

. In our project we use AuNPs with a diameter of roughly 10 nm, giving them a bright red color in solution. Their small size and therefore high surface-to-volume ratio makes them ideal for functionalization with thiolated compounds, forming covalent Au-S bonds. The first step of our concept is to use these properties to functionalize AuNPs with either 5’- or 3’- thiolated DNA and, through addition of linker- RNA which hybridizes with both thiolated DNA strands, form aggregates, changing the color from red to blue. The design of the linker-RNA includes an uracil-rich, single-stranded segment between the DNA-complementary termini, making it prone to Cas13a-mediated promiscuous cleavage. .

It has been shown that, for purely DNA-based hybridization, AuNP aggregates can be spotted on filter paper, dried and severed by addition of a nuclease-containing solution, visible through diffusion of red AuNPs on the paper. Thus, the second part of our concept is to spot RNA-linked AuNPs on paper, dry them alongside the Cas13a mixture and detect specific target RNAs and resulting Cas13a activity with a simple change from blue to red.

Software

To help facilitate the design of crRNA, the sequences that give CascAID its specificity, we developed a software tool that checks crRNA for unwanted secondary structures. This gives valuable insight on whether the sequence is suited to use with Cas13a or whether some modifications are needed. Together with Team Delft's software tool which designs the corresponding crRNA based on the target, we collaborated to develop a powerful tool that suggests crRNA sequences and checks their usability

References

Cohen, Limor, and David R. Walt. "Single-Molecule Arrays for Protein and Nucleic Acid Analysis." Annual Review of Analytical Chemistry 0 (2017).
Nakano, Michihiko, et al. "Single-molecule PCR using water-in-oil emulsion." Journal of biotechnology 102.2 (2003): 117-124.
Taniguchi, Yuichi, et al. "Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells." science 329.5991 (2010): 533-538.
Rissin, David M., et al. "Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations." Nature biotechnology 28.6 (2010): 595-599.
Pardee, Keith, et al. "Rapid, low-cost detection of Zika virus using programmable biomolecular components." Cell 165.5 (2016): 1255-1266.
Slomovic, Shimyn, Keith Pardee, and James J. Collins. "Synthetic biology devices for in vitro and in vivo diagnostics." Proceedings of the National Academy of Sciences 112.47 (2015): 14429-14435.
Tang, Ruihua, et al. "A fully disposable and integrated paper-based device for nucleic acid extraction, amplification and detection." Lab on a Chip 17.7 (2017): 1270-1279.
Vashist, Sandeep Kumar, et al. "Emerging technologies for next-generation point-of-care testing." Trends in biotechnology 33.11 (2015): 692-705.
Gubala, Vladimir, et al. "Point of care diagnostics: status and future." Analytical chemistry 84.2 (2011): 487-515.
Abudayyeh, Omar O., et al. "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector." Science 353.6299 (2016): aaf5573.
Gootenberg, Jonathan S., et al. "Nucleic acid detection with CRISPR-Cas13a/C2c2." Science (2017): eaam9321.
https://www.idtdna.com/pages/docs/technical-reports/in_vitro_nuclease_detectionD325FDB69855.pdf (retrieved: 13.10.17)
Anraku, Yasuhiro, Ryuta Mizutani, and Yoshinori Satow. "Protein splicing: its discovery and structural insight into novel chemical mechanisms." IUBMB life 57.8 (2005): 563-574.
Link, Stephan, and Mostafa A. El-Sayed. "Size and temperature dependence of the plasmon absorption of colloidal gold nanoparticles." The Journal of Physical Chemistry B 103.21 (1999): 4212-4217.
Zhao, W., Ali, M.M., Aguirre, S.D., Brook, M.A., and Li, Y. (2008). "Paper-based bioassays using gold nanoparticle colorimetric probes." Analytical Chemistry 80, 8431–8437.