Material&Methods
- 1) Parts
- 2) Primer list
- 3) Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDSPAGE&Westernblotting
- 3-12 B.xylophilus Experiment
- 4) Methods
- 4-1 Miniprep
- 4-2 Gel Extraction and PCR purification
- 4-3 Restriction Enzyme Digestion
- 4-4 Ligation
- 4-5 Transformation
- 4-6 PCR
- 4-7 Sequencing
- 4-8 RT-PCR
- 4-9 RTqPCR
- 4-10 Western blotting (Sample preparation of S. cerevisiae)
- 4-11 Western blotting (Basic protocol)
- 4-12 Culture using yeasts and measurement
- 4-13 The way of taking photos
- 4-14 Methods of taking movies
- 4-15 Way of making agar pad
- 4-16 Synthesis of dsRNA
- 4-17 Soaking
- Thaw competent cells on ice
- Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
- Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
- Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C
- Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C
- Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0
- Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes
- Centrifuge 5000rpm for 1min and remove the supernatant
- Resuspend with 30ul of SDS sample buffer
- Heat samples for 10min at 100°C using block incubater
- Vortex well
- Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)
- Soak the gel in transfer buffer
- Soak PVDF membrane in 100% methanol for 30 sec
- Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
- Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
- Transfer the proteins from the gel to the membrane with 100 mA for 1 h
- Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
- Wash for 5 min 3 times with TBST
- Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
- Wash for 5 min 3 times with TBST
- Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
- Add detection reagent onto the membrane, covering all of the membrane
- Incubate for 5 minutes at room temperature
- Drain off excess detection reagent by dabbing with Kimwipe
- Place the sample in the CCD camera compartment and record the images
- Prepare medium put on 3.5 cm plate.
- Drop liquid-cultured yeasts on the center of medium.
- Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.
- Pipette suspension including nematodes on the medium.
- Culture it at 25 ℃
- Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.
- Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.
- Suck out 12ul of water on the medium and drop it on microscope slide.
- Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.
- Make agar pad.
- Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.
- Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.
- Snap microscope slide with the finger and reach suspension to the center of agarose medium.
- Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.
- Make medium of 2% agar and sterlize by autoclave.
- Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.
- After the medium sodifies, reveal slowly covered slide glass.
- Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days.
1) Parts
Basic Parts
Composite Parts
2) Primer List
primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
tropomyosinT7R | TAATACGACTCACTATAGGGCTTGTTTTCTCCGGCTTCGG | 40 | 79 | 48 | Fukuda | Macrogen Japan Corp |
tropomyosinT7F | TAATACGACTCACTATAGGGGATCGAGAAGGACAACGCCC | 40 | 79 | 50 | Fukuda | Macrogen Japan Corp |
tropomyosinR | CTTGTTTTCTCCGGCTTCGG | 20 | 66 | 55 | Fukuda | Macrogen Japan Corp |
top-1F | GACTTTTCGTGCGTCTTCGG | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
top-1T7R | TAATACGACTCACTATAGGGCCCGGTTGAAAAGCAAGTGT | 40 | 78 | 45 | Fukuda | Macrogen Japan Corp |
top-1T7F | TAATACGACTCACTATAGGGGACTTTTCGTGCGTCTTCGG | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
top-1R | CCCGGTTGAAAAGCAAGTGT | 20 | 64 | 50 | Fukuda | Macrogen Japan Corp |
eef-1gF | GCAAAGGTTGCCGGTAAGAC | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
eef-1gT7R | TAATACGACTCACTATAGGGGACGGCAGAGGCCAACTTTA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
eef-1gT7F | TAA TACGACTCACTATAGGGGCAAAGGTTGCCGGTAAGAC | 40 | 77 | 48 | Fukuda | Macrogen Japan Corp |
eef-1gR | GACGGCAGAGGCCAACTTTA | 20 | 64 | 55 | Fukuda | Macrogen Japan Corp |
asbF | GGACTTTGGTCGTTGTCCCA | 20 | 63 | 55 | Fukuda | Macrogen Japan Corp |
asbT7R | TAATACGACTCACTATAGGGTCCACAGCGTCCTTCAAGTC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
asbT7F | TAATACGACTCACTATAGGGGGACTTTGGTCGTTGTCCCA | 40 | 78 | 48 | Fukuda | Macrogen Japan Corp |
asbR | TCCACAGCGTCCTTCAAGTC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
14-3-3proteinF-2 | TGGAGGGTGATCTCGTCCAT | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
14-3-3proteinT7R-2 | TAATACGACTCACTATAGGG CAAGGGGGATGGTTGGTCTC | 41 | 78 | 49 | Fukuda | Macrogen Japan Corp |
14-3-3proteinT7F-2 | TAATACGACTCACTATAGGG TGGAGGGTGATCTCGTCCAT | 41 | 76 | 46 | Fukuda | Macrogen Japan Corp |
14-3-3proteinR-2 | CAAGGGGGATGGTTGGTCTC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
actinF | AATGGCTCCGGTATGTGCAA | 20 | 65 | 50 | Fukuda | Macrogen Japan Corp |
actinR | TGGTGGTGAAAGAGTAGCCG | 20 | 62 | 55 | Fukuda | Macrogen Japan Corp |
14-3-3zetaF | CCTACAAGAACGTGGTCGGT | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
14-3-3zetaT7R | TAATACGACTCACTATAGGGTGTGAGTGCTCGCAAACTGT | 40 | 75 | 45 | Fukuda | Macrogen Japan Corp |
14-3-3zetaT7F | TAATACGACTCACTATAGGGCCTACAAGAACGTGGTCGGT | 40 | 76 | 48 | Fukuda | Macrogen Japan Corp |
14-3-3zetaR | TGTGAGTGCTCGCAAACTGT | 20 | 60 | 50 | Fukuda | Macrogen Japan Corp |
14-3-3proF | TCTCGGTCGCCTACAAGAAC | 20 | 61 | 55 | Fukuda | Macrogen Japan Corp |
14-3-3proT7R | TAATACGACTCACTATAGGGCCAGTCTCTCCCGTCTCGTT | 40 | 77 | 50 | Fukuda | Macrogen Japan Corp |
14-3-3proT7F | TAATACGACTCACTATAGGGTCTCGGTCGCCTACAAGAAC | 40 | 75 | 48 | Fukuda | Macrogen Japan Corp |
14-3-3proR | CCAGTCTCTCCCGTCTCGTT | 20 | 62 | 60 | Fukuda | Macrogen Japan Corp |
AK1F | TCGGAGACGGTTGTGTGAAGATG | 23 | 66 | 52 | Yoshimoto | Macrogen Japan Corp |
AK1T7R | TAATACGACTCACTATAGGGCAAGCACGGGTTGAATGGGT | 41 | 79 | 46 | Yoshimoto | Macrogen Japan Corp |
AK1T7F | TAATACGACTCACTATAGGGTCGGAGACGGTTGTGTGAAGATG | 43 | 77 | 47 | Yoshimoto | Macrogen Japan Corp |
AK1R | CAAGCACGGGTTGAATGGGT | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
longAK2F | TCCGAATCATGGCGAGAACC | 20 | 66 | 55 | Yoshimoto | Macrogen Japan Corp |
longAK2T7R | TAATACGACTCACTATAGGGCATGCCGGTCAACGGATAGT | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
longAK2T7F | TAATACGACTCACTATAGGGTCCGAATCATGGCGAGAACC | 40 | 78 | 48 | Yoshimoto | Macrogen Japan Corp |
longAK2R | CATGCCGGTCAACGGATAGT | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
shortAK2F | CCGTTTTGGATTTGTCGCGT | 20 | 67 | 50 | Yoshimoto | Macrogen Japan Corp |
shortAK2T7R | TAATACGACTCACTATAGGGTCGATCTTCTTGACCGTCGC | 40 | 77 | 48 | Yoshimoto | Macrogen Japan Corp |
shortAK2T7F | TAATACGACTCACTATAGGGCCGTTTTGGATTTGTCGCGT | 40 | 79 | 45 | Yoshimoto | Macrogen Japan Corp |
shortAK2R | TCGATCTTCTTGACCGTCGC | 20 | 64 | 55 | Yoshimoto | Macrogen Japan Corp |
gal1-1F | cccCGAATTCccccattatctt | 22 | 68 | 50 | Yoshimoto | Macrogen Japan Corp |
gal1-1R | CTCCCACACCAGCATCCAA | 19 | 63 | 58 | Yoshimoto | Macrogen Japan Corp |
gal1-2F | AAGCTGGGCGCCACTTT | 17 | 64 | 59 | Yoshimoto | Macrogen Japan Corp |
gal1-2R | CAAGTCGTTGCTGAAGAAACATTTCAC | 27 | 66 | 41 | Yoshimoto | Macrogen Japan Corp |
gal1-3F | ACTCGGCGTCCGGAG | 15 | 61 | 73 | Yoshimoto | Macrogen Japan Corp |
gal1-3R | tacccTGCAGgggagc | 16 | 59 | 69 | Yoshimoto | Macrogen Japan Corp |
gpd-1F | tctagaggatccccCGAATTC | 21 | 63 | 52 | Yoshimoto | Macrogen Japan Corp |
gpd-1R | CCGTTGACCGGCATGct | 17 | 65 | 65 | Yoshimoto | Macrogen Japan Corp |
gpd-2F | AATCCGCTGTGGCCGC | 16 | 66 | 69 | Yoshimoto | Macrogen Japan Corp |
gpd-2R | AACCACCTTCTTCGCACAGAAC | 22 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
gpd-3F | GACGTCCTTGGTGAAATGTTTC | 22 | 61 | 45 | Yoshimoto | Macrogen Japan Corp |
gpd-3R | gggaaaaccctggcgttac | 19 | 64 | 58 | Yoshimoto | Macrogen Japan Corp |
IK21 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
IK22 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
IK23 | ATTTATTGGAGAAAGATAACATATCATACTTTCCC | 35 | 66 | 29 | Yoshimoto | Macrogen Japan Corp |
IK24 | AACCTTTATTGTGTGCACACTCAAAC | 26 | 63 | 38 | Yoshimoto | Macrogen Japan Corp |
IK25 | GATAATATAAAGATGGGCAGCAGCCATCAT | 30 | 69 | 40 | Yoshimoto | Macrogen Japan Corp |
IK26 | CCAATAAATCTATTCTTTAGCTCCTGACTCCAATATTGTA | 40 | 70 | 32 | Yoshimoto | Macrogen Japan Corp |
IK27 | ACTAGTGGATCCCCCCCTCCACAAAGGCCTCTCCT | 35 | 81 | 60 | Yoshimoto | Macrogen Japan Corp |
IK28 | GAATTCCTGCAGCCCAACCTTTATTGTGTGCACACTCAAAC | 41 | 80 | 46 | Yoshimoto | Macrogen Japan Corp |
IK60 | GTGTAGGCCTCGGCATCCG | 19 | 67 | 68 | Yoshimoto | Macrogen Japan Corp |
IK61 | TAATACGACTCACTATAGGGGTGGAGAGGGTGAAGGTGATG | 41 | 77 | 49 | Yoshimoto | Macrogen Japan Corp |
IK62 | TAATACGACTCACTATAGGGTGCCATGTGTAATCCCAGCAG | 41 | 77 | 46 | Yoshimoto | Macrogen Japan Corp |
IK81 | atgtatTCTAGAcTCCTCCACAAAGGCCTCTCCTGG | 36 | 75 | 50 | Dou | Macrogen Japan Corp |
IK82 | GCCCCCTGCAtGCCCTCC | 18 | 72 | 78 | Dou | Macrogen Japan Corp |
IK83 | GCGCAGGAGGGCaTGCAGG | 19 | 73 | 74 | Dou | Macrogen Japan Corp |
IK84 | gtACTAGTgCTTTATATTATCAATATTTGTGTTTGTGGAGGGGGGGG | 47 | 77 | 40 | Dou | Macrogen Japan Corp |
IK85 | GGGTCGCGGATCCgaaCtcATGG | 23 | 75 | 65 | Dou | Macrogen Japan Corp |
IK86 | CGCTTCTTCCTGCCATgaGttcGGA | 25 | 74 | 56 | Dou | Macrogen Japan Corp |
IK87 | atgtatTCTAGAcaatgggcagcagccatc | 30 | 71 | 47 | Dou | Macrogen Japan Corp |
IK88 | gtACTAGTgCTATTCTTTAGCTCCTGACTCCA | 32 | 66 | 44 | Dou | Macrogen Japan Corp |
IK89 | AAT CTA GAA GCG GCC GCA CAC GCT TT TTC | 38 | 77 | 39 | Dou | Macrogen Japan Corp |
IK90 | GAACTAGTCAGAGATCTGAGTCCGGACTTGTACAGCTC | 38 | 73 | 50 | Dou | Macrogen Japan Corp |
IK91 | ccgcaaaatcaggtgtgttg | 20 | 63 | 50 | Yoshimoto | Macrogen Japan Corp |
IK92 | tatctttaccaattagtttcaatgtttagtaagg | 34 | 63 | 26 | Yoshimoto | Macrogen Japan Corp |
IK93 | AATGACGCTGACGGTACAGG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
IK94 | ATGCCCCAGACTGTGAGTTG | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
IK95 | ggttgtgtgaagatgaccgc | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
IK96 | tcttcagcagggacttgcag | 20 | 62 | 55 | Yoshimoto | Macrogen Japan Corp |
IK97 | agcgttcaactagcagacca | 20 | 59 | 50 | Yoshimoto | Macrogen Japan Corp |
IK98 | agggcagattgtgtggacag | 20 | 61 | 55 | Yoshimoto | Macrogen Japan Corp |
IK99 | TGGCGAGAACCACCTTCTTC | 20 | 63 | 55 | Yoshimoto | Macrogen Japan Corp |
IK100 | GCTCCCTGGTTGAACGTGTA | 21 | 61 | 52 | Yoshimoto | Macrogen Japan Corp |
IK21-2 | CCTCCACAAAGGCCTCTCCT | 20 | 64 | 60 | Yoshimoto | Macrogen Japan Corp |
IK22-2 | CTTTATATTATCAATATTTGTGTTTGTGGAGGGGG | 35 | 70 | 34 | Yoshimoto | Macrogen Japan Corp |
IK121 | GCCTCTCCTGGGGTTTGAG | 19 | 63 | 63 | Ohara | Macrogen Japan Corp |
IK122 | CTCCACAAACACAAATATTGATAATATAAAGatgggcagc | 40 | 73 | 35 | Ohara | Macrogen Japan Corp |
IK129 | CCTCCACAAACACAAATATTGATAATATAAAGatgggcagcagccatcat | 50 | 80 | 38 | Ohara | Macrogen Japan Corp |
IK130 | GGAAAGTATGATATGTTATCTTTCTCCAATAAATCTATTCTTTAGCTCCTGACTCCAATATTGTA | 65 | 77 | 31 | Ohara | Macrogen Japan Corp |
IK101 | atgtcttctagagcggtaggt | 21 | 56 | 48 | Yoshimoto | Macrogen Japan Corp |
IK102 | cctgattttgcggccgcatccgtcgaaactaagttctgg | 39 | 85 | 54 | Yoshimoto | Macrogen Japan Corp |
IK103 | aacttagtttcgacggat gcggccgcaaaatcag g | 36 | 83 | 50 | Yoshimoto | Macrogen Japan Corp |
IK104 | gcACTAGTtgaagcttctctatct | 24 | 56 | 42 | Yoshimoto | Macrogen Japan Corp |
IK105 | atgtcttctagagccccattatcttagcctaaaaaaacc | 39 | 73 | 38 | Yoshimoto | Macrogen Japan Corp |
IK106 | cctgattttgcggccgcctccatggtggcggc | 32 | 90 | 69 | Yoshimoto | Macrogen Japan Corp |
IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
Name | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
3-2 Restriction Enzyme
Name | Supplier |
---|---|
EcoRI | TaKaRa, Promega |
PstI | TaKaRa, Promega |
SpeI | TaKaRa, Promega |
3-3 Polymerase
Name | Supplier |
---|---|
KAPA™HiFi HotStart ReadyMix (2x) | KAPABIOSYSTEMS |
KAPA2G™ Fast HotStart ReadyMix with dye (2x) | KAPABIOSYSTEMS |
KAPATaq™EXtra HotStart ReadyMix with dye | KAPABIOSYSTEMS |
3-4 DNA ligase
Name | Supplier |
---|
3-5 Marker
Name | Supplier |
---|---|
1kb DNA Ladder | TaKaRa |
3-6 Organism
Name | Supplier |
---|---|
E.coli DH5α Genotype | TaKaRa |
E.coli BL21(DE3)pLysS Competent Cells | Promega |
3-7 Antibiotics
Name | Supplier |
---|
3-8 Equipment
Name | Supplier |
---|---|
BioPhotometer | eppendorf |
LABO SHAKER | BIO CRAFT |
CO2 INCUBATOR | SANYO |
Pipette Controller | Biohit Midi Plus |
MiniCentrifuge Model GMC-060 | LMS CO.,LTD. |
HIGH-SPEED REFRIGERATED CENTRIFUGE | TOMY |
HIGH-PRESSURE STEAM STERILIZER | TOMY |
VOTEX-GENE2 | Scientific Industryes |
Scanning Electron Miniscope TM1000s | HITACHI |
Fluorescence Microscope BX61N-34-FL-1-D | OLYMPUS |
SCIECE IMAGING SYSTEM LAS-3000 | Fuji film |
3-9 Backbone
Name | Supplier |
---|---|
pSB1C3 | iGEM registry |
pSB1A2 | iGEM registry |
pSB3C5 | iGEM registry |
3-10 Buffer
Name | Supplier |
---|---|
Sodium Carbonate | Wako |
Sodium Bicarbonate | Wako |
Methanol(99.5%) | Wako |
Sodium Chloride | Wako |
SDS | nacalai tesque |
Trisaminomethane | nacalai tesque |
Potassium dihydrogenphosphste | SIGAMA-ALDRICH |
Potassium Chloride | Wako |
Glycine | Wako |
Agar, Powder | Wako |
Agarose XP | Wako |
10% Hydrochloric Acid | Wako |
3-11 SDSPAGE&Westernblotting
IMMOBILON - P Blotting Sandwiches | Immobilon |
---|---|
REAL GEL PLATE (10%) | BIO CRAFT |
BE-210(SDSPAGE) | BIO CRAFT |
BE-330 | BIO CRAFT |
Amersham ECL Anti-Mouse IgG | GE healthcare |
Amersham ECL Anti-rabbit IgG | GE healthcare |
Amersham ECL Prime Blocking Reagent | GE healthcare |
Amersham ECL Prime WB Detection Reagent | GE healthcare |
3-12 B. xylophilus Experiment
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-2 Gel Extraction and PCR purification
Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.
4-3 Restriction Enzyme Digestion
Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.
4-4 Ligation
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's
4-5 Transformation
4-6 PCR
PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols
4-7 Sequencing
We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php
4-8 RT-PCR
We extracted B. Xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.
RT-PCR was performed using ~~~ according to the manufacturer's protocol.
4-9 RTqPCR
????????
4-10 Western blotting (Sample preparation of S. cerevisiae)
4-11 Western blotting (Basic protocol)
4-12 Culture using yeasts and measurement
4-13 The way of taking photos
4-14 Methods of taking movies
4-15 Way of making agar pad
4-16 Synthesis of dsRNA
We synthesyzed dsRNA by "MEGAscript™ T7 Transcription Kit."
https://www.thermofisher.com/order/catalog/product/AM1334
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf