Team:Oxford/Software

Software Tool

Enter the disease name, parasite or specific protease to find the cleavage sequence of protease specific to the disease of interest and how our system may be applicable.

Disease	Parasite	Specific Protease	DNA Sequence of Cleavage Site	Protease Cleavage Sequence	Medium of Test	Final Output	Positive Result
Congenital Chagas Disease	Trypanosoma Cruzi	Cruzipain	AAAAAAGTTAAAGCTAAAAAA	K/K/L/KR-A/KS/K/RQ	Blood	Hirudin	No blood clotting
Sepsis	Pseudomonas aeruginosa	LasA		After Gly-Gly (e.g. PGVGG - elastin) or between Lys-Ile (e.g. NKKIEKFQ(S-P) - beta=casein)	Blood	Hirudin	No blood clotting
African Sleeping sickness	Trypanosoma brucei	Rhodesain/Brucepain	TCCGCGCCGAAATCCCTGATTGGC/ TCCGCGCCGCGTTCCCTGATTGGC	S/A/P/R-K/S/L/I/G	Blood	Hirudin	No blood clotting
Schistosomiasis	Schistosoma mansoni	Cercarial elastase	AGCTGGCCGCTG	SWPL	Blood	Hirudin	No blood clotting
Congenital toxoplasmosis	Toxoplasma gondii	Cathepsin L		KQKLR	Amniotic fluid