Notebook & Result

Red - working on RF cloning

Green - working on new genes

Blue - working on yeast cells

Orange - working on Brett

Purple - working on improve BioBrick

S.cerevisiae 3095 with URA- mutation were obtained from Dr. Itay Onn (faculty of medicine of Bar Ilan University) and were isolated from YEPD plates.
Isolation streak of Brett on selection medium- specific YEPD media.

Colonies from Brett isolation appeared.
Colonies that appeared were tested using PCR with specific primers (from Prof. Martin Goldway lab) for Brett detection- PB2, RUX, DB, and NLS. We got negative results- no PCR product.

Fig.1- Dana having fun with Brett colonies in the lab

We got pRS306/316 from Dr. Itay Onn.
Transformation into TOP-10 competent cells:
- Preparation of competent TOP10 e.coli bacteria for heat-shock transformation (we used this protocol – לתת לינק לדף פרוטוקול מספר 9)
- T--Tel-Hai--dana-in-the-labTransformation for plasmids pRS306 + pRS316 into competent cells was performed using Heat-shock protocol then incubated O.N.
  
  Fig.2 - Plasmid map of pRS306 / pRS316 – with enzymes sites.
A new sample of Brett was tested:
Sample was sawn on YEPD selective Brett plates for colony isolation.

Fig.3 - Brett colonies, YEPD plates. The colonies grew over 3 days at 30℃

Isolated colonies were analyzed by PCR with specific primers for Brett strains - PB2, RUX, DB, and NLS.

Table 1 - Brett primers, designed in Prof. Martin Goldway lab

Primer name	Sequence	Product size	Detection target
Rux (specific for Brett)	DBRUX F: ggatgggtgcacctggtttacac DBRUX R: GAAGGGCCACATTCACGAACCCC	96 bp	28S rRNA
DB (specific for Brett)	DB394 R: acgaggaacgggc DB90 F: actagagagaggag	300 bp	28S rRNA
PB2 (specific for Brett)	PB2: AGAGTGAGGGGATAATGA ITS 4B: tcctccgcttattgatatgc	132 bp	28S rRNA
NLS (universal)	NL1: GCCATATCAATAAGCGGAGGAAA LS2: attcccaaacaatcaactcgactc	250 bp	large subunit ribosomal RNA gene

Team:Tel-Hai/Notebook