Disease | Congenital Chagas Disease |
Parasite | Trypanosoma Cruzi |
Specific Protease | Cruzipain |
DNA Sequence of Cleavage Site | AAAAAAGTTAAAGCTAAAAAA |
Protease Cleavage Sequence | K/K/L/KR-A/KS/K/RQ |
Medium of Test | Blood |
Final Output | Hirudin |
Positive Result | No blood clotting |
|
Disease | Sepsis |
Parasite | Pseudomonas aeruginosa |
Specific Protease | LasA |
DNA Sequence of Cleavage Site | |
Protease Cleavage Sequence | After Gly-Gly (e.g. PGVGG - elastin) or between Lys-Ile (e.g. NKKIEKFQ(S-P) - beta=casein) |
Medium of Test | Blood |
Final Output | Hirudin |
Positive Result | No blood clotting |
|
Disease | African Sleeping sickness |
Parasite | Trypanosoma brucei |
Specific Protease | Rhodesain/Brucepain |
DNA Sequence of Cleavage Site | TCCGCGCCGAAATCCCTGATTGGC/ TCCGCGCCGCGTTCCCTGATTGGC |
Protease Cleavage Sequence | S/A/P/R-K/S/L/I/G |
Medium of Test | Blood |
Final Output | Hirudin |
Positive Result | No blood clotting |
|
Disease | Schistosomiasis |
Parasite | Schistosoma mansoni |
Specific Protease | Cercarial elastase |
DNA Sequence of Cleavage Site | Cercarial elastase |
Protease Cleavage Sequence | AGCTGGCCGCTG |
Medium of Test | SWPL |
Final Output | Hirudin |
Positive Result | No blood clotting |
|
Disease | Congenital toxoplasmosis |
Parasite | Toxoplasma gondii |
Specific Protease | Cathepsin L |
DNA Sequence of Cleavage Site | AAACAGAAACTGCGC |
Protease Cleavage Sequence | KQKLR |
Medium of Test | Amniotic fluid |
Final Output | Luciferase |
Positive Result | Light |
|