Team:CIEI-BJ/Results
PdGES, Phyla dulcis geraniol synthase (GES), is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate（GPP）can be produced by glucose. The function of PdGES is to convert GPP into geraniol. This enzyme is one of the essential proteins in our process, since it produces geraniol in the first place.
(GenBank: GU136162.1)
ATGGCGAGTGCAAGAAGCACCATATCTTTGTCCTCACAGTCATCTCATCATGGGTTCTCCAAAAACTCATTTCCATGGCAACTGAGGCATTCCCGCTTTGTTATGGGTTCTCGAGCACGTACCTGCGCATGCATGTCATCATCAGTATCACTGCCTACTGCAACGACGTCGTCCTCAGTCATTACAGGCAACGATGCCCTCCTCAAATACATACGTCAGCCTATGGTAATTCCTTTGAAAGAAAAGGAGGGCACGAAGAGACGAGAATATCTGCTGGAGAAAACTGCAAGGGAACTGCAGGGAACTACGGAGGCAGCGGAGAAACTGAAATTCATTGATACAATCCAACGGCTGGGAATCTCTTGCTATTTCGAGGATGAAATCAACGGCATACTGCAGGCGGAGTTATCCGATACTGACCAGCTTGAGGACGGCCTCTTCACAACGGCTCTACGCTTCCGTTTGCTCCGTCACTACGGCTACCAAATCGCTCCCGACGTCTTCCTAAAATTCACGGACCAAAATGGAAAATTCAAAGAATCCTTAGCGGATGACACACAAGGATTAGTCAGCTTATACGAAGCATCATATATGGGAGCAAACGGAGAAAACATATTAGAAGAAGCTATGAAATTCACCAAAACTCATCTCCAAGGAAGACAACATGCGATGAGAGAAGTGGCTGAAGCCTTGGAGCTTCCGAGGCATCTGAGAATGGCCAGGTTAGAAGCAAGAAGATACATCGAACAATATGGTACAATGATTGGACATGATAAAGACCTCTTGGAGCTAGTAATATTGGACTATAACAATGTCCAGGCTCAGCACCAAGCGGAACTCGCCGAAATTGCCAGATGGTGGAAGGAGCTTGGTCTAGTTGACAAGTTAACTTTCGCGCGAGATAGACCATTGGAGTGCTTTTTGTGGACTGTCGGTCTTCTACCTGAACCCAAATACTCTGCTTGCCGAATCGAGCTCGCAAAAACAATAGCCATTCTATTGGTAATCGATGATATCTTCGATACCTATGGGAAAATGGAAGAACTCGCTCTTTTCACGGAGGCAATTAGAAGATGGGATCTTGAAGCTATGGAAACCCTTCCCGAGTACATGAAAATATGCTATATGGCATTGTACAATACCACCAACGAGATATGCTACAAAGTCCTCAAGAAAAATGGATGGAGTGTTCTCCCATACCTAAGATATACGTGGATGGACATGATAGAAGGTTTTATGGTGGAGGCAAAGTGGTTCAATGGTGGAAGTGCTCCAAACTTGGAAGAGTACATAGAGAATGGAGTCTCAACGGCTGGGGCATACATGGCTTTGGTGCATCTCTTCTTTCTAATTGGGGAAGGTGTCAGTGCGCAAAATGCCCAAATATTACTGAAGAAACCCTATCCTAAGCTCTTCTCGGCTGCCGGTCGAATTCTTCGCCTTTGGGATGATCTTGGAACGGCTAAGGAGGAGGAAGGAAGAGGTGATCTTGCATCGAGCATACGTTTATTCATGAAAGAAAAGAACCTAACAACGGAAGAGGAAGGGAGAAATGGTATACAGGAGGAGATATATAGCTTATGGAAAGACCTAAACGGAGAGCTCATTTCTAAAGGTAGGATGCCATTGGCCATCATCAAAGTGGCACTTAACATGGCTAGAGCTTCTCAAGTGGTGTACAAGCATGACGAGGACTCTTATTTTTCATGTGTAGACAATTATGTGGAGGCCCTGTTCTTCACTCCTCTCCTTTGA
In order to assure that PdGES had been ligated to the multiple cloning sites of the vector successfully, we avoid all the common restriction enzyme cutting sites （EcoR I, Xba I, Spe I, Pst I, BamH I, Bgl II, Hind III, Kpn I, Nco I, Nde I, Not I, Sal I, Xho I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site）when the synthesis was performed.
To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoided the restriction enzyme cutting sites, which are EcoR Ⅰ, Xba I, Spe I, Pst I.
To ligate genes directly to the standard vector, we added the restriction enzyme cutting sites of Xba Ⅰ and Spe Ⅰ to the upstream and downstream of the target gene.
ATGGCGAGCGCGCGTAGCACCATCAGCCTGAGCAGCCAAAGCAGCCACCACGGTTTCAGCAAAAACAGCTTTCCGTGGCAGCTGCGTCACAGCCGTTTCGTTATGGGCAGCCGTGCGCGTACCTGCGCGTGCATGAGCAGCAGCGTGAGCCTGCCGACCGCGACCACCAGCAGCAGCGTGATTACCGGTAACGACGCGCTGCTGAAGTATATCCGTCAGCCGATGGTGATTCCGCTGAAGGAGAAAGAGGGCACCAAGCGTCGTGAATACCTGCTGGAGAAAACCGCGCGTGAGCTGCAAGGCACCACCGAGGCGGCGGAAAAGCTGAAATTCATCGACACCATTCAGCGTCTGGGTATCAGCTGCTACTTTGAGGATGAAATCAACGGCATTCTGCAAGCGGAACTGAGCGACACCGATCAGCTGGAGGATGGTCTGTTCACCACCGCGCTGCGTTTTCGTCTGCTGCGTCACTACGGCTATCAAATCGCGCCGGACGTTTTCCTGAAATTTACCGATCAGAACGGCAAGTTCAAAGAAAGCCTGGCGGACGATACCCAAGGCCTGGTGAGCCTGTACGAAGCGAGCTATATGGGTGCGAACGGCGAGAACATTCTGGAGGAAGCGATGAAGTTTACCAAAACCCACCTGCAAGGTCGTCAGCACGCGATGCGTGAGGTTGCGGAAGCGCTGGAGCTGCCGCGTCACCTGCGTATGGCGCGTCTGGAAGCGCGTCGTTACATCGAGCAGTATGGCACCATGATTGGCCACGACAAGGATCTGCTGGAGCTGGTGATCCTGGACTACAACAACGTTCAGGCGCAACACCAGGCGGAACTGGCGGAGATTGCGCGTTGGTGGAAGGAGCTGGGTCTGGTTGACAAACTGACCTTCGCGCGTGATCGTCCGCTGGAATGCTTTCTGTGGACCGTGGGTCTGCTGCCGGAACCGAAATATAGCGCGTGCCGTATCGAGCTGGCGAAGACCATCGCGATTCTGCTGGTTATCGACGATATTTTCGACACCTACGGTAAAATGGAGGAACTGGCGCTGTTTACCGAAGCGATTCGTCGTTGGGATCTGGAAGCGATGGAGACCCTGCCGGAGTATATGAAAATCTGCTACATGGCGCTGTATAACACCACCAACGAAATTTGCTACAAGGTGCTGAAGAAAAACGGTTGGAGCGTTCTGCCGTACCTGCGTTATACCTGGATGGATATGATCGAAGGCTTCATGGTGGAGGCGAAGTGGTTTAACGGTGGCAGCGCGCCGAACCTGGAGGAATATATTGAGAACGGTGTGAGCACCGCGGGCGCGTACATGGCGCTGGTTCACCTGTTCTTTCTGATCGGTGAAGGCGTGAGCGCGCAAAACGCGCAGATTCTGCTGAAGAAACCGTATCCGAAACTGTTCAGCGCGGCGGGTCGTATCCTGCGTCTGTGGGACGATCTGGGCACCGCGAAAGAGGAAGAGGGTCGTGGCGACCTGGCGAGCAGCATTCGTCTGTTTATGAAGGAGAAAAACCTGACCACCGAAGAGGAAGGTCGTAACGGCATCCAAGAGGAAATTTACAGCCTGTGGAAGGATCTGAACGGTGAACTGATCAGCAAAGGCCGTATGCCGCTGGCGATCATTAAGGTGGCGCTGAACATGGCGCGTGCGAGCCAGGTGGTTTACAAACACGACGAAGATAGCTATTTCAGCTGCGTGGACAACTACGTTGAGGCGCTGTTCTTTACCCCGCTGCTGTAA
PdGES
CAI: 0.97
Fig. 1-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.
Introduction of pUC57:
pUC57 is a carrier of E.Coli and it is a cloning vector with size of 2710 bp. The promoter of pUC57 is lac , the replicon is ColE1 origin, and the resistance of pUC57 is ampicillin in prokaryotes. In addition, the aerobic environment with 37 degree Celsius in LB medium is the optimal temperature for culture of pUC57. In our experiment, we got genes PdGES and PcGES from pUC57 as our initial materials.
The sequences of common primer for pUC57:
5' sequencing primer M13R: CAGGAAACAGCTATGACC
3' sequencing primer M13F: TGTAAAACGACGGCCAGT
Fig. 1-2 The plasmid portfolio of pUC57
To obtain the target gene PdGES by using the specific primers to clone the targeted gene, our team amplifiedd the template----vector pUC57 with PdGES ---- through PCR.
The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGGCGAGCGCGCGTAG
The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTACAGCAGCGGGGTAA
As shown inAs shown in figure 1-3, the size of PdGES shown on the picture matches the theoretical size of PdGES which is 1755 bp. The result proved that we had successfully cloned the gene . PdGES .
Fig. 1-3 Electrophoresis of PdGES PCR product.
The left column is the marker, and the two strips on the right are PCR products of PdGES .
The sizes of the two strips are both about 2000 bp.
pPIC9K is a carrier for protein expression of in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is Ampicillin.
The sequences of common primer for pPIC9K:
5' sequencing primer is 5´-GACTGGTTCCAATTGACAAGC-3´
3' sequencing primer is 5´-GCAAATGGCATTCTGACATCC-3´
Fig. 1-4 The plasmid portfolio of pPIC9K
TThe vector pPIC9K used in our experiment doesn’t have the S part, because S part is the secretion signal which can remove the protein we produced in the experiment. Since our purpose is to obtain the protein, we had to cut this part to make our experiment successful.
As shown in the diagram below, PdGES had been ligated to the yeast vector pPIC9K successfully. The process is achieved by digestion and ligation to BamHI and NotI. Finally, we transform the ligation product into competent cell yeast GS115.
Fig. 1-5 Electrophoresis of PdGES -contained pPIC9K vector.
The left column is the marker and the strips on the right are the PCR products of ligation of PdGES.
pET32a is a carrier for protein expression of protein in E.Coli and it is with a size of 5900bp. The promoter of pET32a is T7, which is a strong promoter that can express at any time, in any cell and under any circumstance. The resistance of pET32a is Ampicillin.
The sequences of primer for pET32a:
5' sequencing primer is 5´-TAATACGACTCACTATAGGG-3´
3' sequencing primer is 5´-GCTAGTTATTGCTCAGCGG-3´
Fig. 1-6 The plasmid portfolio of pET32a
We tried to ligate SpTPS1 gene into pET32a vector, but after three trails, we failed to ligate the intracellular device in pET32a. The possible explanation is that the condition of ligation is not suitable or the sequence of this gene.
PcGES, Pogostemon cablin geraniol synthase (GS1), is an also an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate（GPP）can be produced. The function of PcGES is to convert GPP to geraniol. PcGES functions the same as PdGES, the only difference is that they are from different species. By applying both GESs in our experiments, we can find out which one is more efficient by analyzing the efficiency of production.
(GenBank: KF926075.1)
ATGTCTTGTGCTAGAAGCTACACCATTCCTTTGTCCTTCCCCAAAACCTCTAATTCACCATTGCAACTAAAGAATCTCCTCCCTTTCCCCGCCGCCCGGTCGCGTTTTTCCGTGCGCATGTCCACCTCGTCCCTTCCCGTTGGCAACGAAGCCCTACTAAAATACATTCGACAACCCGTGGTGTTGCCTACGGAAGAAGATGAGAGCATCAAGAGGAGAGATTATTTGCTCGAAAAAACTGCGAGGAGGTTAAGGACGAGTACGGGTAGTGTGGAGAAGCTTAAGCTTATCGATACGATCCAACGACTAGGAATCGATTATTATTTGGAGGACGATATAAACGTAGTACTTAGAAATGAGTACTATAATGGTAGGTCTAGTGAAGAAGACCTCTTCACTACAGCTCTAAGATTTCGTTTGCTTCGTCACAACGGCTTCCAAATTAGTTCTGATGTATTCATGAAATTCAAGGACAAAAATGGAAAATTCAAAAAATGGATAGCTGAGGATACAATAGGGTTACTGAGCTTATATGAGGCGTCGTATATGGGAGCTCATGGTGAAAAAATATTGGAAGAAGCGATGGAATTCTCGAGGTCACTCCTCAAGAGATCGCTTCCTCAGTTGCCTCCGAAGCTCCACGGGCAGGTGGCTCAAGCCTTGGAGCTTCCGAGACACCTGAGGATGGCTAGATTAGAAGCTCGACGGTTTGTCCAGCAATACGCTAAACAAAGTGACTGCGATCGTGACCTTTTGAACCTAGCAACATTGGATTATAACAAGGTTCAATTGCAGCACCAATTTGAACTTGCCGAAATTACAAGGTGGTGGCAACAGCTTGGTCTAGTAGAAAAGTTAACATTTGCACGAGATAGACCGTTGGAGTGTTTTTTGTGGACCGTTGGATTACTCCCAGAACCCAGATATTCCACGTGTCGAATTGAGATGGCCAAGACCATTGCTATTTTATTAGTCATTGACGATATTTTCGACACGTATGGCAAAATGGATGAACTCCTCCTCTTCACCCAAGCTATTAGAAGATGGGATCTTGAAGCAATGGATATCCTTCCGGAATACATGAAAATATGTTACATGGCATTATACAACACAACTAATGAAATATGCTACAAAGTGCTCAAACTCAATGGATGGAGTGTCCTTTCTTACCTTAAATCTACGTGGATAGATATGATAGAAGGTTTTATGGTGGAGGCAAAATGGTTGAATGGTGGTGGTGCACCAAACTTGGAAGAGTACCTTGAGAATGGAGTGTCTACGGCGGGTGCATACATGGCTCTGGTGCACCTCTTTTTCCTAATTGGAGAAGGCGTTAATGACCAAAATGCCCCACTCTTGACCAAAAAACCATACCCCAAGCTCTTCTCCGCCGCTGGCCGGATTCTTCGCCTCTGGGACGACCTCGGAACTGCCAAGGAGGAGCAAGAGCGAGGAGACGTAGCATCGAGCATCGAGTTTGTGATGAGAGAGAAAGAGGTGGAAAGTGAAGAAGAGGGAAGAAGATACATATTGGGAGAGATATATGAGTTATGGAAGGATTTGAATGGGGAGTTGATGTCCAAGAATGGAATGCCATTAGCGATTATTAAAGTCGCACTTAACATGGCACGAGCTTCCCAAGTGGTGTACAAGCATGAAGAGGACACTTATTTCTCCAGCGTGGATAATTACGTGGAAGCCCTCTTCTTCACTCCTCTTCCTTCATCCATCTAA
In order to assure that PcGES ligate to the multiple clone sites of the vector successfully, we avoid all the common restriction enzyme cutting sites （EcoR I, Xba I, Spe I, Pst I, BamH I, Bgl II, Hind III, Kpn I, Nco I, Nde I,Not I,Sal I, Xho I, Polymerase slippage site, Polymerase slippage site, Frameshift element, ribosome binding site）when the synthesis is being performed.
To make the parts established by genes satisfy the need of constructing the vector pSBIC3, we avoid the restriction enzyme cutting sites, which are EcoR Ⅰ, Xba I, Spe I, Pst I.
To lig ate genes directly to the standard vector, we add the restriction enzyme cutting sites of Xba Ⅰ and Spe Ⅰ to the upstream and downstream of target gene.
ATGTCTTGTGCTAGATCATACACTATCCCATTATCTTTTCCAAAGACATCTAATTCACCATTACAATTGAAAAATTTGTTACCATTTCCAGCTGCAAGATCAAGATTTTCTGTTAGAATGTCTACATCTTCATTACCAGTTGGTAACGAAGCATTGTTGAAGTACATCAGACAACCAGTTGTTTTGCCAACAGAAGAAGATGAATCAATTAAAAGAAGAGATTATTTGTTGGAAAAGACTGCAAGAAGATTAAGAACTTCTACAGGTTCAGTTGAAAAATTGAAATTGATCGATACTATCCAAAGATTAGGTATCGATTACTACTTGGAAGATGATATCAACGTTGTTTTGAGAAACGAATACTACAACGGTAGATCATCTGAAGAAGATTTGTTTACTACAGCTTTGAGATTCAGATTGTTGAGACATAACGGTTTCCAAATTTCTTCAGATGTTTTTATGAAGTTTAAAGATAAGAATGGTAAATTCAAGAAATGGATTGCTGAAGATACAATCGGTTTGTTATCTTTATACGAAGCATCTTACATGGGTGCACATGGTGAAAAGATTTTGGAAGAAGCTATGGAATTTTCAAGATCATTGTTGAAGAGATCATTGCCACAATTGCCACCAAAATTACATGGTCAAGTTGCTCAAGCATTAGAATTGCCAAGACATTTGAGAATGGCTAGATTGGAAGCAAGAAGATTTGTTCAACAATACGCTAAACAATCTGATTGTGATAGAGATTTGTTGAATTTGGCAACTTTGGATTACAATAAGGTTCAATTACAACATCAATTCGAATTGGCTGAAATCACTAGATGGTGGCAACAATTGGGTTTGGTTGAAAAATTGACATTTGCAAGAGATAGACCATTGGAATGTTTCTTGTGGACTGTTGGTTTGTTACCAGAACCAAGATACTCTACTTGTAGAATCGAAATGGCTAAGACAATTGCAATCTTGTTAGTTATTGATGATATCTTCGATACTTATGGTAAAATGGATGAATTGTTGTTGTTTACACAAGCTATCAGAAGATGGGATTTGGAAGCAATGGATATCTTGCCAGAATACATGAAAATTTGTTATATGGCTTTATACAATACTACAAACGAAATTTGTTACAAGGTTTTGAAATTGAACGGTTGGTCTGTTTTGTCATATTTGAAATCTACATGGATCGATATGATCGAAGGTTTTATGGTTGAAGCTAAATGGTTGAATGGTGGTGGTGCTCCAAATTTGGAAGAATACTTAGAAAACGGTGTTTCAACTGCTGGTGCATACATGGCTTTAGTTCATTTGTTTTTCTTGATCGGTGAAGGTGTTAACGATCAAAACGCACCATTATTGACTAAGAAACCATACCCAAAATTGTTTTCTGCTGCTGGTAGAATTTTAAGATTGTGGGATGATTTGGGTACTGCTAAAGAAGAACAAGAAAGAGGTGACGTTGCATCTTCAATCGAATTTGTTATGAGAGAAAAAGAAGTTGAATCAGAAGAAGAAGGTAGAAGATACATCTTGGGTGAAATATATGAATTGTGGAAAGATTTGAACGGTGAATTGATGTCTAAAAATGGTATGCCATTGGCTATTATTAAGGTTGCATTGAACATGGCTAGAGCATCACAAGTTGTTTACAAGCATGAAGAAGATACATACTTTTCTTCAGTTGATAACTACGTTGAAGCATTGTTTTTCACTCCATTGCCATCTTCTATTTGA
PcGES
CAI: 0.93
Fig. 2-1 The distribution of codon usage frequency along the length of the gene sequence. A CAI of 1.0 is considered to be perfect in the desired expression organism, and a CAI of > 0.8 is regarded as good, in terms of high gene expression level.
The information of this vector is the same as PdGES (above 1.2.1.1)
To obtain the target gene PcGES , using the specific primers to clone the target gene, we amplify the template is the vector pUC57 with PcGES through PCR.
The sequence of forward primer is: AAAAACAACTAATTATTCGAAGATGTCTTGTGCTAGATCAT
The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTCAAATAGAAGATGGCAAT
As shown is figure 1-3, we successfully cloned gene PcGES , because the size of PcGES shown on the picture matches with the theoretical size of PcGES which is 1734 bp.
Fig. 2-2 Electrophoresis of PcGES PCR product.
The left column is the marker, and the two strips on the right are PCR products of PcGES.
The sizes of the two strips are about 2000 bp.
The We try to ligate SpTPS1 gene into pPIC9K and pET32a vector, but after three trails, we failed to ligate the vector. The possible explanation is the condition of ligation is not suitable or the sequence of this gene. But we successfully ligated SpTPS1 gene with OYE and 2A in pPIC9K and pET32a vector, the specific information will be show the following text.(3.)
ATCTCTCTAATAATCATCTTCGTCAGCAGCAGCACAGCAGCAGCAGAAGAAAGTCATATATATATATATATCTTAGATTCATTTCAGTTCTAGATAAGAAGCAACAATGGCTGAAACTGGAACAGAAGGGACCGGGATCACCACCCTATTTTCTCCTTACAAAATGGGCAAGTTCAGCCTCTCCCACAGGGTGGTGCTGGCTCCCATGACTAGATGCAGAGCGTTGAACGGGATACCAAACGCAGCGCTGGTGGATTACTACACGCAGAGATCAACTCCCGGCGGATTTCTCATCACGGAAGGCACTCTGGTTTCCCCTACTGCCCCTGGGTTTCCTCATGTCCCTGGAATTTATACAGAAGAACAAGCGGAGGCATGGAAGAGGGTGGTGGATGCAGTTCATGCCAAAGGGAGCATCATATTCTGTCAATTATGGCATGTTGGCCGCGCATCTCATCAGGTTTATCAACCTAATGGAGCGCACCAATATCATCGACGGGCAAGGCCATCTCAAACAGATGGAGAATTCTCATGCCAGATGGATCATATGGGAAATACCCAACACCTAGGCCCTTGGAAACACCTGAAATACTAGAGGTAGTGAAGAATTATCGCCAGTCAGCCTTGAATGCCATTCGAGCAGGCTTTGATGGAATTGAGGTCCACGGGGCTCATGGTTACCTTATTGATCAATTCTTAAAAGACGGGATCAATGACCGAACAGATGAGTATGGTGGATCAATCAACAATCGATGCAGATTCCTAATGCAGGTGATTCAGGCAGTAGTTGCAGCTATTGGTGCTGATCGAGTTGGTTTCAGAATGTCACCGGCAATTGATCACCTAGATGCCATAGATTCTGATCCGCTCAACTTGGGTCTTGCTGTAATCGAGAGACTTAACAAACTTCAGTTGAACCTTGGATCAAAACTCACTTATCTCCATGTCACTCAGCCTCGCTACACAGCTTATGGCCAAACAGAATCAGGCAGACATGGTACTGAAGAAGAGGAAGCTAGATTAATGAGAACTTGGAGAAGGGCTTATAAGGGAACTTTCATCTGTAGCGGTGGGTTCACGAGGGAGCTAGGAATGGAAGCTATAGCTCAAGATGATGCAGATTTGGTATCTTATGGCCGACTTTTTATTTCAAACCCAGACTTAGTCTTGAGATTTAAGCTCAATGCGCCCTTGAATAAGTATGTCAGGAAAACATTCTACACCCAAGATCCTGTTGTTGGGTACACAGACTACCCATTTTTCAGAAAAGTAGACGGGAGCCAGGAGCCACGATCACGCCTTTGAATCTGTAGTCTTTGGAATAATTATACATGTATTTAAACATATGATATTTTGTTTGAACTTTATTATATCAGTGAACATCTTGATTAAAAGACAACATCCTCTAAGAAGAGGATTTTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
The information of this vector is the same as PdGES (above 1.2.1.1)
To obtain the target gene HbOYE, using the specific primers to clone the targeted gene，our team amplify the template is the vector pUC57 with HbOYE through PCR.
The sequence of forward primer is: TTTTATTTCAAACCCAGAC
The sequence of reverse primer is: GGTGGTGGTGCTCGAGTCTTTTAATTGATTCATCT
As shown is figure 1-3, we successfully cloned gene HbOYE, because the size of HbOYE shown on the picture matches with the theoretical size of HbOYE which is 1455 bp.
Fig. 3-1 Electrophoresis of HbOYE PCR products.
The left column is the marker, and the two strips on the right are PCR products of HbOYE.
The sizes of the two strips are about 1200 bp.
pET32a is a carrier of E.Coli of 5900bp. The promoter of pET32a is T7 and the resistance of pET32a is the Ampicillin. The information of this vector is the same as PdGES (above 1.3.2)
3.3.2 Ligation of HbOYE fragment to pET32a vector
we use the restriction endonuclease BamH I and Xho I to cut the E. Coli expression vector pET32a and make it ligated with HbOYE (1.2 kb), and the result has been shown positive through PCR.
Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the competent cell E. Coli complement cell DH5α, and the result of sequencing is 100% matched.
Fig. 3-2 Electrophoresis of HbOYE -contained pET32a vector.
The left column is the marker and the strips on the right are all the samples of combination of HbOYE and pFT32a. According to the graph, the size is between 1000 bp and 750 bp, so the result is positive.
pPIC9K is a carrier for the expression of protein in yeast of 9276bp. The promoter of pPIC9K is AOX1 and the resistance of pPIC9K is the Ampicillin. The information of this vector is the same as PdGES (above 1.3.1)
3.4.2 Ligation of HbOYE fragment to pPIC9K vector
We utilize restriction endonuclease Bam H I and NotI to cut the yeast expression vector PIC9K and make it ligated with HbOYE (about 1.2 kb), and the result has been shown positive through PCR.
Fig. 3-3 Electrophoresis of HbOYE -contained pPIC9K vector.
The left column is the marker and the strips on the right are all the samples of combination of HbOYE and pPIC9K. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.
To improve the efficiency of production while keeping the two proteins independent at the same time, we decide to combine OYE and GES together. It turns out that we choose 2A as a ‘bridge’ to link the two genes because the protein translated by 2A can be cut by certain enzymes automatically. 2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides contributes to form a torsion which causes the peptide chain to be released later, and then the two genes can express in a cell separately. Furthermore, we employ two kinds of 2A, which are F2A and P2A. By doing so, we can compare the efficiencies of them and choose one which is more efficient.
F2A sequence:
CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC
P2A sequence:
GGAAGCGGAGCGACGAATTTTAGTCTACTGAAACAAGCGGGAGACGTGGAGGAAAACCCTGGACCT
By using Net-PCR, we combine the HbOYE with 2A. 2A is a piece of peptide which can combine two genes together and be cut at 3’ prime end when the DNA is translated into mRNA. After being cut, the two genes can still perform their functions correctly in the latter steps. The picture of electrophoresis following shows the positive result of the combination. This product will be used in the final step of our experiment. Because of the function domain of GES is on the 3’ end，the 2A which can express 20 amino acids which may influence the function of GES protein, so we ligated OYE with 2A first, the ligate GES after 2A.
Fig. 3-4 Eelectrophoresis of HbOYE +2A -contained pPIC9K vector. The left column is the marker and the strips on the right are all the samples of combination of HbOYE and 2A. According to the graph, the size of HbOYE +2A is between 1000 bp and 2000 bp, so the result is positive.
Fig. 3-5 Eelectrophoresis of HbOYE+2A-contained pET32a vector. The M stands for the marker and the 1,2,3 stand for samples of combination of HbOYE and 2A. lane 1 and 2 is the HbOYE + F2A,3 stands for HbOYE + P2A. According to the graph, we use a part of sequence to measure, so the result is positive.
By using Net-PCR, we combine the previous product (HbOYE with 2A) and PcGES. The picture of electrophoresis following shows the positive result of the combination. This product is our final product of the whole experiments.
Fig. 3-6 Electrophoresis of HbOYE+2A+PcGES-contained pET32a vector.
Fig. 3-6 Electrophoresis of HbOYE+2A-contained pPIC9K vector. The left column is the marker and the strips on the right are all the samples of combination of HbOYE and 2A. According to the graph, the size is between 1000 bp and 750 bp, so the result is positive.
Fig. 3-7 Electrophoresis of HbOYE+F2A+PcGES-contained pPIC9K vector.
The M stands for the marker and the 1,2,3 stand for samples of combination of HbOYE +2A and PcGES. 1 and 2 is the HbOYE + F2A+PcGES, According to the graph, we use a part of sequence to measure, so the result is positive.
After ultrasonication, we used the SDS-PAGE electrophoresis to detect our target protein (HbOYE+F2A+GES2 and HbOYE+P2A+GES2), and the result showed that we succesfully produced our the recombinant protein (Fig ).
To make sure the expression of SmCPSI goes successfully with our instruments, we performed sonication on E.Coli cells and smashed them. Then we collect the supernatant fluid and protein to conduct the SDS protein electrophoresis. The size of HbOYE is about 1.2 Kb, and the encoding protein is about 44 KD; The size of PcGES is about 1.8 Kb, and the encoding protein is about 67 KD. There are about 22 KD fusion tags on the carrier skeleton of pET32a on the end N of HbOYE. F2A and P2A can cut the fusion protein into two parts and the each new protein will be about 67 KD which cannot be separated by electropherosis. The result of SDS-PAGE shows that the protein can be expressd fluently through our instruments with the induction of IPTG. The positive result meets our expectation.
ATGCCATTTGTTAAGGACTTTAAGCCACAAGCTTTGGGTGACACCAACTTATTCAAACCAATCAAAATTGGTAACAATGAACTTCTACACCGTGCTGTCATTCCTCCATTGACTAGAATGAGAGCCCAACATCCAGGTAATATTCCAAACAGAGACTGGGCCGTTGAATACTACGCTCAACGTGCTCAAAGACCAGGAACCTTGATTATCACTGAAGGTACCTTTCCCTCTCCACAATCTGGGGGTTACGACAATGCTCCAGGTATCTGGTCCGAAGAACAAATTAAAGAATGGACCAAGATTTTCAAGGCTATTCATGAGAATAAATCGTTCGCATGGGTCCAATTATGGGTTCTAGGTTGGGCTGCTTTCCCAGACACCCTTGCTAGGGATGGTTTGCGTTACGACTCCGCTTCTGACAACGTGTATATGAATGCAGAACAAGAAGAAAAGGCTAAGAAGGCTAACAACCCACAACACAGTATAACAAAGGATGAAATTAAGCAATACGTCAAAGAATACGTCCAAGCTGCCAAAAACTCCATTGCTGCTGGTGCCGATGGTGTTGAAATCCACAGCGCTAACGGTTACTTGTTGAACCAGTTCTTGGACCCACACTCCAATAACAGAACCGATGAGTATGGTGGATCCATCGAAAACAGAGCCCGTTTCACCTTGGAAGTGGTTGATGCAGTTGTCGATGCTATTGGCCCTGAAAAAGTCGGTTTGAGATTGTCTCCATATGGTGTCTTCAACAGTATGTCTGGTGGTGCTGAAACCGGTATTGTTGCTCAATATGCTTATGTCTTAGGTGAACTAGAAAGAAGAGCTAAAGCTGGCAAGCGTTTGGCTTTCGTCCATCTAGTTGAACCTCGTGTCACCAACCCATTTTTAACTGAAGGTGAAGGTGAATACAATGGAGGTAGCAACAAATTTGCTTATTCTATCTGGAAGGGCCCAATTATTAGAGCTGGTAACTTTGCTCTGCACCCAGAAGTTGTCAGAGAAGAGGTGAAGGATCCTAGAACATTGATCGGTTACGGTAGATTTTTTATCTCTAATCCAGATTTGGTTGATCGTTTGGAAAAAGGGTTACCATTAAACAAATATGACAGAGACACTTTCTACAAAATGTCAGCTGAGGGATACATTGACTACCCTACGTACGAAGAAGCTCTAAAACTCGGTTGGGACAAAAATTAA
The information of this vector is the same as PdGES (above 1.2.1.1)
To obtain the target gene ScOYE , using the specific primers to clone the targeted gene,we amplify the template is the vector pUC57 with HbOYE through PCR.
The sequence of forward primer is:AAAAACAACTAATTATTCGAAGATGCCATTTGTTAAGGACT
The sequence of reverse primer is: AGGCGAATTAATTCGCGGCGCTTTTTTGTCCCAACCG
As shown is figure 1-3, we successfully cloned gene ScOYE , because the size of ScOYE shown on the picture matches with the theoretical size of ScOYE which is 1203 bp.
Fig. 4-1 The picture of electrophoresis of ScOYE.
The left column is the marker, and the two strips on the right are PCR products of ScOYE.
The sizes of the two strips are more than 1000 bp.
We uses the restriction endonuclease BamH I and Xho I to cut the E. Coli expression vector pET32a and make it ligated with ScOYE, and the result has been shown positive through PCR.
Then we ligate the product with T4 vector for sequencing. Eventually, the product has been transformed into the E. Coli competent cell DH5α, and the result of sequencing is 100% matched.
Fig. 4-2 Electrophoresis of ScOYE -contained pET32a vector. The left column is the marker and the strips on the right are all the samples of combination of ScOYE and pET32a. According to the graph, the size is between 1000 bp and 2000 bp, so the result is positive.
We plan to striction endonuclease BamH I and NotI to cut the yeast expression vector PIC9K and make it ligated with ScOYE. Then combine the previous product (ScOYE with 2A) and PcGES. but the time is limitated.
