Introduction

The second mechanism we considered is number control. This is the intertwinement of the symbiont and host replication cycles. We believe this to be an imperative function of a healthy relationship between host and symbiont. In fact, the host cell is limited in size and it will be able to contain only a defined number of cells. Moreover, the exchange of nutrients also require a tightly regulated balance. For example, the mechanism of interdependency is based upon the providing of enough tryptophan to the host cell. This would not only depend on the production of amino acid per cell but also on the number of symbionts. Similarly, the symbionts won’t be able to directly access any resource not provided by the host cell. Hence, as in the financial market, a correct balance of consumer and producer must be kept to avoid our symbiotic relationship turning into a parasitic relationship. Number control can be seen as the New Deal of endosymbiosis.

Our vision is to use a modular system based on Clustered Regularly Inverted Short Palindromic Repeats interference (CRISPRi) technology to efficiently connect the symbiont cell replication cycle to the status of the endosymbiosis relationship. As a first step towards an automated number control system, we will investigate the control of cell replication through DNA replication inhibition and model the incorporation of a cell density based system - that is, a quorum sensing circuit - regulating the replication control mechanism.

Experiments

Overview

• General procedure
• Creation of working E. coli DH5-α strains:
• OD600 growth curve

General procedure

To obtain large quantities of our plasmids 3xFLAG-pdCas9 and pgRNA-bacteria we transformed them into E. coli mach1 using Mix&Go (Zymo Research). To verify each transformation we purified the plasmid with column purification, linearized with proper restriction enzyme (RE) digestion to avoid supercoiling, and ran the linearized product in 1% agarose gel electrophoresis.

Moreover, all the purified plasmids were sent for sequencing (Macrogen EZ-seq commercial service).

Creation of working E. coli DH5-α strains

The following commercially available plasmids from AddGene were selected for our experiment:

• 3xFLAG-dCas9/p-bacteria (Addgene #64325)
• pgRNA-bacteria (Addgene #44251)

The three seed sequences designed were inserted using PCR. Thus creating the new plasmids pgRNA1, pgRNA2, and pgRNA3.

We used the following primers for insertion of the seed sequences, where the underlined sequence is SpeI restriction site and the bold text is the seed sequence complementary to the E. coli DH5-α OriC.

• fw.sgRNA1 CCACTAGTGCACTGCCCTGTGGATAACAGTTTTAGAGCTAGAAATAGCAAG
• fw.sgRNA2 CCACTAGTTTGAGAAAGACCTGGGATCCGTTTTAGAGCTAGAAATAGCAAG
• fw.sgRNA3 CCACTAGTGATCATTAACTGTGAATGATGTTTTAGAGCTAGAAATAGCAAG
• rv.sgRNA GGACTAGTATTATACCTAGGACTGAG

After purification of the modified pgRNA plasmids, transformation of E. coli DH5-α was carried out using heat-shock protocol. And the following strains were obtained:

• E. coli DH5-α pdCas9;
• E. coli DH5-α pgRNA1;
• E. coli DH5-α pgRNA2;
• E. coli DH5-α pgRNA3;
• E. coli DH5-α pdCas9 pgRNA1;
• E. coli DH5-α pdCas9 pgRNA2;
• E. coli DH5-α pdCas9 pgRNA3.

Growth curve (OD₆₀₀)

The growth rate of the obtained strains was investigated in absence and presence of the dCas9 inductor tetracycline (tet) using absorbance measurements (protocol).

The strains E. coli DH5-α pdCas9, E. coli DH5-α pgRNA1, E. coli DH5-α pgRNA2, and E. coli DH5-α pgRNA3 cannot be considered proper negative control since they are cultivated with different antibiotics. Hence, three new negative control strain were designed and created:

• E. coli DH5-α empty pdCas9 (EpdCas9). That is, the pdCas9 plasmid with truncated dCas9 CDS using EcoRI restriction);
• E. coli DH5-α pdCas9 + pgRNA-bacteria (that is, the sgRNA scaffold without seed sequence);
• E. coli DH5-α EpdCas9 pgRNA-bacteria (we did manage to obtain this strain).

Moreover, considering that the stop of DNA replication is expected to cause cell enlargement (Wiktor et al., 2016) the OD600­ measurement results might altered by the cell size. To overcome this and other issues a new protocol was design.

However, the difference in growth observed was never significant. Hence, we decided to focus on the numerical model describing the Number Control project, where we also explored the integration of a quorum sensing circuit.

References