Difference between revisions of "Team:Bulgaria/Improve"

 
Line 1: Line 1:
−
{{Bulgaria}}
 
 
<html>
 
<html>
 +
<head>
 +
    <link href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css" rel="stylesheet" integrity="sha384-BVYiiSIFeK1dGmJRAkycuHAHRg32OmUcww7on3RYdg4Va+PmSTsz/K68vbdEjh4u" crossorigin="anonymous">
 +
    <link rel="stylesheet" href="https://cdnjs.cloudflare.com/ajax/libs/font-awesome/4.7.0/css/font-awesome.min.css">
 +
    <style>
 +
        #content, #bodyContent{
 +
            min-width: 1325px;
 +
        }
 +
        #bodyContent{
 +
            margin-top: -82px;
 +
        }
 +
        #firstHeading span{
 +
            display: none;
 +
        }
 +
        #home_logo, #sideMenu{
 +
            display: none;
 +
        }
 +
        .mynavbar {
 +
            overflow: hidden !important;
 +
            background-color:  #1AA55E !important;
 +
            font-family: Arial !important;
 +
        }
  
 +
        .mynavbar a {
 +
            float: left !important;
 +
            font-size: 14px !important;
 +
            color: white !important;
 +
            text-align: center !important;
 +
            padding: 14px 14px !important;
 +
            text-decoration: none !important;
 +
        }
  
−
<div class="column full_size judges-will-not-evaluate">
+
        .mydropdown {
 +
            float: left !important;
 +
            overflow: hidden !important;
 +
        }
  
 +
        .mydropdown .mydropbtn {
 +
            font-size: 14px !important;
 +
            border: none !important;
 +
            outline: none !important;
 +
            color: white !important;
 +
            padding: 14px 16px !important;
 +
            background-color: inherit !important;
 +
        }
  
−
<div class="column full_size">
+
        .mynavbar a:hover, .mydropdown:hover .mydropbtn {
−
<h1>Improve</h1>
+
            background-color: #0d522f  !important;
−
<p>For teams seeking to improve upon a previous part or project, you should document all of your work on this page. Please remember to include all part measurement and characterization data on the part page on the Regisrty. Please include a link to your improved part on this page.</p>
+
        }
  
−
<h3>Gold Medal Criterion #2</h3>
+
        .mydropdown-content {
−
<p><b>Standard Tracks:</b> Improve the function of an existing BioBrick Part. The original part must NOT be from your 2017 part number range. If you change the original part sequence, you must submit a new part. In addition, both the new and original part pages must reference each other. This working part must be different from the part documented in bronze #4 and silver #1.
+
            display: none !important;
 +
            position: absolute !important;
 +
            background-color: #f9f9f9 !important;
 +
            min-width: 160px !important;
 +
            box-shadow: 0px 8px 16px 0px rgba(0,0,0,0.2) !important;
 +
            z-index: 1 !important;
 +
        }
  
−
<br><br>
+
        .mydropdown-content a {
−
<b>Special Tracks:</b> Improve the function of an existing iGEM project (that your current team did not originally create) and display your achievement on your wiki.</p>
+
            float: none !important;
 +
            color: black !important;
 +
            padding: 12px 16px !important;
 +
            text-decoration: none !important;
 +
            display: block !important;
 +
            text-align: left !important;
 +
        }
  
 +
        .mydropdown-content a:hover {
 +
            background-color: #75c99e !important;
 +
        }
  
 +
        .mydropdown:hover .mydropdown-content {
 +
            display: block !important;
 +
        }
 +
 +
        .partners{
 +
            padding-top: 30px !important;
 +
        }
 +
 +
        .partners-title{
 +
            font-size: 32px !important;
 +
            letter-spacing: 15px !important;
 +
            font-weight: 300 !important;
 +
            text-transform: uppercase !important;
 +
            text-align: center !important;
 +
            padding: 40px !important;
 +
 +
        }
 +
 +
        .partner{
 +
            display: inline-block !important;
 +
            padding: 20px !important;
 +
        }
 +
 +
        .partner-logo{
 +
            max-width: 250px !important;
 +
            max-height: 250px !important;
 +
        }
 +
 +
        .partner-title{
 +
            text-transform: uppercase !important;
 +
        }
 +
 +
        p{font-size:large !important;}
 +
 +
    </style>
 +
</head>
 +
<body>
 +
<div class="container">
 +
    <div class=" mynavbar">
 +
 +
        <a href="https://2017.igem.org/Team:Bulgaria">Home</a>
 +
        <a href="https://2017.igem.org/Team:Bulgaria/team">Team</a>
 +
        <div class="mydropdown">
 +
            <button class=" mydropbtn">Project
 +
                <i class="fa fa-caret-down"></i>
 +
            </button>
 +
            <div class=" mydropdown-content">
 +
                <a href="https://2017.igem.org/Team:Bulgaria/description" style="border-bottom:1px solid black">Description</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/design" style="border-bottom:1px solid black">Design</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/experiments" style="border-bottom:1px solid black">Experiments</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/results" style="border-bottom:1px solid black">Results</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/contribution" style="border-bottom:1px solid black">Contribution</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/improve" style="border-bottom:1px solid black">Improve</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/second-project" style="border-bottom:1px solid black">Second project</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/Demonstrate" style="border-bottom:1px solid black">Demonstrate</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/lab-book" style="border-bottom:1px solid black">Lab book</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/protocols">Protocols</a>
 +
            </div>
 +
        </div>
 +
 +
        <div class=" mydropdown">
 +
 +
            <button class=" mydropbtn">Human Practices
 +
                <i class="fa fa-caret-down"></i>
 +
            </button>
 +
            <div class=" mydropdown-content">
 +
                <a href="https://2017.igem.org/Team:Bulgaria/HP/Silver" style="border-bottom:1px solid black">Silver</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/HP/Gold_Integrated" style="border-bottom:1px solid black">Gold</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/survey" style="border-bottom:1px solid black">Survey</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/public-engagement">Public Engagements</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/i-engineer" style="border-top:1px solid black">&nbsp; I, Engineer</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/fission-festival">&nbsp; Fission festival</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/international-workshop-innovation-corner">&nbsp; International workshop Innovation corner</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/sofia-science-festival">&nbsp; Sofia science festival</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/researchers-night" >&nbsp; The European Researchers’ Night</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/bloomberg-tv-bulgaria">&nbsp; Bloomberg TV Bulgaria</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/bnt1-tv-bulgaria">&nbsp; BNT1 TV Bulgaria</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/agar-art-bulgaria">&nbsp; Agar Art - Bulgaria</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/bg-science-magazine" style="border-bottom:1px solid black">&nbsp; BG Economics Magazine</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/project-yana" style="border-bottom:1px solid black">Project Yana</a>
 +
                <a href="https://2017.igem.org/Team:Bulgaria/project-vyara">Project Vyara</a>
 +
            </div>
 +
        </div>
 +
 +
        <div class=" mydropdown">
 +
            <button class=" mydropbtn">Achievements
 +
                <i class="fa fa-caret-down"></i>
 +
            </button>
 +
            <div class=" mydropdown-content">
 +
                <a href="https://2017.igem.org/Team:Bulgaria/parts" >Parts</a>
 +
            </div>
 +
        </div>
 +
        <a href="https://2017.igem.org/Team:Bulgaria/Collaborations">Collaborations</a>
 +
        <a href="https://2017.igem.org/Team:Bulgaria/safety">Safety</a>
 +
        <a href="https://2017.igem.org/Team:Bulgaria/Attributions">Attributions</a>
 +
 +
    </div>
 +
 +
 +
<br>
 +
<br>
 +
<div class="row">
 +
    <div class="col-md-12">
 +
        <h1 style="color:#1AA55E; font-family: Comic sans MS;"> Improve </h1>
 +
        <br>
 +
      <h3>
 +
          <b>Bronze medal contribution</b>
 +
      </h3>
 +
        <p><br />
 +
 +
 +
            We improved Part Part:BBa_K145201 (INPUT TetR generator). Initially we designed an expression construct, composed by parts BBa_K145201 and BBa_K081012(GFP Generator). When we expressed this construct in the high copy number vector pSB1C3, we found that a significant basal level of GFP expression can be detected without adding an inducer. This is present on the picture given below (left tube - no induction, right tube - induction with tetracycline).<br /><br />
 +
 +
 +
 +
  <a href="https://imgur.com/3shbtjA"><img src="https://i.imgur.com/3shbtjA.jpg" title="source: imgur.com" /></a>
 +
<br /><br />
 +
 +
 +
A careful sequence analysis reviled that a LVA-like degradation tag exists in the reading frame of TetR in BBa_K145201. Moreover, the J23116 promoter is in the same orientation as the downstream expression unit. Indeed, they are separated by a transcription terminator but it is known that no terminator is a 100% effective.<br /><br />
 +
 +
To improve this part, we used a PCR based approach, using BBa_K145201 as matrix. The resulting new part (BBa_K2515003) was  cloned in pSB1C3 and submitted to the registry. Our new part has TetR without a degradation tag and is in inverted orientation compared to the original one. Thanks to that the basal uninduced expression levels can be lowered.
 +
<br /><br />
 +
See our new part <a href="http://parts.igem.org/Part:BBa_K2515003">here</a>.
 +
 +
<br /><br />
 +
 +
 
 +
        </p>
 +
 +
        <h3>
 +
            <b> Gold Medal Criterion #2</b>
 +
        </h3>
 +
        <p><br /><br />
 +
            We offer a strategy for improvement of part J23102. We selected this Anderson promoter since the Anderson promoter family is among the most used parts available on the iGEM registry. Having in mind the large number of composite parts that contain an Anderson promoter, we though that it will be very useful if one can control the promoter activity without need of subcloning. To achieve such type of regulation, we decided to use our system for CRISPRi. We designed 2 gRNAs that target this promoter (TTGACAGCTAGCTCAGTCCT and TAGTAGCTAGCACAGTACCT) and cloned them into our gRNA expression vector (Part:BBa_K2515002). These constructs gave us the ability to control the J23102 promoter activity in a strain with dCas9 unther the control of an inducible arabinose promoter. In this way one can control the Anderson promoter activity via adding L-arabinose to the media. No matter that we selected J23102 for our experiments, we believe that this type of regulation can be transferred to any other member of this promoter family if one redesign the gRNAs.
 +
        </p>
 +
 +
    </div>
 
</div>
 
</div>
 +
 
 +
</div>
 +
<br> <br> <br>
 +
    <br> <br> <br>
 +
 +
 +
    <footer id = "footer">
 +
        <div id="images" class="partners">
 +
 +
            <div class="row">
 +
                <div class="col-md-12 text-center">
 +
                    <h2 style="font-family: Times New Roman">
 +
                        Our Partners
 +
                    </h2>
 +
                </div>
 +
            </div>
 +
            <br><br>
 +
            <div class="row text-center">
 +
                <div class="col-md-4">
 +
                    <a href="https://www.uni-sofia.bg/">
 +
            <span class="partner">
 +
                <img src="https://static.igem.org/mediawiki/2016/2/29/Su-logo2.png"
 +
                      style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
                <div class="col-md-4">
 +
                    <a href="https://www.venusconcept.com/">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/nX3mgLX.png"
 +
                      style="width: 320px; margin-top: -45px;">
 +
            </span>
 +
 +
                    </a>
 +
                </div>
 +
 +
                <div class="col-md-4">
 +
                    <a href="bulmed.bg/">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/vNa55DS.png"
 +
                      style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
 +
            </div>
 +
 +
            <!-- 2 -->
 +
 +
 +
 +
            <div class="row text-center">
 +
                <div class="col-md-4">
 +
                    <a href="mu-sofia.bg">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/B1HvUKI.png"
 +
                    style=" width: 180px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
 +
                <div class="col-md-4">
 +
                    <a href="http://sofiatech.bg/">
 +
            <span class="partner">
 +
                <img src="https://static.igem.org/mediawiki/2016/6/65/Tech-park-logo.png"
 +
                    style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
                <div class="col-md-4">
 +
                    <a href="https://students.uni-sofia.bg/">
 +
            <span class="partner">
 +
                <img src="https://static.igem.org/mediawiki/2016/9/9e/Su-logo3.png"
 +
                    style="width: 320px;">
 +
            </span>
 +
 +
                    </a>
 +
                </div>
 +
 +
            </div>
 +
 +
            <!-- 3 -->
 +
 +
 +
            <div class="row text-center">
 +
 +
                <div class="col-md-4">
 +
                    <a href="http://www.neb-online.fr/">
 +
            <span class="partner">
 +
                <img src="http://www.neb-online.fr/wp-content/uploads/neb_logo_409.png"
 +
                    style=" width: 300px;margin-top: -40px;">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
 +
                <div class="col-md-4">
 +
                    <a href="https://www.thermofisher.com/">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/RC4pMPf.png"
 +
                    style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
                <div class="col-md-4">
 +
                    <a href="http://www.neb-online.fr/">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/NpIrZfq.png"
 +
                    style="width: 320px;">
 +
            </span>
 +
 +
                    </a>
 +
                </div>
 +
 +
            </div>
 +
 +
            <!-- 4 -->
 +
 +
            <div class="row text-center">
 +
                <div class="col-md-4">
 +
                    <a href="http://tu-sofia.bg/">
 +
            <span class="partner">
 +
                <img src="https://static.igem.org/mediawiki/2016/9/97/Tu-logo.png"
 +
                      style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
  
 +
                <div class="col-md-4">
 +
                    <a href="http://www.vipcatering.bg/">
 +
            <span class="partner">
 +
                <img src="http://www.vipcatering.bg/images/logo_client222432/images/clients/npss.png?v4"
 +
                    style=" width: 320px; ">
 +
            </span>
 +
                    </a>
 +
                </div>
 +
                <div class="col-md-4">
 +
                    <a href="https://www.idtdna.com/">
 +
            <span class="partner">
 +
                <img src="https://i.imgur.com/0x1tYBf.png"
 +
                    style="width: 320px;">
 +
            </span>
  
 +
                    </a>
 +
                </div>
  
 +
            </div>
 +
        </div>
 +
    </footer>
 +
</body>
 
</html>
 
</html>

Latest revision as of 02:48, 2 November 2017

Home Team
Description Design Experiments Results Contribution Improve Second project Demonstrate Lab book Protocols
Silver Gold Survey Public Engagements   I, Engineer   Fission festival   International workshop Innovation corner   Sofia science festival   The European Researchers’ Night   Bloomberg TV Bulgaria   BNT1 TV Bulgaria   Agar Art - Bulgaria   BG Economics Magazine Project Yana Project Vyara
Parts
Collaborations Safety Attributions


Improve


Bronze medal contribution


We improved Part Part:BBa_K145201 (INPUT TetR generator). Initially we designed an expression construct, composed by parts BBa_K145201 and BBa_K081012(GFP Generator). When we expressed this construct in the high copy number vector pSB1C3, we found that a significant basal level of GFP expression can be detected without adding an inducer. This is present on the picture given below (left tube - no induction, right tube - induction with tetracycline).



A careful sequence analysis reviled that a LVA-like degradation tag exists in the reading frame of TetR in BBa_K145201. Moreover, the J23116 promoter is in the same orientation as the downstream expression unit. Indeed, they are separated by a transcription terminator but it is known that no terminator is a 100% effective.

To improve this part, we used a PCR based approach, using BBa_K145201 as matrix. The resulting new part (BBa_K2515003) was cloned in pSB1C3 and submitted to the registry. Our new part has TetR without a degradation tag and is in inverted orientation compared to the original one. Thanks to that the basal uninduced expression levels can be lowered.

See our new part here.

Gold Medal Criterion #2



We offer a strategy for improvement of part J23102. We selected this Anderson promoter since the Anderson promoter family is among the most used parts available on the iGEM registry. Having in mind the large number of composite parts that contain an Anderson promoter, we though that it will be very useful if one can control the promoter activity without need of subcloning. To achieve such type of regulation, we decided to use our system for CRISPRi. We designed 2 gRNAs that target this promoter (TTGACAGCTAGCTCAGTCCT and TAGTAGCTAGCACAGTACCT) and cloned them into our gRNA expression vector (Part:BBa_K2515002). These constructs gave us the ability to control the J23102 promoter activity in a strain with dCas9 unther the control of an inducible arabinose promoter. In this way one can control the Anderson promoter activity via adding L-arabinose to the media. No matter that we selected J23102 for our experiments, we believe that this type of regulation can be transferred to any other member of this promoter family if one redesign the gRNAs.