Team:Bulgaria/improve
Improve
Bronze medal contribution
We improved Part Part:BBa_K145201 (INPUT TetR generator). Initially we designed an expression construct, composed by parts BBa_K145201 and BBa_K081012(GFP Generator). When we expressed this construct in the high copy number vector pSB1C3, we found that a significant basal level of GFP expression can be detected without adding an inducer. This is present on the picture given below (left tube - no induction, right tube - induction with tetracycline).
A careful sequence analysis reviled that a LVA-like degradation tag exists in the reading frame of TetR in BBa_K145201. Moreover, the J23116 promoter is in the same orientation as the downstream expression unit. Indeed, they are separated by a transcription terminator but it is known that no terminator is a 100% effective.
To improve this part, we used a PCR based approach, using BBa_K145201 as matrix. The resulting new part (BBa_K2515003) was cloned in pSB1C3 and submitted to the registry. Our new part has TetR without a degradation tag and is in inverted orientation compared to the original one. Thanks to that the basal uninduced expression levels can be lowered.
See our new part here.
Gold Medal Criterion #2
We offer a strategy for improvement of part J23102. We selected this Anderson promoter since the Anderson promoter family is among the most used parts available on the iGEM registry. Having in mind the large number of composite parts that contain an Anderson promoter, we though that it will be very useful if one can control the promoter activity without need of subcloning. To achieve such type of regulation, we decided to use our system for CRISPRi. We designed 2 gRNAs that target this promoter (TTGACAGCTAGCTCAGTCCT and TAGTAGCTAGCACAGTACCT) and cloned them into our gRNA expression vector (Part:BBa_K2515002). These constructs gave us the ability to control the J23102 promoter activity in a strain with dCas9 unther the control of an inducible arabinose promoter. In this way one can control the Anderson promoter activity via adding L-arabinose to the media. No matter that we selected J23102 for our experiments, we believe that this type of regulation can be transferred to any other member of this promoter family if one redesign the gRNAs.
