BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

BBa_K525998

BBa_K624004

BBa_K863200

BBa_K543020

BBa_K731721

Plasmid Isolation

Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.

INSERT GEL IMAGES

PCRs

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template	BBa_K525998 (T7 promoter+RBS)
Forward primer	gactaccacggcatgatgaacctgaatcgc
	Amplifies the CmR gene, includes NcoI site
Reverse primer	gaattcAAGCTTtttctcctctttccctatagtgagtcg
	Adds HindIII site downstream
Amplicon size	886 bp

PCR 2 — T7 Expression Backbone (Piece 2)
Template	BBa_K731721 (T7 terminator)
Forward primer	gtatcacgaggcagaatttcag
	Keeps the NheI site
Reverse primer	gagaatatgtttttcgtctcagcc
	Splits the CmR gene, includes NcoI site
Amplicon size	1533 bp

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template	BBa_K1321337 (sfGFP in Freiburg format)
Forward primer	gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
	Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer	gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
	Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size	753 bp

PCR 4 — SpyCatcher
Template	BBa_K1650037 (SpyCatcher)
Forward primer	GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
	Adds BamHI and Gly-Ser-Ser upstream
Reverse primer	gacgtcGCTAGCTTAaatatgagcatcgcccttgg
	Adds stop codon (TAA) and NheI site downstream
Amplicon size	450 bp

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template	BBa_J18932 (mCherry RFP)
Forward primer	CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
	Adds 5xHis upstream
Reverse primer	cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
	Adds stop codon (TAA) and NheI site downstream
Amplicon size	735 bp

PCR 6 — mCherry
Template	Product of PCR5
Forward primer	aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
	Adds HindIII, a start codon (ATG) and His upstream
Reverse primer	cgtatgGCTAGCTTATTTATACAG
	Keeps stop codon (TAA) and NheI site downstream
Amplicon size	753 bp

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template	BBa_J18932 (mCherry RFP)
Forward primer	CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
	Adds 5xHis upstream
Reverse primer	accgatGGATCCtttatacagttcatccatgccg
	Adds BamHI site downstream
Amplicon size	732 bp

Restriction Digests

Restriction digests for T7 expression backbone

Digest 1: Double-digest PCR1 product with NcoI and HindIII

Digest 2: Double-digest PCR2 product with NheI and NcoI

Restriction digests for sfGFP-SpyCatcher

Digest 3: Double-digest PCR3 product with HindIII and BamHI

Digest 4: Double-digest PCR4 product with BamHI and NheI

Restriction digest for 6xHis-mCherry

Digest 5: Double-digest PCR6 product with HindIII and NheI

Restriction digests for mCherry-SpyTag

Digest 6: Double-digest Oligo 1 with HindIII and NdeI

Digest 7: Double-digest PCR7 product with NdeI and BamHI

Digest 8: Double-digest Oligo 2 product with BamHI and NheI

Restriction enzymes used in our assembly
Restriction Enzyme	Sequence	Activity in NEBuffers (%)				Incubation temperature	Heat inactivation
		1.1	2.1	3.1	CutSmart
AgeI	A\CCGGT	100	75	25	75	37°C	65°C
AgeI-HF	A\CCGGT	100	50	10	100	37°C	65°C
BamHI	G\GATCC	75*	100*	100	100*	37°C	—
BamHI-HF	G\GATCC	100	50	10	100	37°C	—
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
NcoI	C\CATGG	100	100	100	100	37°C	80°C
NcoI-HF	C\CATGG	50	100	10	100	37°C	80°C
NdeI	CA\TATG	75	100	100	100	37°C	65°C
NheI	G\CTAGC	100	100	10	100	37°C	65°C
NheI-HF	G\CTAGC	100	25	10	100	37°C	80°C
* denotes star activity

Multi-Ligation

Ligating sfGFP-SpyCatcher

Ligating mCherry-SpyTag

Screening Transformants