Team:UCopenhagen/Parts

P A R T S

Guide RNA (gRNA)

  • 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
  • 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
  • 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)

Name Type Type Designer Length
BBa_K2455000 Basic Part His-tagged AroG gene from E. coli MG1655 1092
BBa_K2455001 Basic Part His-tagged TrpE gene from E. coli MG1655 1602
BBa_K2455002 Basic Part (Improvement of old) R9-SYFP2-6His 804
BBa_K2455003 Basic Part Nona-Arginine with his-tag 81
BBa_K2455004 Basic Part YddG E. coli Tyr, Trp, Phe exporter 885
BBa_K2455005 Basic Part (Improvement of old - Illegal) R9-mTag BFP-6His 786
BBa_K2455007 Basic Part (Composite) YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001) 2513
BBa_K2455008 Basic Part (Composite) YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) 2005

Find Incell here: