Http : //2017.igem.org/Team : AHUT China/Notebook

AHUT

This part consists of 2 parts: the first round is from May 15th to September 17th, and the second one is from then to October 14th.

2017.5.15:

2017.5.19:

Morning:
The first amplification of error-prone PCR:
Added the following ingredients in turn in 30μL system:

put the system into the PCR and set the param:

Afternoon:
agarose gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3.Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
Be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores ：

6.Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
7. Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.

2017.5.23:

The second amplification of error-prone PCR
made three 30μL systems and put the following ingredients into them:

System 1 took the sample of the first PCR
System 2 took the self-provided template
System 3 took the self-provided template
PCR primer
1. System 1: added 1μL Rna and Fna respectively
2. System 2: added 1μL Prefix and Rna respectively
3. System 3: added 1μL Suffix and Fna respectively
Taq deoxyribonucleic acid polymerase （5U/μL） 2μL
put the system into the PCR and set the param:

agarose gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

2017.5.27:

Gel extraction:
1.First, took three devoid of nucleic acid and 1.5ml centrifuge tube contaminated by nuclease, and heated the water bath to 75℃
2. Cut the agarose gel shangles that containing target DNA under the ultraviolet lamp, and sucked the liquid on gel surface with paper towel and chopped it up. Then put them into three centrifuge tubes respectively and weighed them on the scale.
Centrifuge tube 1:(Rna and Fna) the weight of gels were 60mg
Centrifuge tube 2:(PrefixF and Rna) the weight of gels were 94mg
Centrifuge tube 3:(SuffixR and Fna) the weight of gels were 80mg
3. Added Buffer DE-A of three gels volumes into three centrifuge tube respectively, and heated them at 75℃ when mixed well,mixed them discontinuously(every 2-3min), until the gels were completely dissolved(about 6-8min).
4. Added Buffer DE-B of 0.5 Buffer DE-A volume（150μL）and mixed them well, and DNA fragments of this experiemnt were less than 400bp, adding isopropyl alcohol of one gel volume（100μL）was needed.(The mixture which had added Buffer DE-B turned into yellow, and it turned into yellow homogeneous solution after fully mixed)
5.Transfer the mixed liquid from the centrifuge tube to the DNA preparation tube(to 2ml centrifuge tube), and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
6. Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
7.Put preparation tube back to 2ml centrifuge tube, added centrifuge tube, centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate. And used the same method again to wash it with Buffer W2,and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
8.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
9. Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 1min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube,volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Remade Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

The third amplification of error-prone PCR
made three 30μL systems and put the following ingredients into them

System 1: cut and recycled sample 1.
System 2: cut and recycled sample 2.
System 3: cut and recycled sample 3.
PCR primer
1. System 1: added 1μL Rna and Fna respectively
2.System 2: added 1μL Prefix and Rna respectively
3. System 3: added 1μL Suffix and Fna respectively
And added Tap deoxyribonucleic acid polymerase（5U/μL）2μL in all the systems respectively
put the system into the PCR and set the param

2017.5.31:

Morning:
Remade Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

Afternoon:
PS: The results of the experiment in the morning were not good, which may due to:
(1) Self-provided DNA template contained a higher concentration, so it was diluted and PCR was redone again.
(2) Temperature affected the experimental results, so there was a gradient setting on the annealing temperature of PCR.
First, diluted self provided template from （1:10）to （1:1000）:
Added 99μL ultrapure water to the centrifuge tube, then added 1μL self provided template(1:10) and diluted it to (1:1000).
The fourth amplification of error-prone PCR:
made two 30μL systems and added the following ingredients

PCR primer:
1. Centrifuge 1: added 1μL Rna and Fna respectively.
2. Centrifuge 2: added 1μL Rna and Fna respectively. And added 1μLTaq deoxyribonucleic acid polymerase（5U/μL）to centrifuge tubes respectively.
put the system into the PCR and set the param

centrifuge tube 1 52.8℃ centrifuge tube56.0℃
Remade Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores

2017.6.4:

Remade Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores

2017.6.8:

First, diluted self provided template from （1:1000）to （1:50000）:
Added 98μL ultrapure water to the centrifuge tube, then added 2μL self provided template(1:1000) and diluted it to (1:50000).
The fifth amplification of error-prone PCR made two 30μL systems and added the following ingredients

PCR primer
1.Centrifuge 1: added 1μL Rna and Fna respectively.
2. Centrifuge 2: added 1μL Rna and Fna respectively. And added 1μLTaq deoxyribonucleic acid polymerase（5U/μL）to centrifuge tubes respectively. put the system into the PCR and set the param

centrifuge tube 1 52.8℃ centrifuge tube56.0℃
Made Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores

2017.6.12:

The sixth amplification of error-prone PCR:
made two 30μL systems and added the following ingredients

2017.6.15:

Achievedcut and recycle of gels:
1.First, took two devoid of nucleic acid and 1.5ml centrifuge tube contaminated by nuclease, and heated the water bath to 75℃
2. Cut the agarose gel shangles that containing target DNA under the ultraviolet lamp, and sucked the liquid on gel surface with paper towel and chopped it up. Then put them into three centrifuge tubes respectively and weighed them on the scale.
Centrifuge tube 1:(Rna and Fna) the weight of gels were 83mg
Centrifuge tube 2:(Fna and Rna) the weight of gels were 79mg And the gels in the centrifuge tube 1 and 2 were transferred to the same centrifuge tube with forceps.
3. Added Buffer DE-A of three gels volumes into three centrifuge tube respectively, and heated them at 75℃ when mixed well,mixed them discontinuously(every 2-3min), until the gels were completely dissolved(about 6-8min).
4. Added Buffer DE-B of 0.5 Buffer DE-A volume（250μL）and mixed them well, and DNA fragments of this experiemnt were less than 400bp, adding isopropyl alcohol of one gel volume（166μL）was needed.(The mixture which had added Buffer DE-B turned into yellow, and it turned into yellow homogeneous solution after fully mixed)
5.Transfer the mixed liquid from the centrifuge tube to the DNA preparation tube(put the preparation tube in 2ml centrifuge tube), and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
6. Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
7.Put preparation tube back to 2ml centrifuge tube, added centrifuge tube, centrifuged for 1 min at 13550r/min speed. Then abandoned the filtrate,and used the same method again to wash it with Buffer W2,and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
8.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
9. Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 1min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Made Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.application of sample: added the following ingredients to two gels pores

Diluted the Start, End and Path that had been cut and recycled to (1:100000), and used PCR once again:
First added 99μl ddH2O+1μl samples into three centrifuge tubes(diluted the Start,End and Path in 100 times), then added 18μl ddH2O +2μl samples which had been diluted in 100 times into another three centrifuge tubes(at this time,diluted the Start,End and Path in 1000 times).Finally, added 99μl ddH2O+1μl samples that had been diluted in 1000 times into another three centrifuge tubes(diluted Start, End, and Path in 100000 times).
The seventh amplification of error-prone PCR:
made two 30μL systems and added the following ingredients

Centrifuge 1: cut and recycled the templates (Rna and Fna of PCR)
Centrifuge 2: cut and recycled the templates (SuffixR and Fna of PCR)
Centrifuge 3: cut and recycled the templates (PrefixF and Rna of PCR)
PCR primer
Centrifuge 1: added 1μL Rna and Fna respectively.
Centrifuge 2: added 1μL SuffixR and Fna respectively.
Centrifuge 3: added 1μL PrefixF and Rna respectively.
And added 1μLTaq deoxyribonucleic acid polymerase（5U/μL）to centrifuge tubes
respectively.
put the system into the PCR and set the param

Made Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores

2017.6.19:

6.Electrophoresis: Turn on the power of electrophoresis voltage Us=100V electrical current Is=399mA time Ts=3:30
7. Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under Ultraviolet fluoroscopy.

Achievedcut and recycle of gels:
1.First, took two devoid of nucleic acid and 1.5ml centrifuge tube contaminated by nuclease, and heated the water bath to 75℃
2. Cut the agarose gel shangles that containing target DNA under the ultraviolet lamp, and sucked the liquid on gel surface with paper towel and chopped it up. Then put them into three centrifuge tubes respectively and weighed them on the scale.
Centrifuge tube 1:(Rna and Fna) the weight of gels were 109 mg
Centrifuge tube 2:(SuffixR and Fna) the weight of gels were 80 mg
Centrifuge tube 3:(PrefixF and Rna) the weight of gels were 69 mg
3. Added Buffer DE-A of three gels volumes into three centrifuge tube respectively, and heated them at 75℃ when mixed well,mixed them discontinuously(every 2-3min), until the gels were completely dissolved(about 6-8min).
4. Added Buffer DE-B of 0.5 Buffer DE-A volume（250μL）and mixed them well, and DNA fragments of this experiemnt were less than 400bp, adding isopropyl alcohol of one gel volume（166μL）was needed.(The mixture which had added Buffer DE-B turned into yellow, and it turned into yellow homogeneous solution after fully mixed)
5.Transfer the mixed liquid from the centrifuge tube to the DNA preparation tube(to 2ml centrifuge tube), and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
6. Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
7.Put preparation tube back to 2ml centrifuge tube, added centrifuge tube, centrifuged for 1 min at 13550r/min speed. Then abandoned the filtrate,and used the same method again to wash it with Buffer W2,and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
8.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
9. Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 1min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Made Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.application of sample: added the following ingredients to two gels pores

2017.6.23(did the experiment of"Bypaass Reaction" in PCR ):

Tooktwo tubes of PCR, and made the same system of 50μL, then added the
following materials:

Finally, added hi-fi 0.8μl Tap DNA polymerase into all systems respectively.
put the system into the PCR and set the param

2017.6.27(recycled and repaired the DNA gaps):

The two tubes of the same samples after PCR were merged into one tube and did recycling experiments (supposed the samples were 100μl):
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(300μl ) into it.
2.Then added Buffer DE-B(150μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate,
and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
7. Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Did repairing gap reaction in PCR
Added the following materials into a PCR tube（10μl system)

Param setting： 16℃ forever P
ut it into biochemical incubator after half an hour(16℃） for reserved

2017.6.30:(repaired the gap)

Did repairing gap reaction in PCR
Added the following materials into a PCR tube（20μl system)

Param setting： 16℃ forever
Put it into biochemical incubator after half an hour(16℃）

2017.7.4：

Recycled the samples after PCR(added 40μl water into 10μl sample, and in all was 50μl):
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(300μl ) into it.
2.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate,
and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
PCR amplification (amplified the samples that had been repaired in Bypass Reaction):
Added the following materials into two tubes of 50μL system

put the system into the PCR and set the param

Gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

2017.7.8：

Did recycle experiments of all the samples after PCR:
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(300μl ) into it.
2.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate,
and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
The collocation of medium (divided into 3 bottles of liquid nutrient medium and one bottle of solid medium):
Took a 1000ml beaker, and added 760ml deionized water, then began to dissolve it after adding the following materials tripton 8g yeast extract 4g NaCl 4g
Stirred the liquid until the solid was completely dissolved, and added 5mol/L NaOH（160μl) and adjusted pH to 7.0, then used deionized water in constant volume of 800 ml.
Divided the prepared solution into 4 bottles (every bottle was about 200ml), added 3g agar powder to one of the bottles to make solid medium, and the others were made into liquid nutrient medium. Put the well-prepared medium and culture dish that needed to be sterilized to High-Pressure Steam Sterilization Pot to sterilize.
Plate smearing method
1.Before using Bechtop, turned on UV lamp of Bechtop at least for 30 min to sterilize;
2.Turned on the blower and lamp while using Bechtop, and turned off UV sterilamp and sterilized hands and arms, etc.
3.Opened the lid of the pot, and put the medium in conical flask into sterile culture dish which had been sterilized while it was still hot (agar was not congealed at 50℃) on the Bechtop. Put the triangular flask that contained culture dish next to the fire, and opened the breathable film and let the mouth face to the fire. Put the culture dish with the left hand and covered the flame with the dish.(The method of holding dish: Used ring finger and little finger to hold the bottom, used thumb and middle finger to hold the lid so that it was conveninent to open and cover the lid with thumb. Before operation, practiced this action until skillful enough.) Put culture dish about 15mL into it quickly through a slot. Covered the dish and shaked it sightly to make the medium was evenly distributed at the bottom of the culture dish, and then placed it on the desktop. After solidification, made them into plate for inoculation of bacteria.

2017.7.12：

Enzyme digestion (made up three 50μl systems for enzyme digestion): addded the following materials into three PCR tubes

37℃ heating for 3 hours with water bath
recycled DNA fragment:
Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(150μl ) into it.
2.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate,
and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

Connection（made up two 20μl systems to connect）：
Addedthe following materials into PCR tube

37℃ heating for 3 hours with water bath

2017.7.16：

Inversion (the recombinant vectors were introduced into escherichia coli):
Took out four clean 1.5ml centrifuge tubes ont the bechtop and added the following materials:
Tube 1：DH 5αcompetent cell 50μl
Tube 2：DH 5αcompetent cell 50μl
Tube 3：DH 5αcompetent cell 50μl+ Fa1and Rz1 linking carrier 10μl
Tube 4：DH 5αcompetent cell 50μl+ Fa2 and Rz2linking carrier 10μl ice-bath for 30min 42℃ heat engine for 90s ice-bath for 2min again
Then added 300μl LB liquid medium to every tube（no chloramphenicol）
Then put it to37℃、220r/min table concentrator 45min
spread plate(the operation was on the bechtop):
1.Took out four sterile culture media and the marks. Medium 1 (no chloramphenicol), Medium 2 (contained sugar), Medium 3 (contained chloramphenicol), Medium 4 (contained chloramphenicol).
2.Soaked the spreader in an beaker full of beaker (every time after the bacteria had been spread, this action was needed).
3.Added the bacteria solution of centrifuge tubes into the surface of the corresponding media: The solution of Tube 1 was added to the Medium 1, the solution of Tube 2 was added to the Medium 2,the solution of Tube 3 was added to the Medium 3,the solution of Tube 4 was added to the Medium 4.
4.Ignited the spreader which had a little amount of alcohol with the fire. When the alcohol was burned out, cooled it for 8~10s.
5.The bacterial solution was evenly coated on the surface of the medium with spreader, rotated the culture dish so that the solution can be coated evenly.(Attention: Soaked the end of spreader in an beaker full of the volume fraction of seventy percent ethanol. When took it out, let the extra ethanol drop in the beaker, then ignited the spreader which had a little amount of ethanol with the fire.)
6.After the bacteria had been coated, leaving to rest for 5 minutes.
Put the four media that had had bacterination to 37℃ biochemical incubator for culture.

2017.7.20：

1.Selelcted the escherichia coli and enlarged cultur:（the operation was on the bechtop）
2.Took out the inoculated culture dish and observed the distribution of the flora.

3.Made up 35μl/ml chloramphenicol: first added 50mg/ml chloramphenicol 35μl to 50ml centrifuge tube, and had constant volume of LB culture medium, then mixed them together.
4.Prepared 8 centrifuge tubes that had been sterilized (marked with 1，2，3，4，5，6，7，8), and added about 2500μl LB medium + chloramphenicol respectively. Then used 10μl needles to select floras (only pick one flora) in culture dish one by one, and put both the floras and needles into eight 15ml centrifuge tubes that contained solution.

2017.7.24：

Had enzyme digestion to the isolated plasmid,extracted the target gene 10XNEB buffer 2.5μl X 8.5 21.25μl BSA(0.1％)0.25μlX8.5 2.225μl ECOR1-HF 0.5μlX 8.54.25μl p5t-1 0.5μl X8.5 4.25μl DDW 15μl X 8.5 127.5μl
added 18.75μl to every tube, and added 6.25μl plasmid for supplement Put the tubes into PCR instrument for 3 hours for enzyme digestion

2017.7.28：

Electrophoresis experiment
1.DL 15000 5μl
2.DL 20000 5μl
3.（production 1）9μl＋1μl loding buffer
4.(production 2)9μl＋1μllodingbuffer
5.(production 3)9μl＋1μllodingbuffer
6.(production 4)9μl＋1μllodingbuffer
7.(production 5)9μl＋1μllodingbuffer
8.(production 6)9μl＋1μllodingbuffer
9.(production 7)9μl＋1μllodingbuffer
10.(production 8)9μl＋1μllodingbuffer
11.positive control
The productions were 1.2.3.4，and primer was Ra1.Rz1; the productions were 5.6.7.8，and the primer was Ra2.Rz2.

2017.8.2：

1.Sequencd the target genes extracted by enzyme digestion:
a. Took out 8 clean PCR tubes and marked with P1,P2,P3,P4,P5,P6, P7,P8, and added 10μl corresponding production of enzyme digestion. (The productions 1,2,3,4 were Fa1 and Rz1 used inversion, enzyme digestion for plasmid product, productions 5.6.7.8 were Fa2 and Rz2 used inversion, enzyme digestion for plasmid product)
b.the sample package of 8 tubes were delivered to the Illumina company, thus the results could be obtained.
2.First used PCR for the target genes extracted by enzyme digestion,thenused electrophoresis :
Added the following materials to 8 tubes of 50μL system:

Put the system in PCR and set the param:

3. Gel electrophoresis
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.2g and poured 20ml TAE to make a agarose solution of 1.0%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
Application of sample: the following ingredients were added to the 10 gel pores
DL15000 DNA marker 5μL
(production 1)9μl ＋ 1μl loading buffer
(production 2)9μl ＋ 1μl loading buffer
(production 3)9μl ＋ 1μl loading buffer
(production 4)9μl ＋ 1μl loading buffer
(production 5)9μl ＋ 1μl loading buffer
(production 6)9μl ＋ 1μl loading buffer
(production 7)9μl ＋ 1μl loading buffer
(production 8)9μl ＋ 1μl loading buffer
positive control + 1μl loading buffer
(The productions 1.2.3.4 were Fa1 and Rz 1, used inversion,enzyme digestion for plasmid product, the productions 5.6.7.8 were Ra2 and Rz2 used inversion,enzyme digestion for plasmid product)
Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.

2017.8.10:

Selelcted the escherichia coli and enlarged cultur:（the operation was on the bechtop）
a.Took out the inoculated culture dish and observed the distribution of the flora.
b.Made up 35μl/ml chloramphenicol: first added 50mg/ml chloramphenicol 35μl to 50ml centrifuge tube, and had constant volume of LB culture medium, then mixed them together.
c.Prepared 8 centrifuge tubes that had been sterilized (marked with 1，2，3，4，5，6，7，8), and added about 2500μl LB medium + chloramphenicol respectively. Then used 10μl needles to select floras (only pick one flora) in culture dish one by one, and put both the floras and needles into eight 15ml centrifuge tubes that contained solution.
d.15ml centrifuge tubes marked with 1,2, and selected Fa1 and Rz1 inversion of E coli. 15ml centrifuge tubes marked with 3,4,5,6,7,8, anad selected Fa2 and Rz2 inversion of E coli d. Put 8 15ml centrifuge tubes into 37℃ biochemical incubator for culture.

2017.8.14：

1.Extracted the plasmid from E coli:(8 tubes in all)
a. Took 1-4ml medium solution that from LB medium overnight,12000r/min, centrifuged for 1 min, and abandoned the clear liquid.
b. Added 250μl Buffer S1 suspended precipitum and the suspension should be even without small truffles.(Made sure that RNase had been added to Buffer S1)
c. Added 250μl Buffer S2, turned it upside-down 4-6 time sightly but completely so that the thalli could be split completely. Stopped the operation until a transparent solution was formed. This procedure should not exceed 5 minutes. (Attention: Covered the bottle lid immediately after used Buffer S2 in case NaOH of Buffer S2 of CO2 in air reduced the efficiency of lysis; in order to avoid shaking violently, or DNA of genome would be contaminated.This procedure should not exceed 5 minutes. )
d. Added 350μl BufferS3, turned it upside-down 6-8 time sightly but completely, 12000r/mi,centrifuged for 10min.(avoid shaking violently, or DNA of genome would be contaminated.)
e.Absorbed liquid supernatant produced in Step d, and transferred it to preparation tube (put it into 2ml centrifuge tube which was provided by kit), 12000r/min, centrifuged for 1min, and abandoned the filtrate.
f. Put preparation tube into centrifuge tube, and added 500μlBuffer W1，12000r/min, centrifuged for 1min, then abandoned the filtrate.
g.Put preparation tube into centrifuge tube, added 700μl Buffer W2, 12000r/min, centrifuged for 1 min, then abandoned the filtrate. And used the same method again to wash it with 700μl Buffer W2.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
h.Put preparation tube into 2ml centrifuge tube,12000r/min， and centrifuged for 2 min.
i. Put preparation tube back to 1.5ml centrifuge tube of 1.5ml, and added 50μl deionized water to the central membrane of preparation tube. Left to rest for 1min in room temperature, 12000r/min. (Heated deionized water to 65℃ could improve elution efficiency)
2.Used enzyme digestion for extracted plasmid and extracted the target gene:
Took out eight 1.5ml centrifuge tubes(marked from 1 to 8), and added the given materials respectively:

Divided 18.75μl to every tube, and added 6.5μl plasmid (Took another tube without plasmid for positive control)
Put the centrifuge tube into 37℃ water bath for 3 hours for enzyme digestion.
3.Electrophoresis:
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.6g and poured 40ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour; Application of sample: the following ingredients were added to the 17 gel pores
DL15000 DNA marker 5μL
(production 1)4μl ＋ 1μl loading buffer
(Enzyme digestion 1)4μl ＋ 1μl loading buffer
(production 2)4μl ＋ 1μl loading buffer
(Enzyme digestion 2)4μl ＋ 1μl loading buffer
(production 3)4μl ＋ 1μl loading buffer
(Enzyme digestion 3)4μl ＋ 1μl loading buffer
(production 4)4μl ＋ 1μl loading buffer
(Enzyme digestion 4)4μl ＋ 1μl loading buffer
(production 5)4μl ＋ 1μl loading buffer
(Enzyme digestion 5)4μl ＋ 1μl loading buffer
(production 6)4μl ＋ 1μl loading buffer
(Enzyme digestion 6)4μl ＋ 1μl loading buffer
(production 7)4μl ＋ 1μl loading buffer
(Enzyme digestion 7)4μl ＋ 1μl loading buffer
(production 8)4μl ＋ 1μl loading buffer
(Enzyme digestion 8)4μl ＋ 1μl loading buffer
(The productions 1.2were Fa1 and Rz 1, used inversion,enzyme digestion for plasmid product, the productions 3.4.5.6.7.8 were Ra2 and Rz2 used inversion,enzyme digestion for plasmid product)
Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.

2017.8.18:

1.Used PCR amplified the target genes extracted by enzyme digestion in Sept. 27th, and then used electrophoresis.
Added the following materials to eight tubes of 50μL system:

Put the system into PCR and set the param:

gel electrophoresis
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.2g and poured 20ml TAE to make a agarose solution of 1.0%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
Application of sample: the following ingredients were added to 10 gel pores DL15000 DNA marker 5μL
(Production 1)9μl＋1μl loading buffer
(Production 2)9μl＋1μl loading buffer
(Production 3)9μl＋1μl loading buffer
(Production 4)9μl＋1μl loading buffer
(Production 5)9μl＋1μl loading buffer
(Production 6)9μl＋1μl loading buffer
(Production 7)9μl＋1μl loading buffer
(Production 8)9μl＋1μl loading buffer
positive control＋1μl loading buffer
(The productions 1.2.3.4 were Fa1 and Rz 1, used inversion,enzyme digestion for plasmid product, the productions 5.6.7.8 were Ra2 and Rz2 used inversion,enzyme digestion for plasmid product)
Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.
2.Selelcted the escherichia coli and enlarged cultur:（the operation was on the bechtop）
a.Took out the inoculated culture dish and observed the distribution of the flora.
b.Made up 35μl/ml chloramphenicol: first added 50mg/ml chloramphenicol 35μl to 50ml centrifuge tube, and had constant volume of LB culture medium, then mixed them together.
c.Prepared 8 centrifuge tubes that had been sterilized (marked with 1，2，3，4，5，6，7，8), and added about 2500μl LB medium + chloramphenicol respectively. Then used 10μl needles to select floras (only pick one flora) in culture dish one by one, and put both the floras and needles into eight 15ml centrifuge tubes that contained solution.
(15ml centrifuge tubes marked with 1,2, and selected Fa1 and Rz1 inversion of E coli. 15ml centrifuge tubes marked with 3,4,5,6,7,8, anad selected Fa2 and Rz2 inversion of E coli
d. Put six 15ml centrifuge tubes into 37℃,220r/min, uesd shaker for culture for 16 hours.

2017.8.22:

Extracted the plasmid from E coli:(6 tubes in all)
a. Took 1-4ml medium solution that from LB medium overnight,12000r/min, centrifuged for 1 min, and abandoned the liquid supernatant.
b. Added 250μl Buffer S1 suspended precipitum and the suspension should be even without small truffles.(Made sure that RNase had been added to Buffer S1)
c. Added 250μl Buffer S2, turned it upside-down 4-6 time sightly but completely so that the thalli could be split completely. Stopped the operation until a transparent solution was formed. This procedure should not exceed 5 minutes.
(Attention:covered the bottle lid immediately after used Buffer S2 in case NaOH of Buffer S2 of CO2 in air reduced the efficiency of lysis; in order to avoid shaking violently, or DNA of genome would be contaminated.This procedure should not exceed 5 minutes. )
d. Added 350μl BufferS3, turned it upside-down 6-8 time sightly but completely, 12000r/mi,centrifuged for 10min.(avoid shaking violently, or DNA of genome would be contaminated.)
centrifugation
e. Absorbed liquid supernatant produced in Step d, and transferred it to preparation tube (put it into 2ml centrifuge tube which was provided by kit), 18. 12000r/min, centrifuged for 1min, and abandoned the filtrate.
f. Put preparation tube into centrifuge tube, and added 500μlBuffer W1，12000r/min, centrifuged for 1min, then abandoned the filtrate.
g.Put preparation tube into centrifuge tube, added 700μl Buffer W2, 12000r/min, centrifuged for 1 min, then abandoned the filtrate. And used the same method again to wash it with 700μl Buffer W2.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
h.Put preparation tube into 2ml centrifuge tube,12000r/min， and centrifuged for 2 min.
24. i. Put preparation tube back to 1.5ml centrifuge tube of 1.5ml, and added 50μl deionized water to the central membrane of preparation tube. Left to rest for 1min in room temperature, 12000r/min. (Heated deionized water to 65℃ could improve elution efficiency)
2. Used enzyme digestion for extracted plasmid, and extracted target genes: Took six 1.5ml centrifuge tubes (marked with 1.2.3.4.5.6), and added the following materials:

Divided 18.75μl to every tube, and added 6.5μl plasmid (Took another tube without plasmid for positive control)
Put the centrifuge tube into 37℃ water bath for 3 hours for enzyme digestion.
3. electrophoresis
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.2g and poured 20ml TAE to make a agarose solution of 1.0%, then put it it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution,
and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
Application of sample: the following ingredients were added to 13 gel pores
DL15000 DNA marker 5μL
(Production 1)4μl＋1μl loading buffer
(Enzyme digestion 1)9μl＋1μl loading buffer
(Production 2)4μl＋1μl loading buffer
(Enzyme digestion 2)9μl＋1μl loading buffer
(Production 3)4μl＋1μl loading buffer
(Enzyme digestion 3)9μl＋1μl loading buffer
(Production 4)4μl＋1μl loading buffer
(Enzyme digestion 4)9μl＋1μl loading buffer
(Production 5)4μl＋1μl loading buffer
(Enzyme digestion 5)9μl＋1μl loading buffer
(Production 6)4μl＋1μl loading buffer
(Enzyme digestion 6)9μl＋1μl loading buffer
(The productions 1.2 were Fa1 and Rz 1, used inversion,enzyme digestion for plasmid product, the productions 3.4.5.6 were Ra2 and Rz2 used inversion,enzyme digestion for plasmid product)
Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.

2017.8.27:

1. Bypass Reaction:
Took two PCR tubes for making up the same systems of 60μL, and added the following materials:

Put the system into PCR and set the param:

The two tubes of the same samples after PCR were merged into one tube and did recycling experiments (supposed the samples were 100μl):
a.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(300μl ) into it.
b.Then added Buffer DE-B(150μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
c.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
d.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
e.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate. and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
f.Put preparation tube back to 2ml centrifuge tube,12000r/min, and centrifuged for 2 min.
g.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 12000r/min speed to elute DNA.
3.Did repairing gap reaction in PCR
Added the following materials into a PCR tube（20μl system)

Set param: 16℃ forever
Put it into biochemical incubator after half an hour(16℃）

2017.8.31:

1.Used the samples after had been repaired the gap for recycled experiment (added 40μl water to 10μl samples, and there was 50μl in all)
a.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(150μl ) into it.
b.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
c.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
d.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
e.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate. and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
f.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
g.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 12000r/min speed to elute DNA.

2017.9.3:

PCR amplification (amplified the samples that had been repaired in Bypass Reaction):
Added the following materials into two tubes of 50μL system

Put the system into PCR and set the param:

2. Used all the samples after PCR for recycle experiment.
a.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(150μl ) into it.
b.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
c.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
d.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
e.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate. and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
f.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
g.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 12000r/min speed to elute DNA.
3.Enzyme digestion (made three 50μl systems for enzyme digestion)
addded the following materials into three PCR tubes
img src="http://oyeu0gk8v.bkt.clouddn.com/65.png">
37℃ heated water bath for 4.5 hours
2. Recycled DNA fragments
a. Put the samples into three 1.5ml centrifuge tubes, and added Buffer DE-A of three gel volumes(150μl) respectively.
b.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
c.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
d.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
e.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate.
and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
f.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
g.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 12000r/min speed to elute DNA.
3.Connection(Made two 20μl systems to connect)
Addedthe following materials into PCR tube

2017.9.7:

1.Gel electrophoresis
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.2g and poured 20ml TAE to make a agarose solution of 1.0%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
Application of sample: the following ingredients were added to 4 gel pores:

Electrophoresis: Turn on the power of electrophoresis voltageUs=100V electrical current Is=399mA timeTs=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.
I2.nversion (the recombinant vectors were introduced into escherichia coli):
Took out four clean 1.5ml centrifuge tubes ont the bechtop and added the following materials:
Tube 1：DH 5αcompetent cell 50μl
Tube 2：DH 5αcompetent cell 50μl ice-bath for 30min 42℃ heat shock for 90s ice-bath for 2min again
Then added 300μl LB liquid medium to every tube（no chloramphenicol）
Then put it to37℃、220r/min table concentrator 45min
spread plate(the operation was on the bechtop):
a.Took out four sterile culture media and the marks. Medium 1 (no chloramphenicol), Medium 2 (contained sugar), Medium 3 (contained chloramphenicol), Medium 4 (contained chloramphenicol).
b.Soaked the spreader in an beaker full of beaker (every time after the bacteria had been spread, this action was needed).
cAdded the bacteria solution of centrifuge tubes into the surface of the corresponding media: The solution of Tube 1 was added to the Medium 1, the solution of Tube 2 was added to the Medium 2.
dIgnited the spreader which had a little amount of alcohol with the fire. When the alcohol was burned out, cooled it for 8~10s.
eThe bacterial solution was evenly coated on the surface of the medium with spreader, rotated the culture dish so that the solution can be coated evenly.(Attention: Soaked the end of spreader in an beaker full of the volume fraction of seventy percent ethanol. When took it out, let the extra ethanol drop in the beaker, then ignited the spreader which had a little amount of ethanol with the fire.)
After the bacteria had been coated, leaving to rest for 5 minutes.
g.Put the four media that had bacterination to 37℃ biochemical incubator for culture.

2017.9.13:

Selelcted the escherichia coli and enlarged cultur:（the operation was on the bechtop）
a.Took out the inoculated culture dish and observed the distribution of the flora.
b.Made up 35μl/ml chloramphenicol:
first added 50mg/ml chloramphenicol 35μl to 50ml centrifuge tube, and had constant volume of LB culture medium, then mixed them together.
c.Prepared 8 centrifuge tubes that had been sterilized (marked with 1，2，3，4，5，6，7，8), and added about 2500μl LB medium + chloramphenicol respectively. Then used 10μl needles to select floras (only pick one flora) in culture dish one by one, and put both the floras and needles into eight 15ml centrifuge tubes that contained solution.
(15ml centrifuge tubes marked with 1,2, and selected Fa1 and Rz1 inversion of E coli. 15ml centrifuge tubes marked with 3,4,5,6,7,8, anad selected Fa2 and Rz2 inversion of E coli
d. Put six 15ml centrifuge tubes into 37℃,220r/min, uesd shaker for culture for 16 hours.

2017.9.17:

Preparation of laboratory reagents:
1.Subpackage and dilution of primer:the primers were subjected to centrifugal treatment(set DNA to the bottom),11000r/min 2min;then put each primer tube on the reagent card with ice(DNA primers are more stable at low temperature and high concentrations), and added ddH2O(100μM) according to the following requirements.
Primer name Rnb
Sequence (5’to3’): CTTCTGCTCAGGAACCTG
Add ddH2O (100μM): 94μL
Primer name Fnb
Sequence (5’to3’): 5’P- TGCCTGGGAAGAAGGC
Add ddH2O (100μM): 96μL
Primer name PrefixFβ(5-3)
Sequence (5’to3’):
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTGCCTGGGAAGAAGGC
Add ddH2O (100μM): 39μL
Primer name SuffixRβ(5-3)
Sequence (5’to3’):
GTTTCTTCCTGCAGCGGCCGCTACTAGTATCAGTTCCTGAGCAGAAG
Add ddH2O (100μM): 39μL
Primer name Fb1(5-3)
Sequence (5’to3’): GTTTCTTCGAATTCGCGGCCGCTT
Add ddH2O (100μM): 84μL
Primer name Rw1(5-3)
Sequence (5’to3’): GTTTCTTCCTGCAGCGGCCGCTA
Add ddH2O (100μM): 88μL
Primer name Fb2(5-3)
Sequence (5’to3’): GTTTCTTCGAATTCGCGGCCGCTTCTAGAG
Add ddH2O (100μM): 65μL
Primer name Rw2(5-3)
Sequence (5’to3’): GTTTCTTCCTGCAGCGGCCGCTACTAGTA
Add ddH2O (100μM): 68μL
2. Dilution of self provided DNA template (diluted at 1:10) 5'-TGCCTGGGAAGAAGGCGCGCAAGAACGCTCAACCGAGCCCCGCGCGGGCTCCAGCAGAGCTGGAAGTCGAGTGTGCTACTCAACTCAGGAGATTTGGAGACAAACTGAACTTCCGGCAGAAACTTCTGAATCTGATATCCAAACTCTTCTGCTCAGGAACCTG-3'
3.materials of experiment: nucleic acid dyestuffs of SuperRed and GelRed(10000*water solution);Standardized Maker: :DL2000 DNA marker and DL500 DNA marker;the gel extraction kit of AxyPrep DNA.
4.apparatus of experiment:centrifuge; error-prone PCR;electrophoresis tank;YLN-II,Microwave oven;micro sampler and so on.
In the morning:
The first amplification of error-prone PCR:
Added the following ingredients in turn in 30μL system

put the system into the PCR and set the param

In the afternoon.
agarose gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.45g and poured 30ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 3μL of nucleic acid dye into the conical flask which contained 30ml of agarose solution, be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the three gel pores

2017.9.20:

amplification of error-prone PCR(to get the start and end)
made three 30μL systems and put the following ingredients into them

System 1 took the Rnb and Fnb
System 2 took the self-provided template β
System 3 took the self-provided template β
PCR primer
1. System 1: added 1μL Rna and Fna respectively
2. System 2: added 1μL Prefix and Rna respectively
3. System 3: added 1μL Suffix and Fna respectively
Taq deoxyribonucleic acid polymerase （5U/μL） 2μL
put the system into the PCR and set the param

agarose gel electrophoresis:
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.4g and poured 20ml TAE to make a agarose solution of 2%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

Gel extraction:
1.First, took three devoid of nucleic acid and 1.5ml centrifuge tube contaminated by nuclease, and heated the water bath to 75℃
2. Cut the agarose gel shangles that containing target DNA under the ultraviolet lamp, and sucked the liquid on gel surface with paper towel and chopped it up.
Then put them into three centrifuge tubes respectively and weighed them on the scale.
Centrifuge tube 1:(Rna and Fna) the weight of gels were 60mg
Centrifuge tube 2:(PrefixFβ and Rna) the weight of gels were 94mg
Centrifuge tube 3:(SuffixRβ and Fna) the weight of gels were 80mg
3. Added Buffer DE-A of three gels volumes into three centrifuge tube respectively, and heated them at 75℃ when mixed well,mixed them discontinuously(every 2-3min), until the gels were completely dissolved(about 6-8min).
4. Added Buffer DE-B of 0.5 Buffer DE-A volume（150μL）and mixed them well, and DNA fragments of this experiemnt were less than 400bp, adding isopropyl alcohol of one gel volume（100μL）was needed.(The mixture which had added Buffer DE-B turned into yellow, and it turned into yellow homogeneous solution after fully mixed)
5.Transfer the mixed liquid from the centrifuge tube to the DNA preparation tube(to 2ml centrifuge tube), and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
6. Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.
7.Put preparation tube back to 2ml centrifuge tube, added centrifuge tube, centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate. And used the same method again to wash it with Buffer W2,and centrifuged for 1 min at 13550r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
8.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
9. Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 1min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Remade Gel Electrophoresis
1.Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
2.Preparation of agarose solution: used weighing scale to get powdered agar of 0.4g and poured 20ml TAE to make a agarose solution of 2%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
3. Added SuperRed/GelRed nucleic acid dye( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was sightly poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
4. After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
5.Application of sample: the following ingredients were added to the four gel pores

2017.9.24:

”Bridge” experiment
Tooktwo tubes of PCR, and made the same system of 60μL, then added the following materials: <
img src="http://oyeu0gk8v.bkt.clouddn.com/$B6NJ%25Z_W3C%5DQRSYYT$T36G.png">
Finally, added hi-fi 0.8μl Tap DNA polymerase into all systems respectively.
put the system into the PCR and set the param

recycled the samples from THE PCR in the two tubes, and put them together in one tube.(assuming there are 100μl samples.)
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(300μl ) into it.
2.Then added Buffer DE-B(150μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate, and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 12000r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
amplification of PCR:
made two tubes with the following ingredient.
Ultrapure water 31.4μL
Primer star Buffer 5× 10μL
dNTP Mix (2.5mM ) 4μL
DNA template (recycles from the samples) 2μL
PCR primer Rna and Fna system1 Rw1 and Fb1 (10μM) 1μL respectively system2 Rw2 and Fb2 (10μM) 1μL respectively
Taq deoxyribonucleic acid polymera（5U/μL） 0.6μL
put the system into the PCR and set the param
recycled all the samples after PCR
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(150μl ) into it.
2.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate, and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 12000r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Connection(made two systems in 20μl to connect):

37℃ heating for 3 hours with water bath

2017.9.28:

Enzyme digestion (made up three 50μl systems for enzyme digestion):
addded the following materials into three PCR tubes

37℃ heating for 3 hours with water bath
recycled DNA fragment
1.Put the samples into 1.5ml centrifuge tube, and added Buffer DE-A of three gel volumes(150μl ) into it.
2.Then added Buffer DE-B(75μl) of 0.5 Buffer DE-A volume into centrifuge tube and mixed well together. If the recycle of DNA was more than 400bp of the samples in this operation, there was no need for isopropyl alcohol.
3.Transferred the mixed liquid from the 1.5ml centrifuge tube to DNA preparation tube, and put the preparation tube in 2ml centrifuge tube and centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
4.Put preparation tube back to 2ml centrifuge tube, and added 500μL Buffer W1,centrifuged for 1 min at 12000r/min speed, then abandoned the filtrate.
5.Put preparation tube back to 2ml centrifuge tube, added 700μl BuferW2, centrifuged for 1 min at 12000r/min speed. Then abandoned the filtrate, and used the same method again to wash it with Buffer W2,and centrifuged for 30s at 12000r/min speed, then abandoned the filtrate.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
6.Put preparation tube back to 2ml centrifuge tube, and centrifuged for 2 min at 13550r/min speed.
7.Put preparation tube back to clean centrifuge tube of 1.5ml, and put it open for 3 min (volatilized isopropyl alcohol).30μL deionized water（65℃） was added to the central part of the prepared tube, volatilized for 4min in room temperature, then centrifuged for 2 min at 13550r/min speed to elute DNA.
Connection（made up two 20μl systems to connect）：
Addedthe following materials into PCR tube
ddH2O 6μl
10× NEB Buffer 2 2μl
BSA(0.190) 1μl
Added enzyme digestion into DNA sequence
System 1: linearized PSBlC3 plasmid vector 1μl + Fa1 and the recycled production of Rz1 PCR 10μl
System 2: linearized PSBlC3 plasmid vector1μl + Fa2 and the recycled production of Rz2 PCR
System 3: Fa2 and the recycled production of Rz2 PCR 10μl NEB DNA ligase 1μl

2017.10.3:

The collocation of medium (divided into 3 bottles of liquid nutrient medium and one bottle of solid medium):
Took a 1000ml beaker, and added 760ml deionized water, then began to dissolve it after adding the following materials
tripton 8g
yeast extract 4g
NaCl 4g
Stirred the liquid until the solid was completely dissolved, and added 5mol/L NaOH（160μl) and adjusted pH to 7.0, then used deionized water in constant volume of 800 ml.
Divided the prepared solution into 4 bottles (every bottle was about 200ml), added 3g agar powder to one of the bottles to make solid medium, and the others were made into liquid nutrient medium. Put the well-prepared medium and culture dish that needed to be sterilized to High-Pressure Steam Sterilization Pot to sterilize.
Plate smearing method
1.Before using Bechtop, turned on UV lamp of Bechtop at least for 30 min to sterilize;
2.Turned on the blower and lamp while using Bechtop, and turned off UV sterilamp and sterilized hands and arms, etc.
3.Opened the lid of the pot, and put the medium in conical flask into sterile culture dish which had been sterilized while it was still hot (agar was not congealed at 50℃) on the Bechtop. Put the triangular flask that contained culture dish next to the fire, and opened the breathable film and let the mouth face to the fire. Put the culture dish with the left hand and covered the flame with the dish.(The method of holding dish: Used ring finger and little finger to hold the bottom, used thumb and middle finger to hold the lid so that it was conveninent to open and cover the lid with thumb. Before operation, practiced this action until skillful enough.) Put culture dish about 15mL into it quickly through a slot. Covered the dish and shaked it sightly to make the medium was evenly distributed at the bottom of the culture dish, and then placed it on the desktop. After solidification, made them into plate for inoculation of bacteria.
Inversion (the recombinant vectors were introduced into escherichia coli):
Took out four clean 1.5ml centrifuge tubes ont the bechtop and added the following materials:
Tube 1：DH 5αcompetent cell 50μl; Fb1 and Rw1 connecting carrier 10μl
Tube 2：DH 5αcompetent cell 50μl; Fb1 and Rw1 connecting carrier 10μl ice-bath for 30min 42℃ heat engine for 90s ice-bath for 2min again
Then added 300μl LB liquid medium to every tube（no chloramphenicol）
Then put it to37℃、220r/min table concentrator 45min
spread plate(the operation was on the bechtop):
1.Took out four sterile culture media and the marks. Medium 1 (no chloramphenicol), Medium 2 (contained sugar).
2.Soaked the spreader in an beaker full of beaker (every time after the bacteria had been spread, this action was needed).
3.Added the bacteria solution of centrifuge tubes into the surface of the corresponding media: The solution of Tube 1 was added to the Medium 1, the solution of Tube 2 was added to the Medium 2.
4.Ignited the spreader which had a little amount of alcohol with the fire. When the alcohol was burned out, cooled it for 8~10s.
5.The bacterial solution was evenly coated on the surface of the medium with spreader, rotated the culture dish so that the solution can be coated evenly.(Attention: Soaked the end of spreader in an beaker full of the volume fraction of seventy percent ethanol. When took it out, let the extra ethanol drop in the beaker, then ignited the spreader which had a little amount of ethanol with the fire.)
6.After the bacteria had been coated, leaving to rest for 5 minutes.
Put the two media that had had bacterination to 37℃ biochemical incubator for culture over night.
Selelcted the escherichia coli and enlarged cultur:（the operation was on the bechtop）
1.Took out the inoculated culture dish and observed the distribution of the flora.
2.Made up 35μl/ml chloramphenicol: first added 50mg/ml chloramphenicol 35μl to 50ml centrifuge tube, and had constant volume of LB culture medium, then mixed them together.
3.Prepared 8 centrifuge tubes that had been sterilized (marked with 1，2，3，4，5，6，7，8), and added about 2500μl LB medium + chloramphenicol respectively. Then used 10μl needles to select floras (only pick one flora) in culture dish one by one, and put both the floras and needles into eight 15ml centrifuge tubes that contained solution. (marked tube 1,2,3,4 which obtain 15ml transformed Escherichia coil Fb1 and Rw1, marked tube 5,6,7,8 which obtain 15ml transformed Escherichia coil Fb2 and Rw2)
4. Then put the eight tubes to37℃、220r/min table concentrator for 16 hours.

2017.10.8:

Extracted the plasmid from E coli:(8 tubes in all):
a. Took 1-4ml medium solution that from LB medium overnight,12000r/min, centrifuged for 1 min, and abandoned the liquid supernatant.
b. Added 250μl Buffer S1 suspended precipitum and the suspension should be even without small truffles.(Made sure that RNase had been added to Buffer S1)
c. Added 250μl Buffer S2, turned it upside-down 4-6 time s completely so that the thalli could be split completely. Stop the operation until a transparent solution was formed. This procedure should not exceed 5 minutes. (Attention: covered the bottle lid immediately after used Buffer S2 in case NaOH of Buffer S2 of CO2 in air reduced the efficiency of lysis; in order to avoid shaking violently, or DNA of genome would be contaminated. This procedure should not exceed 5 minutes. )
d. Added 350μl BufferS3, turned it upside-down 6-8 time completely, 12000r/mi, centrifuged for 10min. (avoid shaking violently, or DNA of genome would be contaminated.)
Centrifugation
e. Absorbed liquid supernatant produced in Step d, and transferred it to preparation tube (put it into 2ml centrifuge tube which was provided by kit), 18. 12000r/min, centrifuged for 1min, and abandoned the filtrate.
f. Put preparation tube into centrifuge tube, and added 500μlBuffer W1，12000r/min, centrifuged for 1min, then abandoned the filtrate.
g. Put preparation tube into centrifuge tube, added 700μl Buffer W2, 12000r/min, centrifuged for 1 min, then abandoned the filtrate. And used the same method again to wash it with 700μl Buffer W2.(Made sure that absolute ethyl alcohol has been added to Buffer W2 concentrate according to the prescribed volume of the instructions on the reagent bottle;used Buffer W2 twice to make sure that salinity had been completely removed to prevent its impact on the follow-up experiments)
h. Put preparation tube into 2ml centrifuge tube,12000r/min， and centrifuged for 2 min.
i. Put preparation tube back to 1.5ml centrifuge tube of 1.5ml, and added 50μl deionized water to the central membrane of preparation tube. Left to rest for 1min in room temperature, 12000r/min. (Heated deionized water to 65℃ could improve elution efficiency)
Used enzyme digestion for extracted plasmid, and extracted target genes:
Took six 1.5ml centrifuge tubes (marked with 1.2.3.4.5.6，7，8), and added the following materials:
10 X NEB buffer 2μl X 8.5 21.5μl BSA(0.1％) 0.25μl X 8.5 2.2μl ECOR1-HF 0.5μl X 8.5 4μl pst-1 0.5μl X 8.5 4μl dd H2O 15μl X 8.5 130μl
Divided 19μl to every tube, and added 6μl plasmid (Took another tube without plasmid for positive control)
Put the centrifuge tube into 37℃ water bath for 3 hours for enzyme digestion.
Electrophoresis:
Preparation of buffer solution(TAE): 980ml distilled water(measured it with a graduated cylinder)+20mlTAE(50×TAE was diluted to1×TAE), and poured the diluted water into the electrophoresis tank(TAE could be reused in the electrophoresis tank).
Preparation of agarose solution: used weighing scale to get powdered agar of 0.6g and poured 40ml TAE to make a agarose solution of 1.5%, then put it into a microwave oven to cook for 2-3 times (30s/times) until the solid was completely dissolved.
Added SuperRed/GelRed nucleic acid dye ( Gel Staining): added 2μL of nucleic acid dye into the conical flask which contained 20ml of agarose solution, and be careful that nucleic acid dye was poisonous and medical gloves were needed.(The nucleic acid dye was combined with nucleic acids in gels so that they displayed nucleic acid banding under ultraviolet lamp)
After the solution was cooled to 60℃, poured it into horizontal plywood and solidified it for half an hour;
Application of sample: the following ingredients were added to the 17 gel pores:
DL20000 DNA marker 5μL
(production 1)4μl ＋ 1μl loading buffer
(production 2)4μl ＋ 1μl loading buffer
(production 3)4μl ＋ 1μl loading buffer
(production 4)4μl ＋ 1μl loading buffer
(production 5)4μl ＋ 1μl loading buffer
(production 6)4μl ＋ 1μl loading buffer
(production 7)4μl ＋ 1μl loading buffer
(production 8)4μl ＋ 1μl loading buffer
(Enzyme digestion 1)4μl ＋ 1μl loading buffer
(Enzyme digestion 2)4μl ＋ 1μl loading buffer
(Enzyme digestion 3)4μl ＋ 1μl loading buffer
(Enzyme digestion 4)4μl ＋ 1μl loading buffer
(Enzyme digestion 5)4μl ＋ 1μl loading buffer
(Enzyme digestion 6)4μl ＋ 1μl loading buffer
(Enzyme digestion 7)4μl ＋ 1μl loading buffer
(Enzyme digestion 8)4μl ＋ 1μl loading buffer
(The productions 1.2.3.4were Fb1 and Rw 1, used inversion, enzyme digestion for plasmid product, the productions 5.6.7.8 were Rb2 and Rw2 used inversion, enzyme digestion for plasmid product)
Electrophoresis: Turn on the power of electrophoresis voltage Us=100V electrical current Is=399mA time Ts=3:30
Took pictures then got the results: when the gel of electrophoresis had run to the 2/3 of the gel, then stopped electrophoresis. Took out the gel and took pictures under ultraviolet fluoroscopy.
4.Sequencd the target genes extracted by enzyme digestion:
a. Took out 8 clean PCR tubes and marked with P1,P2,P3,P4,P5,P6, P7,P8, and added 10μl corresponding production of enzyme digestion. (The productions 1,2,3,4 were Fb1 and Rw1 used inversion, enzyme digestion for plasmid product, productions 5.6.7.8 were Fb2 and Rw2 used inversion, enzyme digestion for plasmid product)
b. the sample package of 8 tubes were delivered to the Illumina company, thus the results could be obtained.

2017.10.14:

We send plasmid samples constructed in the experiment to a relevant company, and let it help us to import them into Escherichia coli, then detected the expression situation about the expression factor GFP in Escherichia coli by green fluorescence microscope

- Attribution
- Goto
- Project
- Pathway and Design
- Biobrick
- Protocols
- Notebook
- Lab picture
- future work
- Collaboration
- Goto
- Human
  Practice
- Silver
- Gold
- Engagement
- Description
- Goto
- Demonstrate
- Goto
- Proof
- Goto