Team:Freiburg/Notebook Suicide Gene
Lab Notebook Suicide Gene
10.08.17
Transformation of pIG17_83 (Suicide Gene) with Xl 10 Gold
- Thaw Xl10 competent cells from -80 ° Freezer on 30 Minutes on Ice.
- Add Plasmid DNA [2 µl, dependent on concentration] and let stand on Ice for 30 Minutes.
- Heat shock on 42 ° for 45 Seconds and let stand for 2 minutes on Ice.
- Add LB-Medium [450 µl] without antibiotics and incubate for 37 ° for 60 minutes and 300 rounds per minute.
- Plate Culture with antiobiotic resistence on LB-plate with corresponding antibiotics.
- (If overgrown, dilute streak bacteria colonies on another plate.)
11.08.2017
Occulation of Overnight cultures
Pick four single colonies and oculate four overnight cultures with LB-AMP [6 ml each] in glas reaction tubes.
12.08.17
Plasmid Isolation of four Overnight Cultures of pIG17_83 (Suicide Gene) with Promega Miniprep Kit
- Elution in pre-warmed (50°) Elution Buffer [30 µl].
| Sample | Concentration [ng/µl] |
|---|---|
| Suicide Gene 1 | 521 |
| Suicide Gene 3 | 549 |
| Suicide Gene 3 | 804 |
| Suicide Gene 4 | 600 |
14.08.2017
Test Digest of pIG17_83 with XbaI and KpnI
All Controls were performed with autoclaved water [18 µl] and of Plasmid-Solution [2 µl].
Top Band XbaI with Suicide Gene 1-4 with Controls in between
| Components | Volumes [ng/µl] |
|---|---|
| Water | 14,5 (15,5 for SG3) |
| DNA | 2 (1 for SG3) |
| Cutsmart | 2 |
| XbaI | 1,5 |
Expected Fragments: 4617 bp, 3495 bp & 1712 bp
Lower Band KpnI with Suicide Gene 1-4 with Controls in between
| Components | Volumes [ng/µl] |
|---|---|
| Water | 14,5 (15,5 for SG3) |
| DNA | 2 (1 for SG3) |
| Cutsmart | 2 |
| KpnI | 1,5 |
Expected Fragments: 4926 bp, 3867 bp & 1031 bp
Incubate for 60 minutes at 37 °. 4 µl 6X Orange Dye was added to each Sample. DNA-Ladder: 5 µl 1kb GeneRuler plus
Gel Preparation
- Heat up 85 ml (small) or 120 ml (big) 1 x TAE-Buffer with 1 mass percent Agarose in the microwave until the Agarose has dissolved completely.
- Add 5 µl (small) or 7 µl (big) Midori-Green DNA Stain to the heated TAE-Agarose mix and pour into respective gel-chamber with desired comb.
- Let it cool for >45 minutes until it has complete solidificated.
- Remove comb carefully to reveal the gel slots.
- Pour 1 x TAE-Buffer over the cooled down gel until it is completely covered in liquid.
Gel run of test digests
- Put 5µl (small gel) or 8 µl (big gel) DNA ladder (1kb GeneRuler plus) into slot for use as reference.
- Mix DNA Sample with Loading Dye for desired Dilution (6x Purple or Orange Loading Dye)
- Load Gel Slot with Dna Sample
- Run the Gel with following settings: 120 Volt, 3 Watte, 15 Ampere for 45 Minutes.
- Visualize in the Gelbox with Exposure Time of 64 seconds and UV-Light.
Gel-Image
15.08.2017
Test digest with Nde1 and PvuII in CF and Fast digest
First four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): NdeI with Suicide Gene 1 & 2 with Controls in between.
Last four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): PvuII with Suicide Gene 3 & 4 with Controls in between.
NdeI with SG 1 & 2 Expected fragements: 7071 bp & 2753 bp
| Components | Volumes [µl] |
|---|---|
| Water | 15,25 (CS) or 14,5 (FD) |
| DNA | 2 |
| CS (Top) or FD (Lower) | 2 |
| NdeI | 0,75 (CS) or (1,5 FD) |
PvuII with SG 3 & 4. Expected Fragements: 7311 bp & 2513 bp
| Components | Volumes [µl] |
|---|---|
| Water | 15,25 (CS) or 14,5 (FD) |
| DNA | 2 |
| CS (Top) or FD (Lower) | 2 |
| NdeI | 0,75 (CS) or (1,5 FD) |
Gel Run of Test Digest
Ladder: 5µl 1KB GeneRuler PLus
Samples 3 & and 4 have been confirmed as correct fragments.
A glycerolstock of Sample 3 has been made and put into the -80° Freezer
21.08.2017
Occulation of four overnight cultures with pIG17_82 (p526) lentiviral transfer plasmid
4 Colonies have been picked from an LB-Plate.
22.08.2017
Miniprep of four O/N Cultures with p526 with Promega Miniprep Kit
Elution in 30 µl prewarmed (50°) Elution Buffer
| Sample | Concentration |
|---|---|
| 1 | 625 |
| 2 | 494 |
| 3 | 607 |
| 4 | 731 |
Digest of p526
| Component | Concentration | Volume (µl] |
|---|---|---|
| Water | - | 18 |
| DNA | 125 [ng/µl] | 16 |
| Cutsmart | 10x | 4 |
| SpeI-HF | 20 U/µg | 1 |
| SalI-HF | 20 U/µg] | 1 |
Gel Run
Third slot: Digest of p526, Top fragment (Backbone)
Gelextraction of lentiviral Backbone p526 (5839 bp)
Elution in 12 µl milliq Water Yield: 15 ng/µl
21.09.17
Extension PCR with CMV of pIG17_37 and Primers oIG17_280 & and oIG17_281
Forward Extension binds into Lentiviral Backbone (pIG17_83) upstream of restriction site with SpeI.
Reverse Extention binds downstream into e-GFP Sequence of Suicide Gene (pIG17_83).
Sequence:
oIG17_280: Extension: 5`-ATTCAAAATTTTATCGATACTAGCGT-3` Binding Site: 5'- TAGTTATTAATAGTAATCAATTACGGGG - 3'
oIG17_281: Extension: 5`-GCTCCTCGCCCTTGCTCACCAT-3` Binding Site: 5'- TGATACACTTGATGTACTGCCAAG - 3'
Annealing Temperature of 60° was calculated by NEB-Tm-Calculator using Q5-Polymerase.
PCR-Components
| Components | Concentrations | Volumes [µl] |
|---|---|---|
| H2O | - | 29 |
| Template (plG17_34) | 20 ng/µl | 5 |
| 10 mM FW primer | - | 2.5 |
| 10 mM RW primer | - | 2.5 |
| 10mM dNTPs | - | 0,5 |
| 5x Q5 Buffer | - | 10 |
| Q5 Polymerase | - | 0.5 |
| Total | - | 50 |
PCR-Cycles Expected Fragmens Size: 282 bp
| Step | Denaturation | Annealing | Extension | Final Elongation | Chill | |
|---|---|---|---|---|---|---|
| Temperature [°] | 98 | 60 | 72 | 72 | 4 | |
| Length | 30 s | 20 s | 30s | 2 Minutes | Pause | |
| Cycles | 30 x | 1 | Pause | |||
Extension PCR with e-GFP-Hygromycin-Thimidinekinase Cassette
oIG17_282 binds to eGFP Sequence of Suicide Gene.
oIG237 binds to 3'End of Thimidine Kinase, Extension binds downstream of SalI - Restriction site into WPRE-enhancer element of transfer-Plasmid p526 (pIG17_82).
oIG17_282: Binding: 5' - ATGGTGAGCAAGGGCGAGGAGCTGTTC - 3'
oIG17_237: Extension: 5'- GTAATCCAGAGGTTGATTGTCGA - 3' Binding Site: 5'- TCAGTTAGCCTCCCCCATC -3'
Annealing Temperature of 67° was calculated by NEB-Tm-Calculator using Q5-Polymerase
PCR
| Components | Concentrations | Volumes [µl] |
|---|---|---|
| H2O | - | 28.5 |
| Template (plG17_34) | 20 ng/µl | 5 |
| 10 mM FW primer | - | 2.5 |
| 10 mM RW primer | - | 2.5 |
| 10mM dNTPs | - | 1 |
| 5x Q5 Buffer | - | 10 |
| Q5 Polymerase | - | 0.5 |
| Total | - | 50 |
PCR-Cycles Expected Fragment Size: 2906 bp
| Step | Denaturation | Annealing | Extension | Final Elongation | Chill | |
|---|---|---|---|---|---|---|
| Temperature [°] | 98 | 67 | 72 | 72 | 4 | |
| Length | 30 s | 20 s | 4 Minutes | 5 Minutes | Pause | |
| Cycles | 30 x | 1 | Pause | |||
22.09.2017
Gel Run with Extension PCR CMV & eGFP-Hygromycin-TK Fragments
First Slot: 1 kb GeneRuler PLus Ladder
Second Slot: CMV (282 bp)
Third slot: Suicide Gene Cassette (2906 bp)
Fragments with 282 bp (extension CMV) & 2906 bp (SG-Cassette) were cut out.
23.09.2017
Gelextraction of extension PCRs with QiaQuick Gel extraction kit
Procedure according provided protocol Elution in 10 µl prewarmed (50°) Milliq H20
| Sample | |
|---|---|
| ex.CMV | 6 |
| ext.SG | 130 |
26.09.17
Repetion of extension PCR with CMV
CMV from the Gel-Extraction (23.09.2017) was again used as template.
PCR-Cycles Expected Fragmens Size: 282 bp
| Step | Denaturation | Annealing | Extension | Final Elongation | Chill | |
|---|---|---|---|---|---|---|
| Temperature [°] | 98 | 70 | 72 | 72 | 4 | |
| Length | 30 s | 20 s | 30s | 2 Minutes | Pause | |
| Cycles | 40 x | 1 | Pause | |||
No gel run.
27.09.17
Gibson Assembly with CMV-fragment, Suicide-Gene-fragment and lentiviral Backbone p526 pIG17_82
| Components | Concentration | Amount | Weight [pmol] | Volume [µl] |
|---|---|---|---|---|
| Water | - | 1 | ||
| p526 Backbone | - | 0,013 | 50ng | 2 |
| CMV | - | 0,055 | 0,5 | |
| SG-Cassette | - | 0,039 | 0,5 | |
| Gibson Master Mix | 2x | 5 | ||
Final Construct: pIG17_161
Transformation of pIG17_161 with XL10 Gold
28.9.17
1 Colony pick and O/N of the colony
29.9.17
Miniprep of O/N
Elution in 30 µl prewarmed (50°) Elution Buffer
Yield: 1 µg/µl Second Eluate: 140 µg/µl
Test Digest of pIG17_161
| Components | Concentration | Volumes [µl] | |
|---|---|---|---|
| Water | - | 13,5 | |
| DNA | 140 ng/µl | 3,5 | |
| FAstDigest | 5x | 2 | |
| NdeI | - | 1µl | |
Incubate for 30 Minutes on 37 degress.
Expected fragments: 5314 bp & 3647 bp
Gel run
First Slot: 1 Kb GeneRuler PLus Ladder
Second Slot: Digest with fragments of 8961 bp (uncomplete digest) 5314 bp & 3647 bp.
Third Slot: Undigested Control
Sequencing of pIG17_161
Sample with 1 µg DNA per µl (30 µl) was divided into 6 Samples and sent in for sequencing for with Oligos oIG17_19, oIG17_246, oIG17_247, oIG17_248, oIG17_221 and an eGFP-Custom Primer offered by GATC.
30.9.2017
Sequencing results
Sequencing confirmed positive sequence, pIG17_161 was handed over to cell culture for lentiviral transduction
Retransformation of pIG17_161
01.10.2017
Colony Pick & Occulation of 4 Overnight cultures
02.10.2017
Miniprep of 4 O/N
| Sample | Concentration [ng/µl] |
|---|---|
| 1 | 398 |
| 2 | 685 |
| 3 | 787 |
| 4 | 1157 |
An Glyerolstock of Sample 4 has been made with the Number 161 and Notation CMC_eGFP_Hygromycin_Thimidine_Kinase-transfer.
03.10.17
Miniprep of 10 O/N Cultures pIG17_83
Elution on 37° for 15 Minutes with ddH2O
| Sample | Concentration [ng/µl] |
|---|---|
| 1 | 262 |
| 2 | 294 |
| 3 | 389 |
| 4 | 375 |
| 5 | 278 |
| 6 | 305 |
| 7 | 261 |
| 8 | 205 |
| 9 | 321 |
| 10 | 401 |
25.10.2017
Summarized Results of Ganciclovir Killing
Survival Rates
