Team:Kent/Basic Part
Project
Description
Modelling
Results
Parts
Basic Parts
Notebook
Logbook
Experiments
Future Ideas
Safety
Project Safety
Team
Meet the Team
Contribution
Attribution
Human Practices
Silver
Gold
Public Engagement
Interlab
Collaboration
Parts
Basic Parts
BBa_K2340000
Our dCas13a - GFP construct was synthesized by Integrated DNA Technologies. The dCas13a gene sequence was obtained from addgene (http://www.addgene.org/83485/). There are three forbidden restriction sites in the sequence and they were swapped out using a codon usage table. The sequence of the GFP with the standard 25 prefix/suffix (BBa_K648013) was taken from the biobrick library. GFP was chosen as a reporter as it is a frequently used reporter. To improve the stability and activity and conserving the characteristics of the separate proteins we added a flexible linker sequence to separate the two protein domains (DNA sequence: ggctcctccggc. Amino acid sequence: GSSG). To improve imaging, the dCas13a - GFP construct was sequesteredTo reduce background noise, unbound dCas13a - GFP should be stored in the nucleus. This allows the assumption that any dCas13a moving out the nucleus is tracking its target mRNA. To ensure that unbound dCas13a moves from the cytosol (where it’s translated) to the nucleus, nuclear localization sequences (NLS, DNA sequence: cccaagaaaaaacgcaaggtg, amino acid sequence: PKKKRKV) were added on the N-terminal and the C-terminal of the protein.
BBa_K2340001
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is GAAAGCAATGCTATCACCTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints.
BBa_K2340002
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TTTGGGGGATGCTCGCTCCA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340003
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is GAAAGCAATGCTATCACCTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340004
RAB13 guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to RAB13 is AAGTGTTGTTGAAGTTGTCC. This is one of RAB13 guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340005
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is CTCCTTGATGCTTTTCATCC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340006
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is AGTAACAGAATAAATCAGTG. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340007
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TCTGTGCATCCGTCAGGGTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340008
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is ACATTTCCTCACTTCCCTGA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340009
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is ACCCAAATTCCCAAAATGTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340010
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is CCACCCCAGCAGCACCCTCA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints
BBa_K2340011
Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TCAAAAGAGGAAGGTGAATG. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints