Team:SSTi-SZGD/Experiments
SSTi-SZGD
Transformation
•The lyophilized powder is centrifuged first. Open the lid by adding 40 μl of ultrapure water to dissolve, mix well and collect the liquid again by centrifugation.
Transformation
1.Take 2 ul of the plasmid into the 100 ul competent cells, put in the ice for 30 minutes.
2.Followed by a water bath at 42℃ for 45 seconds and then for 1 minute in ice.
3.The whole volume was transferred to 890 ul SOC medium and cultured at 37 ℃ for one hour.
4.Centrifuge 5000 rpm, 5 minutes，discard the supernatant.
5.The cells were disrupted with 100 ul of LB liquid, coated on LB-resistant plates containing 800 mg / mL streptomycin.
6. 37 ℃ first culture for an hour, and then upside down culture about 16 hours.
Colony PCR
•Primer
①VF1
AGTTGGAACCTCTTACGTGC
②supernova-colony-R
CGTACTGGATCAGGTGGCAG
③mhei-colony-R
CCATGTTATCCTCCTCGCCC
④SB-prep-3P-1
GCCGCTGCAGTCCGGCAAAAAA
⑤SB-prep-2Ea
ATGAATTCCAGAAATCATCCTTAGCG
1.Take 2 ul of the plasmid into the 100 ul competent cells, put in the ice for 30 minutes.
2.Followed by a water bath at 42℃ for 45 seconds and then for 1 minute in ice.
3.The whole volume was transferred to 890 ul SOC medium and cultured at 37 ℃ for one hour.
4.Centrifuge 5000 rpm, 5 minutes，discard the supernatant.
5.The cells were disrupted with 100 ul of LB liquid, coated on LB-resistant plates containing 800 mg / mL streptomycin.
6. 37 ℃ first culture for an hour, and then upside down culture about 16 hours.
•Perform PCR with Takara Taq enzyme （total 20 ul）
•Program
Bio-brick PCR
•Primer
①mheI-F
GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGAACTTTGTGCTG
②mheI-R
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTAACCCAGCGCCGCCAG
③LEV-F
GTTTCTTCGAATTCGCGGCCGCTTCTAG ATGAAAGCGTTAACGGCC
④LEV-R
GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TCATTCCGTTTCGCACTGG
•Perform PCR with Takara Taq enzyme （total 20 ul）
•Program
Light induction & Extraction of periplasmic/cytoplasmic protein
Light induction
1.Sub-cultures were grown overnight to added suitable the concentration of antibiotics in 5ml LB and used to inoculate 30ml LB liquid to a starting OD600 of 0.5, cells were shaking culture at 37℃.
2.When cultures reached a cell density of 1.0~2.0, used silver paper to make the culture be in dark ambient induce recombinant protein expression.
Extraction of periplasmic protein
1.Cells were fractionated to yield cytoplasmic by the cell lysis solution ,and periplasmic samples by the Arginine buffer as follows, the E.coil strain cell medium by centrifugation 10000rpm, 5 min.
2.The 1 g cell added 10ml concentration of arginine buffer 0.4mol/L ,pH8.0.
3.After extracting time 45 min on the ice by the centrifugation 10000rpm, the supernatant is periplasmic .
Extraction of cytoplasmic proteins
1.We used “Soluble protein solution” to extract the cytoplasmic, used in this study was composed of 0.0625mol/L Tris- HCl, the ph was adjusted to 6.8 , 2% (w/v) SDS, 10%(w/v) glycerol and 5% 2-mercaptoethanol were obtained extract .
2.Take the strain centrifugation 10000rpm,5min at 4℃, 15ml PB wash cell, centrifugation by the bacterium suspension, discard the supernatant,
3.Repeat that steps twice.
4.Added 200ul to soluble protein solution, to make the bacteria fully suspended and,10min boilingwater to make it inactive.
5.Centrifugation 12000rpm,15min collect supernatant, keep at -20℃.
Enzyme activity detection
1.OPH periplasm enzyme acitvity
•OPH activity assay mixtures (1 mL, 3% methanol) contained 5 μl paraoxon (added from a 10 mg/mL methanol stock solution), 870 μL of 50 mM Tris-HCl buffer (pH 7.4), and 100 μL of cells.
•The enzyme activity was measured using a UV/VIS spectrophotometer at 37℃ by monitoring the increases of linear optical density over time at 405 nm as parathion was hydrolyzed to p-nitrophenol (ε405=17,700 M-1 cm-1). Activities were expressed as units (1 μmol of p-nitrophenol formed per minute) per ml (total reaction volume).
Enzyme activity stability
1. OPH Stability Study of Resting Cultures
•Cells were grown in 30 mL of LB medium supplemented with dark condition to induce and
•100μg/m Lpenicillin-streptomycin for 20 h, washed twice with 50 mL of 150 mM NaCl solution,
•Resuspended in 5 mL of 100 mM phosphate buffer (pH 7.4), and incubated in a shaker at 30 ℃.
•Over a 2-week duration, 0.1 mL of sample was removed each day.
•Samples were centrifuged and resuspended in 0.1 mL of 100 mM phosphate buffer (pH 7.4).
HPLC
1.The collection and preparation of samples
Will be back to the sample all poured on the glass plate, paved into a thin layer, in the shade to make it slowly dry. The dried sample was crushed with a glass rod and passed through a 2 mm sieve to remove more than 2 mm of gravel and plant residue. The samples were repeated by four-fold shrinkage, and finally left enough to analyze the sample, and then further with a glass mortar to be ground, all through the 60 mesh metal screen. Sieve the sample, shake well, bottling analysis.
2.Sample preparation
10g of the soil sample was extracted with 15 mL of methanol: ddH₂O solution (4: 1, v / v) and the mixture was shaken at 200 rpm for 15 minutes. The sieve was then rotated and centrifuged at 6000 g for 5 minutes. The precipitate was treated three times in the same manner and all supernatants were added together. 20 mL of petroleum ether was added to the supernatant to remove lipophilic impurities and the mixture was shaken at 200 rpm for 20 minutes and then the petroleum ether phase , The remaining solution was dried over anhydrous sodium sulfate and evaporated at room temperature with a vacuum rotary evaporator. The residue was redissolved in 5 mL of methanol, mixed thoroughly in an ultrasonic bath for 5 minutes and analyzed by HPLC.
3.Analysis conditions
The mobile phase was methanol: ddH 2 O (4: 1, v / v) at a flow rate of 1.0 mL min -1. MBC, 2-AB and 2-HB were detected at 230 nm by UV-900 detector.
4.Standard working solution preparation
Accurately weighed carbendazim (2-AB / 2AB / p-nitrophenol) standard 0.001g, take 1ml of methanol dissolved 1mg / mL single standard stock solution, take the stock solution 100ul plus methanol 900ml diluted to 100ug / mL Standard working fluid.
5.Methyl parathion standard solution preparation work
(100 μg • mL -1) 0.5 mL to 10.0 mL volumetric flask, acetone constant volume (concentration of 5 μg • mL, dilution and preparation of 0.1,0.2,0.5,1.0,2.0 μg • ML -1 organic phosphorus standard series solution.
