Team:Worldshaper-XSHS/Protocols-methods.html

Plasmid Construction

In our experimental design, plasmid construction is the basis of all work.In the construction of plasmid, we mainly did the following work:

Obtain the desired plasmid from the distribution kits:

1.With a pipette tip, punch a hole through the foil cover into the corresponding well of the part that we want.

2.Pipette 10µL of dH2O (distilled water) into the well. Pipette up and down a few times and let sit for 5 minutes to make sure the dried DNA is fully resuspended. The resuspension will be red, as the dried DNA has cresol red dye.

3.Transform 1µL of the resuspended DNA into competent cells, plate the transformation with the appropriate antibiotic* and grow overnight.

4.Pick a single colony and inoculate broth (again, with the correct antibiotic) and grow for 16 hours.

5.Use the resulting culture to miniprep the DNA and make our own glycerol stock.

Using the miniprepped DNA to run QC tests, such as restriction digests and sequencing.

glycerol stock

1.Add 1 ml of 50% glycerol in H ₂ O to a cryogenic vial.

2.Add 1 ml sample from the culture of bacteria to be stored.

3.Gently vortex the cryogenic vial to ensure the culture and glycerol is well-mixed.

4.Use a tough spot to put the name of the strain or some useful identifier on the top of the vial.

5.On the side of the vial list all relevant information - part, vector, strain, date, researcher, etc.

6.Store in a freezer box in a -80 ℃ freezer.

Make Competent Cells

1.Add 200μL E.coli DH5 alpha to LB medium and row the cells on a shaker at 37 ℃ for 4 hours

2.Take 1.5mL of the culture product and add it to the EP tube. Centrifuge at 4000rpm for five minutes 4 ℃ . Discard the liquid and add 0.6ml of CaCl ₂ solution.

Ice bath After 30 minutes

3.Centrifuge at 4000rpm for five minutes 4 ℃ . Discard the liquid and add 80μL of CaCl2 solution

Single Tube Transformation

1.Thaw competent cells on ice

2.Pipette 3µl of resuspended DNA into 100µl thawed cells. Gently pipette up and down a few times. Keep all tubes on ice.

3.Incubate on ice for 30min.

4.Heat shock tubes at 42°C in water bath for 45 sec.

5.Incubate on ice for 5min.Return transformation tubes to ice bucket.

6.Pipette 600µl LB media to the transformation.

7.Incubate at 37°C for 1 hours, shaking at 120rpm

8.Pipette 100µL of each transformation onto petri plates Spread with sterilized spreader immediately.

9.Spin down cells at 4000rpm for 3mins and discard 400µL of the supernatant. Resuspend the cells in the remaining 100µL, and pipette the transformation onto petri plates Spread with sterilized spreader.

10.Incubate transformations overnight (14-18hr) at 37°C: Incubate the plates upside down (agar side up).

Colony PCR

1.Prepare several 1.5mL Eppendorf tubes with 100μL ddH2O(double-distilled water) in each.

2.Using pipette tips, pick several single colonies from the agar gel medium into individual tubes. Fully vortex the mixture to suspend the bacterium.

3.Make up a 50μL PCR system in PCR tubes(25μL PCR Mix Master, 11μL ddH2O, 10μL suspension and 2μL of each primer)

4.Set the PCR protocol to “Colony PCR” *, place the tubes into the PCR machine and lock the heat cover. Start the protocol.

*Protocol of Colony PCR: 94 ℃ preheating for 5 minute;20-30 replicates of these steps: 94 ℃ heating for 30 seconds, 50-60 ℃ annealing for 30 seconds and 72 ℃ extending for 1-3 minutes(at a speed of ab0ut 1 kbp/min) ； keep the products at the temperature of 10 ℃ .

Plasmid DNA extraction （ Sangon® ）

1.Transfer 1.5mL of the culture to a Eppendorf tube. Centrifuge at 8000rpm for 5 minutes. Discard the supernatant. Add 280μL of resuspension solution(P1 buffer). Completely resuspent cell pellet.

2.Add 200μL of lysis solution(Buffer P2) and mix gently. Set aside for 1 minute.

3.Add 200 μL of neutralizing solution(P3 buffer) and mix by inverting the tubes for 5-10 times.

4.Centrifuge at 12000rpm for 10 min and carefully transfer the supernatant to a adsorption column. Centrifuge at 8000rpm for 30sec, and remove the supernatant.Add 500μL of DW1 Buffer and centrifuge at 8000rpm for 30sec.

5.Add 500μL of Wash Solution and centrifuge at 9000rpm for 30sec. Repeat twice.

6.Centrifuge for 1min and open the lid for 1min to make the alcohol evaporate completely. Move the adsorption column to a new Eppendorf tube and add 30 μL of TE solution to obtain the plasmid DNA.

Gel extraction

1.Cut the DNA stripes from the gel under the UV light （ keep the gel thin when you make it. ）

2.Use Sangon® Gel Extraction Kit to extract target sequence from the gel just cut off.

Utilize PCR to acquire target sequences

PCR system:

2*Master Mix 5μL

ddH2O 3μL

Template 1μL

Forward primer 0.5μL

Reverse primer 0.5μL

10μL

PCR procedure

94 ℃ 5min

30cycles(94 ℃ 30s,50 ℃ 30s,72 ℃ 1kb/min ）

72 ℃ 5min

10 ℃

Plasmid N Construction

(A)Plasmid pXS-Nit1 Construction

1. Pipette bacteria E. coli with pSB1C3 -BFP, pSB1C3-terminator plasmids into 5ml of LB.

2. Extract each of plasmids from 3mL of bacteria E. coli, eluting with 60uL of elution buffer, respectively. Withdraw 3uL of each of elution productions for identification by running through electrophoresis. The electrophoresis results are shown in Figure 1. (lane 3 and 4).

Figure 1. The electrophoresis results for each plasmid

Lane 1: pSB1C3-RBS,Lane 2:pSB1C3-RFP

Lane3: pSB1C3-BFP,Lane 4:pSB1C3-Ter, Lane 5:pSB1C3-P-promo

3. Restriction digest system pSB1C3-BFP (SpeI + PstI) (43uL of plasmid, 5uL of buffer, 1uL of enzyme Spel, 1ul of enzyme Pstl).

4. Take 3uL of pSB1C3-BFP enzyme digestion product for electrophoresis; the results were shown in Figure 2. (lane 3 and 4). The outcome indicates the success of the enzyme digestion. Purify the enzyme digestion products of pSB1C3-BFP, eluting with 30uL of buffer.

Figure 2. The result of enzyme digestion

Lane 1: pSB1C3-RBS,Lane 2:pSB1C3-RFP

Lane3: pSB1C3-BFP,Lane 4:pSB1C3- BFP

5.Run enzyme digestion on PSB1C3-ter (XbaI + PstI) to receive 50uL of product sample. The electrophoresis result is exhibited in Figure 3. Cut out the Ter stripes under UV light environment. Purify the DNA Ter and elute by 30uL of buffer. Use electrophoresis to determine the production of step 4 and the gel extraction. The electrophoresis image is shown in Figure 4.

Figure 3. The electrophoresis result of enzyme digestion PSB1C3-ter (XbaI + PstI)

Figure4. The production of step 4 and the gel extraction production of step 5

Lane 1: pSB1C3-BFP,Lane 2:ter

6. 1inkage system (7uL of ter, 1uL of pSB1C3- BFP). Allow the reaction to run for 6 hours at 16 ℃ .

7. The product of the former reaction transforms competent E.coli. Withdraw 50uL of transformed production and spread on agar plates. Centrifuge and discard supernatant. Slightly pipette to resuspend the bacteria. Spread the bacteria on new agar plates.

8. Allow the bacteria to grow overnight (the result is shown in Figure 5.) Pick 10 units of colonies. Each colony is overnight cultured in 1mL of LB.

Figure 5: bacterial cultures grown overnight

Left: non-concentrated, Right: concentrated

9. Run colony PCR to identify each of the final plasmids. Take the PCR product #2 as an example (the electrophoresis image is shown in Figure 6). The result shows that the PCR product exceed 1000 bp. Therefore, it is diagnosed as a positive clone.

Figure6: The result of colony PCR for #2 plasmid pXS-Nit1

10. Extract 500 uL of #2, 4, and 6 bacterium, respectively. Each extract recombinant plasmid is experimented by electrophoresis (the electrophoresis image is shown in Figure 7.) Each plasmid is run through restriction digestion. The products is run by electrophoresis, which each product turns out to be two stripes. The combination of these two stripes determines the bacteria is a positive clone. (the electrophoresis diagram is shown in FIG. 8).

Figure7: The plamid extracted from #2, 4, and 6 bacterium

Figure8: The result of enzyme digestion

(B) Plasmid pXS-Nit3 Construction

1.Inoculate No. 2, No.4 and No. 6 pXS-Nit1 plasmids (50ul each) into 5ml liquid LB media to incubate overnight;

2.Mini-prepping No. 2 and No.4 plasmids from 3ml overnight culture, respectively. Wash out DNA with 60ul buffer. Use EcoRI and XbaI to cut No.2 pXS-Nit1 plasmid with total reaction solution volume up to 50ul, purify the plasmids and wash them out with 30ul buffer;

Transform pUC 57-N-promo constructed by company into E.coli and pick 3 single colonies to culture;

3.Mini-prepping plasmids and run agarose gel electrophoresis for identification (Fig. 9);

Figure 9: agarose gel electrophoresis for pUC 57-N-promo

4.Use EcoRI and SpeI to cut No.1 pUC 57-N-promo plasmid with total reaction solution volume up to 100ul (plasmid 60ul, ddH2O 27ul, restriction enzyme 1.5ul each, buffer 10ul);

Run agarose gel electrophoresis of DNA restriction digest (6ul for loading) with original (uncut) pUC 57-N-promo plasmid as control (Fig. 10), load residual DNA restriction digestion to agarose gel (Fig. 11). Purify plasmid N-promo from agarose gel and wash out plasmids with 30ul buffer;

Figure10: The production of DNA restriction digestion of pUC 57-N-promo

Lane 1: digestion result; Lane 2: without digestion

Figure 11: agarose gel electrophoresis for residual DNA restriction digestion

Figure 12: agarose gel electrophoresis for pXS-Nit1 restriction digestion and plasmid N-promo restriction digestion

Lane 1: pXS-Nit1 restriction digestion;Lane 2: plasmid N-promo restriction digestion

5.Run agarose gel electrophoresis of both plasmid pXS-Nit1 restriction digestion and plasmid N-promo restriction digest to identification (Fig. 12);

6.Ligation system (plasmid pXS-Nit1 1ul, plasmid N-promo 7ul);

7.Transform plasmid into competent cell, spread 100ul of the cells on plates before dilution, then spread 100ul of the cells on another plate after 10 times dilution;

8.Incubate overnight (Fig. 13), pick 6 single colonies and overnight culture in 1ml liquid LB media;

Figure 13: bacterial cultures grown overnight

Left: undiluted; Right: diluted 10 times

9.Perform colony PCR identification of 6 single colonies of plasmid pXS-Nit3 with plasmid pXS-Nit1 as control and run agarose gel electrophoresis, which shows all 6 single colonies are positive results (Fig. 14);

Figure 14: agarose gel electrophoresis for colony PCR

Lane1-6: 6 single colonies of plasmid pXS-Nit3; Lane 7: plasmid pXS-Nit1

10.Inoculate No. 2 and No. 6 colony (50ul each) to 5ml liquid LB media to incubate overnight, respectively;

11.Mini-prepping No. 2 and No.6 pXS-Nit3 plasmid, wash out with 60ul buffer, then target expressi0n plasmid was constructed completely. Run agarose gel electrophoresis with 2ul sample to confirm (Fig. 15);

Figure 15: agarose gel electrophoresis for pXS-Nit3

Lane 1: No. 2 pXS-Nit3 plasmid ; Lane 2: No.6 pXS-Nit3 plasmid

Plasmid P Construction

(A)Plasmid pXS-Pho1 Construction

1.Mini-prepping plasmid pSB1C3-promoter and pSB1C3-RBS, then run agarose gel electrophoresis to confirm (Fig. 1, lane 1 and 5)

2.Enzyme restriction system (plasmid 43 ul, buffer 5ul, enzyme 1ul each);

3.Run agarose gel electrophoresis for restriction digest (3ul for loading) of plasmid pSB1C3-RBS (cut by EcoRI and XbaI), result show successful restriction (Fig.2, lane 1). Purify restriction digest and wash DNA out in 30ul buffer;

4.Load 50ul of pSB1C3-P-promoter restriction digest (cut by EcoRI and SpeI) for agarose gel electrophoresis (Fig. 16), then purify it from gel collection and wash out in 30ul buffer. Run gel collection from restriction digest of plasmid pSB1C3-RBS and plasmid P-promoter to confirm (Fig. 17);

Figure 16: agarose gel electrophoresis for plasmid pSB1C3-promo restriction digestion

Figure 17: gel collection from restriction digest of plasmid pSB1C3-RBS and plasmid P-promoter

Lane 1: pSB1C3-RBS; Lane 2: P-promoter

5.Ligation system (P-promoter plasmid 6ul, PSB1C3-RBS 2ul), 16°for 6 hours;

6.Transform plasmid into competent cell, spread 50ul of the cells on plates before and after concentration, respectively;

7.Incubate overnight, colonies showed as Fig. 18, pick 10 single colonies and overnight culture in 1ml liquid LB media;

Figure 18: bacterial cultures grown overnight

Left: unconcentrated; Right: concentrated

Figure 19: agarose gel electrophoresis for colony PCR

Lane1: No. 6 pXS-Pho1 plasmid; Lane 2: No. 5 pXS-Pho1 plasmid

8.Perform colony PCR identification, agarose gel electrophoresis result of No. 5 and No. 6 pXS-Pho1 plasmid are showed in Fig.19 as examples. DNA size of No.5 plasmid is 750-1,000 bp, which implies positive colony, while No. 6 plasmid is 250-500bp, which implies negative colony.

9.Perform further identification of No. 6 and 8 pXS-Pho1 plasmids, purify and run agarose gel electrophoresis (Fig. 20). Then do enzyme restriction digestion of 2 pXS-Pho1 plasmids with EcoRI and PstI at both sides of P-promo-RBS fragment (30ul reaction volume). Agarose gel electrophoresis result shows positive results (Fig. 21);

Figure 20: agarose gel electrophoresis for plasmid pXS-Pho1

Figure 21: agarose gel electrophoresis for plasmid pXS-Pho1 restriction digestion

Lane 1: No. 6 pXS-Pho1 plasmids ; Lane 2: No. 8 pXS-Pho1 plasmids

(B)Plasmid pXS-Pho2 Construction

1.Mini-prepping plasmid pSB1C3-RFP and run agarose gel electrophoresis for identification (Fig. 1, lane 2);

2.Enzyme restriction digest (by SpeI and PstI, plasmid 43ul, buffer 5ul, restriction enzyme 1ul each);

3.Run agarose gel electrophoresis for restriction digest (3ul for loading), and result show successful restriction (Fig.2, lane 2). Purify restriction digest and wash DNA out in 30ul buffer, run gel collection from restriction digest of plasmid pSB1C3-RFP and plasmid terminator to confirm (Fig. 22);

Figure 22: gel collection from restriction digest

Lane 1: pSB1C3-RFP; Lane 2: terminator

4.Ligation system (plasmid terminator 7ul, plasmid PSB1C3-RFP 1ul ), 16°for 6 hours;

Transform plasmid into competent cell, spread 50ul of the cells on plates before and after concentration, respectively;

5.After overnight culture, the plate with concentrated cells are full of colonies, the colonies on unenriched plate is perfect for single colony selection, show as Fig. 23. Pick 10.single colonies, respectively and put them into 1ml liquid LB media to culture overnight;

Figure 23: bacterial cultures grown overnight

Left: unconcentrated; Right: concentrated

6.Perform colony PCR identification, agarose gel electrophoresis result of No. 3 pXS-Pho2 plasmid PCR product is showed in Fig.24 as example. DNA size of No.3 plasmid is a little higher than 1000 bp size DNA of the ladder, which implies positive colony;

Figure 24: colony PCR identification for No. 3 pXS-Pho2 plasmid

7.Perform further identification of No. 3, No.7 and 9 of pXS-Pho2 plasmids, purify from 500ul harvest and run agarose gel electrophoresis (Fig. 25). Then do enzyme restriction digestion at both sides of RFP-ter fragment plasmid with XbaI and PstI (30ul reaction volume). Load 10ul DNA of restriction digestion and run agarose gel electrophoresis result shows 2 bands and implies positive results (Fig. 26);

Figure 25: agarose gel electrophoresis for pXS-Pho2 plasmids

Figure 26: agarose gel electrophoresis for plasmid pXS-Pho2 restriction digestion

Lane 1: No. 3 pXS-Pho2 plasmid; Lane 2: No. 7 pXS-Pho2 plasmid; Lane 3: No. 9 pXS-Pho2 plasmid

(C) Plasmid pXS-Pho3 Construction

1.Inoculate No. 6 and No.8 of pXS-Pho1 plasmids, No. 3, No.7 and No.9 of pXS-Pho2 plasmids (50ul each) into 5ml liquid LB media to incubate overnight;

2.Mini-prepping No. 6 and No.8 of pXS-Pho1 plasmids, No. 3 and No.7 of pXS-Pho2 plasmids respectively. Wash DNA out with 60ul buffer. Use SpeI and PstI to cut No.6 pXS-Pho1 plasmid and cut No. 7 of pXS-Pho2 by XbaI and PstI with total reaction solution volume up to 50ul, respectively. Run agarose gel electrophoresis for restriction digest of pXS-Pho1 (3ul for loading, Fig.27). Purify restriction digest and wash them out with 30ul buffer; Run agarose gel electrophoresis for restriction digest of pXS-Pho2 plasmid (50ul for loading, Fig. 28), collect DNA from gel and wash out in 30ul;

Figure 27: agarose gel electrophoresis for plasmid pXS-Pho1 restriction digestion

Figure 27: agarose gel electrophoresis for plasmid pXS-Pho2 restriction digestion

3.Load 3ul pXS-Pho1 plasmid from gel purification and run agarose gel electrophoresis, result is showed in Fig.29 with DNA size around 2,500 bp, run agarose gel electrophoresis for 2ul of Pxs-Pho2 plasmid, result shows DNA size as 800bp (Fig.29)

Figure 28: agarose gel electrophoresis for gel purification of pXS-Pho1 and pXS-Pho2

Lane 1: pXS-Pho2; Lane 2: pXS-Pho1

4.Ligation system (plasmid pXS-Pho1 2ul, plasmid ter-RFP 6ul, buffer 1ul, ligation enzyme 1ul ), 16°for 5 hours;

5.Transform plasmid into competent cell, spread 50ul of the cells on plates to incubate overnight before and after concentration, respectively;

6.Culture overnight, the colonies are showed in Fig. 30, pick 10 single colonies to 1ml liquid LB media to incubate overnight;

Figure 30: bacterial cultures grown overnight

Left: unconcentrated; Right: concentrated

7.Perform colony PCR identification, agarose gel electrophoresis result is showed in Fig. 31. DNA size is around 1000 bp size as DNA of the ladder, which implies positive colony;

Figure 31: agarose gel electrophoresis for colony PCR

8.Perform further identification of No. 1, No.5 and 7 single colonies, purify from 500ul harvest and run agarose gel electrophoresis (Fig. 25). Then do enzyme restriction digestion with EcoRI and SpeI (30ul reaction volume). Load 20ul DNA of restriction digestion and run agarose gel electrophoresis result shows 2 bands and implies positive results (Fig. 32);

Figure 32: agarose gel electrophoresis for plasmid pXS-Pho3 restriction digestion
Lane 1: No. 1 colony; Lane 2: No. 5 colony; Lane 3: No. 7 colony

9.Inoculate No. 5 and No. 7 colony (50ul each) to 5ml liquid LB media to incubate overnight, respectively;

10.Mini-prepping No. 5 and No. 7 plasmid from 3ml culture harvest, wash out with 60ul buffer, then target expressi0n plasmid was constructed completely. Run agarose gel electrophoresis with 2ul sample to confirm (Fig. 33);

Figure 33: agarose gel electrophoresis for plasmid pXS-Pho3

Lane 1: No. 5 plasmid pXS-Pho3; Lane 2: No. 7 plasmid pXS-Pho3

Plasmid O Construction

(A)Plasmid pXS-Oxy1 Construction

1.Get biobrick BBa_E0840 with GFP and biobrick BBa_K561001 with VGB promoter from the plate

2.Transform above mentioned biobricks into DH5 α (see section Single Tube Transformation), plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping (see section mini-prepping)

3.Cut biobrick BBa_E0840 with XbaI and PstI, 37 ℃ for 30 mins, ice bath 5 mins

Restriction digest system as below:

pSB1C3-GFP 43μL

XbaI 1μL

PstI 1μL

10Buffer(M) 5μL

Total 50μL

4.Run DNA gel for restriction digest product

5.Extract DNA from the gel (see Gel extraction)

6.Cut biobrick BBa_ K561001 with SpeI and PstI

Restriction digest system as below:

pSB1C3- vgb promoter 43μL

SpeI 1μL

PstI 1μL

10Buffer(M) 5μL

Total 50μL

7.Run DNA gel for restriction digest product

8.Extract DNA from the gel

9.Ligate DNA product from step 5 and step 8 with T4 DNA Ligase, 23 ℃ for 1 hour, ligation system as below:

10x Reaction buffer 2uL

T4 DNA ligase 0.5μL

Step 5 product 5 μL

Step 8 product 12.5μL

Total 20 μL

10.Transform ligation product into DH5 α , plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping to get the target plasmid

11.Cut target plasmid with XbaI and PstI for identification (2 DNA fragments: 1,069bp and 2,000bp are expected results)

Restriction digest system as below:

Target plasmid 16μL

XbaI 1μL

PstI 1μL

10Buffer(M) 2μL

Total 20μL

12.Run DNA gel for restriction digest product, result is below(Fig. 34):

Figure 34: agarose gel electrophoresis for restriction digest product

13.Perform PCR for identification, PCR reaction system as above.

Primer sequence

F: 5’- ATTAAAGAGGAGAAATACTAGATGCGTAAAGG -3’ （ 32bp ）

R: 5’- ATTACCGCCTTTGAGTGAGC -3’

Amplification length: 1052bp

14. Run DNA gel for PCR product(Fig. 35).

Figure 35: DNA gel for PCR product

(B)Plasmid pXS-Oxy2 Construction

1.Get biobrick BBa_ K145001 from the plate

2.Transform above mentioned biobrick into DH5 α , plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping

3.Cut biobrick BBa_ K145001 with XbaI and PstI (2 DNA fragments: 2,677bp and 2,052bp are expected results), 37 ℃ for 30 mins, ice bath for 5 mins

Restriction digest system as below:

pSB1C3-T7 polymerase 43μL

XbaI 1μL

PstI 1μL

10Buffer(M) 5μL

Total 50μL

4.Run DNA gel for restriction digest product, result as below(Fig. 36)

Figure 36: restriction digest of T7 RNA polymerase

5.Extract DNA fragment with 2677bp size from the gel

6.Cut biobrick BBa_ K561001 with SpeI and PstI

Restriction digest system as below:

pSB1C3- vgb promoter 43μL

SpeI 1μL

PstI 1μL

10Buffer(M) 5μL

Total 50μL

7.Run DNA gel for restriction digest product and extract DNA from the gel

8.Ligate DNA product from step 5 and step 7 with T4 DNA Ligase, 23 ℃ for 1 hour, ligation system as below:

10x Reaction buffer 2uL

T4 DNA ligase 0.5μL

Step 5 product 5 μL

Step 7 product 12.5μL

Total 20 μL

9.Transform ligation product into DH5 α , plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping to get the target plasmid

10.Cut target plasmid with XbaI and PstI for identification (2 DNA fragments: 2,798bp and 2,052bp are expected results)

Restriction digest system as below:

Target plasmid 16μL

XbaI 1μL

PstI 1μL

10Buffer(M) 2μL

Total 20μL

11.Run DNA gel for restriction digest product, result is below(Fig. 37):

Figure 37: DNA gel for restriction digest

Lane1: restriction digest of plasmid pXS-Oxy2;Lane 2:double enzyme (XbaI and PstI) restriction digest of plasmid pXS-Oxy1;

(C)Plasmid pXS-Oxy3 Construction

1.Synthesize the forward primer which contained the T7 promoter (5’TAATACGACTCACTATAGGG3’) and a part of GFP sequence(5’ ATTAAAGAGGAGAAATACTAGATGCG3’):

5’GCTCTAGATAATACGACTCACTATAGGGATTAAAGAGGAGAAATACTAGATGCG3’

and reverse primer of sequence at GFP downstream

R:5’- ATTACCGCCTTTGAGTGAGC -3’

2.Perform PCR amplification

3.Ligate PCR product with T vector

4.Cut ligation product with XbaI and PstI

5.Extract DNA fragment with 916bp size from gel

6.Cut plasmid pXS-Oxy2 with XbaI and PstI

7.Extract DNA fragment with 2,052bp size from gel

8.Ligate DNA product from step 5 and step 7 with T4 DNA Ligase

9.Transform ligation product into DH5 α , plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping to get the target plasmid

10.Cut target plasmid with XbaI and PstI for identification (2 DNA fragments: 916bp and 2,052bp are expected results)

Restriction digest system as below:

Target plasmid 16μL

XbaI 1μL

PstI 1μL

10Buffer(M) 2μL

Total 20μL

11.Run DNA gel for restriction digest product

(D)Plasmid pXS-Oxy4 Construction

1.Cut plasmid pXS-Oxy3 with XbaI and PstI

2.Extract DNA fragment with 916bp size from gel

3.Cut plasmid pXS-Oxy2 with SpeI and PstI

4.Extract DNA fragment with 4,846bp size from gel

5.Ligate DNA product from step 2 and step 4 with T4 DNA Ligase

6.Transform ligation product into DH5a, plating the culture on a dish and pick single colony after overnight culture, incubate single colony overnight and then make mini-prepping to get the target plasmid

7.Cut target plasmid with XbaI and PstI for identification (2 DNA fragments: 3,710bp and 2,052bp are expected results)

Restriction digest system as below:

Target plasmid 16μL

XbaI 1μL

PstI 1μL

10Buffer(M) 2μL

Total 20μL

8.Use XbaI and PstI to do single enzyme restriction of target plasmid for identification, respectively

9.Run DNA gel for restriction digest product, result is showed as below(Fig. 38)

Figure 38: DNA gel for restriction digest product

Lane 1: GFP PCR;Lane 2: Single enzyme restriction digestion by PstI;Lane 3: Double enzyme restriction digestion by XbaI and PstI;Lane 4: Single enzyme restriction digestion by XbaI;Lane 5: Plasmid pXS-Oxy4

Functional analysis for Plasmid pXS-Oxy1 and Plasmid pXS-Oxy4

1. take 18 50mL centrifuge tubes and labeled them from 1 to 18. Each centrifuge tube was added with 15mL LB medium, 15 μL chloramphenicol.

2. Take tube1-6 and inoculate 100 μL Oxy1 strain (DH5a transformed with plasmid pXS-Oxy1) in each tube, and sealed with a lid. In the centrifuge tubes numbered 7-12, 100μL Oxy4(DH5a transformed with plasmid pXS-Oxy4) strains were inoculated and sealed with a lid. 13-18 of the centrifuge tubes were inoculated with 100 L Oxy4 strain, but unsealed(use a gas-permeable membrane).

3. Take a sample every two hours and store on the ice. Oxygen concentration was measured by an oxygen electrode. (each sampling and measuring operation takes ab0ut 5 minutes).

4. all samples were added to a 96 well plate, and the corresponding OD600 value and fluorescence intensity value were read out by plate reader.

Team:Worldshaper-XSHS/Protocols-methods.html

Protocols and methods