Difference between revisions of "Team:Bielefeld-CeBiTec/Project/unnatural base pair/preservation system"

m
Line 18: Line 18:
 
Due to tautomerisation of isoG and hydrolysis of isoC<sup>m</sup> there is a need for a system, to preserve the unnatural base pair&nbsp;(UBP) on the plasmid. In 2017, Zhang&nbsp;<i>et&nbsp;al</i>. successfully deployed a CRISPR (<i>clustered regularly interspaced short palindromic repeat</i>)-Cas9 system for retention of a UBP. We adapted this conservation system to our UBP and thus used the bacterial immune response to eliminate all plasmid DNA that had lost the UBP.  
 
Due to tautomerisation of isoG and hydrolysis of isoC<sup>m</sup> there is a need for a system, to preserve the unnatural base pair&nbsp;(UBP) on the plasmid. In 2017, Zhang&nbsp;<i>et&nbsp;al</i>. successfully deployed a CRISPR (<i>clustered regularly interspaced short palindromic repeat</i>)-Cas9 system for retention of a UBP. We adapted this conservation system to our UBP and thus used the bacterial immune response to eliminate all plasmid DNA that had lost the UBP.  
 
<br>
 
<br>
−
The nuclease Cas9 is part of the adaptive immune system of <i>Streptococcus pyogenes</i>, where it induces double strand breaks in the genomic DNA. This enzyme is recruited  by a CRISPR&nbsp;RNA&nbsp;(crRNA). A crRNA consists of direct repeats interspaced by variable sequences called protospacer. Those protospacers are derived from foreign DNA and encode the Cas9 guiding sequence&nbsp;(guide RNA). An auxiliary transactivating crRNA (tracrRNA) helps processing the precursor crRNA array into an active crRNA that contains the 20 nucleotide guide RNA. The guide RNA binds to the complementary genomic DNA sequence via Watson-Crick base pairing. For this binding, the genomic DNA sequence needs to be located upstream of a CRISPR type II specific 5’&#x2001;NGG&nbsp;protospacer&nbsp;adjacent&nbsp;motif&nbsp;(PAM). To combine crRNA and tracrRNA a chimeric single&nbsp;stranded&nbsp;guide&nbsp;RNA&nbsp;(sgRNA) was designed. Therefore, only the 20 nucleotide guiding sequence needs to be exchanged for targeting any genomic sequence followed by a PAM sequence (Ran&nbsp;<i>et al</i>., 2013 a, b). A double strand break introduced by Cas9 leads to DNA degradation by exonucleases in prokaryotic cells (Simmon and Lederberg, 1972).
+
The nuclease Cas9 is part of the adaptive immune system of <i>Streptococcus pyogenes</i>, where it induces double strand breaks in the genomic DNA. This enzyme is recruited  by a CRISPR&nbsp;RNA&nbsp;(crRNA). A crRNA consists of direct repeats interspaced by variable sequences called protospacer. Those protospacers are derived from foreign DNA and encode the Cas9 guiding sequence&nbsp;(guide RNA). An auxiliary transactivating crRNA (tracrRNA) helps processing the precursor crRNA array into an active crRNA that contains the 20 nucleotide guide RNA. The guide RNA binds to the complementary genomic DNA sequence via Watson&#x2011;Crick base pairing. For this binding, the genomic DNA sequence needs to be located upstream of a CRISPR type II specific 5’&#x2001;NGG&nbsp;protospacer&nbsp;adjacent&nbsp;motif&nbsp;(PAM). To combine crRNA and tracrRNA a chimeric single&nbsp;stranded&nbsp;guide&nbsp;RNA&nbsp;(sgRNA) was designed. Therefore, only the 20 nucleotide guiding sequence needs to be exchanged for targeting any genomic sequence followed by a PAM sequence (Ran&nbsp;<i>et al</i>., 2013 a, b). A double strand break introduced by Cas9 leads to DNA degradation by exonucleases in prokaryotic cells (Simmon and Lederberg, 1972).
 
<br>
 
<br>
 
The UBP isoG and isoC<sup>m</sup> is an orthogonal system. UBP inside the target DNA causes a mismatch to the sgRNA generally reducing the cleavage activity of Cas9&nbsp;(Zhang&nbsp;<i>et al</i>., 2017). Accordingly, Cas9 can be programmed by sgRNAs to cleave all plasmids, which had lost the UBP due to point mutations&nbsp;(Figure 1). Consequently, this leads to a retention of the UBP in the plasmids.
 
The UBP isoG and isoC<sup>m</sup> is an orthogonal system. UBP inside the target DNA causes a mismatch to the sgRNA generally reducing the cleavage activity of Cas9&nbsp;(Zhang&nbsp;<i>et al</i>., 2017). Accordingly, Cas9 can be programmed by sgRNAs to cleave all plasmids, which had lost the UBP due to point mutations&nbsp;(Figure 1). Consequently, this leads to a retention of the UBP in the plasmids.
Line 42: Line 42:
 
<article>
 
<article>
 
 
−
We designed a <i>lac</i> operon for a tight repression called <i>P<sub>lac&#x2011;tight</sub></i> to achieve a low transcription rate. The induction of the wild type <i>lac</i> operon increases the level of &#946;&#x2011;galactosidase 1000&#x2011;fold (Müller&nbsp;<i>et&nbsp;al</i>.,&nbsp;1996). As part of the <i>lac</i> operon the <i>lac</i> repressor was the first repressor isolated and sequenced in 1966 by Gilbert and Müller-Hill. The wild type <i>lac</i> operon consists of the genes <i>lacZ</i>, <i>lacY</i> and <i>lacA</i> that are transcribed from the lac promoter <i>P<sub>lac</sub></i> into a polycistronic mRNA (Figure&nbsp;4). These genes code for the proteins &#946;&#x2011;galactosidase, Lac permease and Lac transacetylase (Oehler&nbsp;<i>et&nbsp;al</i>.,&nbsp;1994).
+
We designed a <i>lac</i> operon for a tight repression called <i>P<sub>lac&#x2011;tight</sub></i> to achieve a low transcription rate. The induction of the wild type <i>lac</i> operon increases the level of &#946;&#x2011;galactosidase 1000&#x2011;fold (Müller&nbsp;<i>et&nbsp;al</i>.,&nbsp;1996). As part of the <i>lac</i> operon the <i>lac</i> repressor was the first repressor isolated and sequenced in 1966 by Gilbert and Müller&#x2011;Hill. The wild type <i>lac</i> operon consists of the genes <i>lacZ</i>, <i>lacY</i> and <i>lacA</i> that are transcribed from the lac promoter <i>P<sub>lac</sub></i> into a polycistronic mRNA (Figure&nbsp;4). These genes code for the proteins &#946;&#x2011;galactosidase, Lac permease and Lac transacetylase (Oehler&nbsp;<i>et&nbsp;al</i>.,&nbsp;1994).
 
 
 
<!-- Mittleres zentriertes Bild -->
 
<!-- Mittleres zentriertes Bild -->
Line 74: Line 74:
 
</div>
 
</div>
 
 
−
The distance of 70.5&nbsp;bp showed the strongest repression value which is 50&#x2011;fold higher than the natural repression. Repression drops sharply to 15&#x2011;fold at a 150.5&nbsp;bp spacing and to threefold at around 600&nbsp;bp. All inter-operator distances beyond 600&nbsp;bp kept a twofold increased repression value (Müller&nbsp;<i>et&nbsp;al</i>.,&nbsp;1996).
+
The distance of 70.5&nbsp;bp showed the strongest repression value which is 50&#x2011;fold higher than the natural repression. Repression drops sharply to 15&#x2011;fold at a 150.5&nbsp;bp spacing and to threefold at around 600&nbsp;bp. All inter&#x2011;operator distances beyond 600&nbsp;bp kept a twofold increased repression value (Müller&nbsp;<i>et&nbsp;al</i>.,&nbsp;1996).
 
<br>
 
<br>
 
According to these results, our <i>P<sub>lac&#x2011;tight</sub></i> consists of the auxiliary operator O<sub>id</sub> with a 70.5&nbsp;bp spacing to O1 at its natural position. The residuray sequence like the P lac was kept as the natural <i>lac</i> operon taken from <i>E.&nbsp;coli</i>&nbsp;BL21(DE3) (Figure&nbsp;7).
 
According to these results, our <i>P<sub>lac&#x2011;tight</sub></i> consists of the auxiliary operator O<sub>id</sub> with a 70.5&nbsp;bp spacing to O1 at its natural position. The residuray sequence like the P lac was kept as the natural <i>lac</i> operon taken from <i>E.&nbsp;coli</i>&nbsp;BL21(DE3) (Figure&nbsp;7).
Line 80: Line 80:
 
<!-- Mittleres zentriertes Bild -->
 
<!-- Mittleres zentriertes Bild -->
 
<div class="figure large">
 
<div class="figure large">
−
<img class="figure image" src="https://static.igem.org/mediawiki/2017/7/78/T--Bielefeld-CeBiTec--tight_lac_operon_geneious.png">
+
<img class="figure image" src="https://static.igem.org/mediawiki/2017/7/78/T--Bielefeld&#x2011;CeBiTec--tight_lac_operon_geneious.png">
 
<p class="figure subtitle"><b>Figure&nbsp;7: Tight <i>lac</i> operon <i>P<sub>lac&#x2011;tight</sub></i>.</b><br>The figure with its annotations was created with the software Geneious 10.0.8.</p>
 
<p class="figure subtitle"><b>Figure&nbsp;7: Tight <i>lac</i> operon <i>P<sub>lac&#x2011;tight</sub></i>.</b><br>The figure with its annotations was created with the software Geneious 10.0.8.</p>
 
</div>
 
</div>

Revision as of 14:14, 31 August 2017

Preservation system

Preservation system using Cas9

Due to tautomerisation of isoG and hydrolysis of isoCm there is a need for a system, to preserve the unnatural base pair (UBP) on the plasmid. In 2017, Zhang et al. successfully deployed a CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 system for retention of a UBP. We adapted this conservation system to our UBP and thus used the bacterial immune response to eliminate all plasmid DNA that had lost the UBP.
The nuclease Cas9 is part of the adaptive immune system of Streptococcus pyogenes, where it induces double strand breaks in the genomic DNA. This enzyme is recruited by a CRISPR RNA (crRNA). A crRNA consists of direct repeats interspaced by variable sequences called protospacer. Those protospacers are derived from foreign DNA and encode the Cas9 guiding sequence (guide RNA). An auxiliary transactivating crRNA (tracrRNA) helps processing the precursor crRNA array into an active crRNA that contains the 20 nucleotide guide RNA. The guide RNA binds to the complementary genomic DNA sequence via Watson‑Crick base pairing. For this binding, the genomic DNA sequence needs to be located upstream of a CRISPR type II specific 5’ NGG protospacer adjacent motif (PAM). To combine crRNA and tracrRNA a chimeric single stranded guide RNA (sgRNA) was designed. Therefore, only the 20 nucleotide guiding sequence needs to be exchanged for targeting any genomic sequence followed by a PAM sequence (Ran et al., 2013 a, b). A double strand break introduced by Cas9 leads to DNA degradation by exonucleases in prokaryotic cells (Simmon and Lederberg, 1972).
The UBP isoG and isoCm is an orthogonal system. UBP inside the target DNA causes a mismatch to the sgRNA generally reducing the cleavage activity of Cas9 (Zhang et al., 2017). Accordingly, Cas9 can be programmed by sgRNAs to cleave all plasmids, which had lost the UBP due to point mutations (Figure 1). Consequently, this leads to a retention of the UBP in the plasmids.

Figure 1: UBP conservation system using Cas9.
sgRNAs are targeted against every possible DNA sequence that had lost the UBP, which was incorporated on a plasmid. A: The UBP gets lost, which leads to a point mutation. One of the sgRNAs can bind to the DNA target sequence. Cas9 is recruited and cleaves the plasmid, which is followed by its degradation. B: Plasmids that contain a UBP in the DNA target sequence lead to a mismatch with every sgRNA. Cas9 does not cleave the plasmid, leading to a retention of the UBP.

For this conservation system, we integrated the cas9 gene into the genome of E. coli BL21(DE3). This new strain is called X1. To be able to strictly regulate the expression of cas9 we used the optimized IPTG‑inducible promoter Plac&#x2011tight. The genomic knock in was done according to the protocol by Cobb et al., 2014 using the pCRISPomyces plasmid system. A sgRNA was designed searching for a reverse sequence with the constraint N(16)R(4)NGG (Cobb et al., 2004) inside the coding sequence of the arsB gene (Zhang et al., 2017) of the E. coli genome. arsB is coding for an arsenic efflux pump membrane protein. As a result, 5‘‑TATTGTTCATAATAGAAGAG‑3‘ turned out to be the suggested guiding sequence with the highest on‑target activity score with being unique within the complete genome. Furthermore, a repair template is necessary for the knock in. Therefore, a composite BioBrick was assembled using 1 kb long flanking sequences, two times the terminator BBa_B0015 flanking the Plac‑tight and the cas9 coding sequence (Figure 2).

Figure 2: The repair template for genomic integration into E. coli BL21(DE3).
The 1 kb left flanking sequence (LFS) and right flanking sequence (RFS) are taken from the genome of E. coli BL21(DE3). Inside the genome LFS and RFS are directly flanking the coding sequence of arsB. The strong terminators from BBa_B0015 were used to avoid basal expression and to stop transcription right after cas9. The coding sequence of cas9 is taken from the pCRISPomyces plasmid system by Cobb et al., 2014 and is originated from S. pyogenes. It is negatively regulated by the IPTG‑inducible promoter Plac‑tight.

This composite BioBrick from Figure 2 needs to be restricted with NotI to separate the linear repair template from the pSB1C3 backbone. Together with the target plasmid containing the sgRNA and the pCRISPomyces plasmid containing the cas9 all three elements were co‑transfected into E. coli BL21(DE3). The genomic integration was verified by sequencing.

Optimization of the negatively regulating promoter Plac

We designed a lac operon for a tight repression called Plac‑tight to achieve a low transcription rate. The induction of the wild type lac operon increases the level of β‑galactosidase 1000‑fold (Müller et al., 1996). As part of the lac operon the lac repressor was the first repressor isolated and sequenced in 1966 by Gilbert and Müller‑Hill. The wild type lac operon consists of the genes lacZ, lacY and lacA that are transcribed from the lac promoter Plac into a polycistronic mRNA (Figure 4). These genes code for the proteins β‑galactosidase, Lac permease and Lac transacetylase (Oehler et al., 1994).

Figure 3: DNA map of the wild type lac operon and its transcriptional and translational products (Oehler et al., 1994).

The transcription is constitutively activated by the CAP protein. lacI codes for the tetrameric Lac repressor and is expressed by the promoter Pi. The Lac repressor can bind to the lac operators O1, O2 or O3. O3 is located 92 bp upstream of O1 and O2 401 bp downstream of O1. The inter‑operator distances are counted from the center of O1 to the center of the distal operator. By binding simultaniously to O1 and O2 or to O1 and O3, the Lac repressor forms a DNA loop that negatively controlls the expression of Plac (Oehler et al., 1994).

Figure 4: The wild type lac operators.
The tetrameric Lac repressor can bind either the lac operators O1 and O3 or O1 and O2 to form a DNA loop. The DNA loops efficiently inhibit the transcription by the CAP protein (Oehler et al., 1994).

In 1994, Oehler et al. showed that an inactivated O2 in its natural position does not decrease the repression by low amounts of tetrameric Lac repressor. Based on this result, we designed our Plac‑tight without the lac operator O2. It was also shown that two weak operators result in a tighter repression than a single strong operator. This can be explained by the thermodynamic concept that a second operator increases the local concentration of the Lac repressor for the neighboring operator. As a consequence there is a higher probability of occupation for two operators by the Lac repressor leading to a tighter repression (Oehler et al., 1996). In 1983, Sadler et al. proposed a ideal lac operator Oid that binds the Lac repressor 10‑fold tighter than the natural strong lac operator O1. Oid is a inverted repeat of the left half of O1 (Figure 5).

Figure 5: The lac operator Oid.
The inversion is indicated by the arrow for the perfectly symmetric lac operator Oid. It is the inverted repeat of the left half of O1 (Sadler et al. 1983).

The operator‑DNA‑operator complex requires energy for the bending process in order to form a DNA loop. Additional energy for a torsion is required when the two lac operators lay on opposite sites of the helical DNA surface. Therefore, the DNA loop formation is energetically favoured for lac operators in phase (Müller et al., 1996). In 1996, Mueller et al. investigated the strength of repression for an inter‑operator distance of Oid and O1 from 57.5 bp up to 1493.5 bp. The repression values were compared to the repression by a single O1 at its natural position. A shorter spacing than 57.5 bp could not be examined due to the 35 box of the promoter. Phase dependency for the repression was observed for a spacing around 200 bp. That leads to the observation of periodically maxima for repression values (Figure 6).

Figure 6: Repression values dependent on inter‑operator distances between O1 and Oid.
The repression values refer to the repression of the chromosomal lacZ gene under the control of O1 at its natural positon and Oid at the indicated position. With 50 tetrameric Lac repressors per cell the repression value is calculated by the specific activity of β‑galactosidase in absence of active Lac repressor devided by the specific activity of β‑galactosidase in the presence of active Lac repressor. The dashed line shows the repression value for a single natural O1 operator (Mueller et al., 1996).

The distance of 70.5 bp showed the strongest repression value which is 50‑fold higher than the natural repression. Repression drops sharply to 15‑fold at a 150.5 bp spacing and to threefold at around 600 bp. All inter‑operator distances beyond 600 bp kept a twofold increased repression value (Müller et al., 1996).
According to these results, our Plac‑tight consists of the auxiliary operator Oid with a 70.5 bp spacing to O1 at its natural position. The residuray sequence like the P lac was kept as the natural lac operon taken from E. coli BL21(DE3) (Figure 7).

Figure 7: Tight lac operon Plac‑tight.
The figure with its annotations was created with the software Geneious 10.0.8.