Difference between revisions of "Team:Freiburg/Notebook Suicide Gene"

(Created page with "{{Freiburg/Navbar}} <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="de" lang="de" dir="ltr"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />...")
 
Line 19: Line 19:
 
<link rel="stylesheet" type="text/css" href="/igem2017/lib/exe/css.php?t=vector&amp;tseed=a997da6dc350c65c375c557c2f11f900"/>
 
<link rel="stylesheet" type="text/css" href="/igem2017/lib/exe/css.php?t=vector&amp;tseed=a997da6dc350c65c375c557c2f11f900"/>
 
<!--[if gte IE 9]><!-->
 
<!--[if gte IE 9]><!-->
−
<script type="text/javascript">/*<![CDATA[*/var NS='labor';var SIG=' --- //[[ada.seredynska@gmail.com|Adrianna Seredynska]] 2017/10/18 15:11//';var JSINFO = {"id":"labor:cell_culture","namespace":"labor","plugins":{"edittable":{"default columnwidth":""}},"isadmin":0,"isauth":1};
+
<script type="text/javascript">/*<![CDATA[*/var NS='labor';var SIG=' --- //[[x]] 2017/10/18 15:11//';var JSINFO = {"id":"labor:cell_culture","namespace":"labor","plugins":{"edittable":{"default columnwidth":""}},"isadmin":0,"isauth":1};
 
/*!]]>*/</script>
 
/*!]]>*/</script>
 
<script type="text/javascript" charset="utf-8" src="/igem2017/lib/exe/jquery.php?tseed=23f888679b4f1dc26eef34902aca964f"></script>
 
<script type="text/javascript" charset="utf-8" src="/igem2017/lib/exe/jquery.php?tseed=23f888679b4f1dc26eef34902aca964f"></script>
Line 97: Line 97:
 
         <div class="flex-container">
 
         <div class="flex-container">
 
           <div class="item">
 
           <div class="item">
 +
 +
 +
 +
<h1 class="sectionedit1" id="lab_notebook_suicide_gene_cloning">Lab Notebook Suicide Gene</h1>
 +
<div class="level1">
 +
 +
<p>
 +
Papers:
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=herpes_simplex_virus_thymidine_kinase_gene_transfer_for_controlled.pdf" class="media mediafile mf_pdf" title="herpes_simplex_virus_thymidine_kinase_gene_transfer_for_controlled.pdf (2.2 MB)">herpes_simplex_virus_thymidine_kinase_gene_transfer_for_controlled.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=suicide_gene_therapy_by_herpes_simplex_virus-1_thymidine_kinase_hsv-tk_.pdf" class="media mediafile mf_pdf" title="suicide_gene_therapy_by_herpes_simplex_virus-1_thymidine_kinase_hsv-tk_.pdf (725.7 KB)">suicide_gene_therapy_by_herpes_simplex_virus-1_thymidine_kinase_hsv-tk_.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=nihms-514623.pdf" class="media mediafile mf_pdf" title="nihms-514623.pdf (310.9 KB)">nihms-514623.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=increased_susceptibility_of_cells_to_inducible_apo.pdf" class="media mediafile mf_pdf" title="increased_susceptibility_of_cells_to_inducible_apo.pdf (293.3 KB)">increased_susceptibility_of_cells_to_inducible_apo.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=immunologic_potential_of_donor_lymphocytes.pdf" class="media mediafile mf_pdf" title="immunologic_potential_of_donor_lymphocytes.pdf (372.6 KB)">immunologic_potential_of_donor_lymphocytes.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/fetch.php?media=hygromycin-protocol.pdf" class="media mediafile mf_pdf" title="hygromycin-protocol.pdf (316.8 KB)">hygromycin-protocol.pdf</a>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=gcv.png" class="media" title="gcv.png"><img src="/igem2017/lib/exe/fetch.php?w=400&amp;tok=a05db8&amp;media=gcv.png" class="media" alt="" width="400" /></a>
 +
</p>
 +
 +
<p>
 +
Properties of GCV
 +
</p>
 +
 +
<p>
 +
<a href="https://pubchem.ncbi.nlm.nih.gov/compound/ganciclovir#section=Melting-Point" class="urlextern" target="_Blank" title="https://pubchem.ncbi.nlm.nih.gov/compound/ganciclovir#section=Melting-Point" rel="nofollow noopener">https://pubchem.ncbi.nlm.nih.gov/compound/ganciclovir#section=Melting-Point</a>
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_1'> </div>
 +
<h3 class="sectionedit2" id="cloning_with_cmv_and_-egfp-hygromycin-tk_cassette">Cloning with CMV and -EGFP-Hygromycin-TK Cassette</h3>
 +
<div class="level3">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_2'> </div>
 +
<h2 class="sectionedit3" id="section100817">10.08.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_3'> </div>
 +
<h2 class="sectionedit4" id="transformation_of_pig17_83_suicide_gene_with_xl_10_gold">Transformation of pIG17_83 (Suicide Gene) with Xl 10 Gold</h2>
 +
<div class="level2">
 +
<ol>
 +
<li class="level1"><div class="li"> Thaw  Xl10 competent cells from -80 ° Freezer on 30 Minutes on Ice.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Add  Plasmid DNA [2 µl, dependent on concentration] and let stand on Ice for 30 Minutes.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Heat shock on 42 ° for 45 Seconds and let stand for 2 minutes on Ice.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Add LB-Medium [450 µl] without antibiotics and incubate for 37 ° for 60 minutes and 300 rounds per minute.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Plate Culture with antiobiotic resistence on LB-plate with corresponding antibiotics. </div>
 +
</li>
 +
<li class="level1"><div class="li"> (If overgrown, dilute streak bacteria colonies on another plate.)</div>
 +
</li>
 +
</ol>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_4'> </div>
 +
<h2 class="sectionedit5" id="section11082017">11.08.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_5'> </div>
 +
<h3 class="sectionedit6" id="occulation_of_overnight_cultures">Occulation of  Overnight cultures</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Pick four single colonies and oculate four overnight cultures with  LB-AMP [6 ml each] in glas reaction tubes.
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_6'> </div>
 +
<h2 class="sectionedit7" id="section120817">12.08.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_7'> </div>
 +
<h3 class="sectionedit8" id="plasmid_isolation_of_four_overnight_cultures_of_pig17_83_suicide_gene_with_promega_miniprep_kit">Plasmid Isolation of four Overnight Cultures of pIG17_83 (Suicide Gene) with Promega Miniprep Kit</h3>
 +
<div class="level3">
 +
<ol>
 +
<li class="level1"><div class="li"> Elution in pre-warmed (50°) Elution Buffer [30 µl].</div>
 +
</li>
 +
</ol>
 +
<div class="table sectionedit9"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Sample</th><th class="col1">Concentration [ng/µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Suicide Gene 1</td><td class="col1">521</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">Suicide Gene 3</td><td class="col1">549</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">Suicide Gene 3</td><td class="col1">804</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">Suicide Gene 4</td><td class="col1">600</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_9'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_8'> </div>
 +
<h2 class="sectionedit10" id="section14082017">14.08.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_10'> </div>
 +
<h3 class="sectionedit11" id="test_digest_of_pig17_83_with_xbai_and_kpni">Test Digest of pIG17_83 with XbaI and KpnI</h3>
 +
<div class="level3">
 +
 +
<p>
 +
All Controls were performed with autoclaved water [18 µl] and of Plasmid-Solution [2 µl].
 +
</p>
 +
 +
<p>
 +
<strong>Top Band XbaI with Suicide Gene 1-4 with Controls in between</strong>
 +
</p>
 +
<div class="table sectionedit12"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Volumes [ng/µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">14,5  (15,5 for SG3)</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">2 (1 for SG3)</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">Cutsmart</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">XbaI</td><td class="col1">1,5</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_12'> </div>
 +
<p>
 +
Expected Fragments: 4617 bp, 3495 bp &amp; 1712 bp
 +
</p>
 +
 +
<p>
 +
<strong>Lower Band KpnI with Suicide Gene 1-4 with Controls in between</strong>
 +
</p>
 +
<div class="table sectionedit13"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Volumes [ng/µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">14,5  (15,5 for SG3)</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">2 (1 for SG3)</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">Cutsmart</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">KpnI</td><td class="col1">1,5</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_13'> </div>
 +
<p>
 +
Expected Fragments: 4926 bp, 3867 bp &amp; 1031 bp
 +
</p>
 +
 +
<p>
 +
Incubate for 60 minutes at 37 °.
 +
4 µl 6X Orange Dye was added to each Sample.
 +
DNA-Ladder: 5 µl 1kb GeneRuler plus
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_11'> </div>
 +
<h3 class="sectionedit14" id="gel_preparation">Gel Preparation</h3>
 +
<div class="level3">
 +
<ol>
 +
<li class="level1"><div class="li"> Heat up 85 ml (small) or 120 ml (big) 1 x TAE-Buffer with 1 mass percent Agarose in the microwave until the Agarose has dissolved completely.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Add 5 µl (small) or 7 µl (big) Midori-Green DNA Stain to the heated TAE-Agarose mix and pour into respective gel-chamber with desired comb. </div>
 +
</li>
 +
<li class="level1"><div class="li"> Let it cool for &gt;45 minutes until it has complete solidificated.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Remove comb carefully to reveal the gel slots.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Pour 1 x  TAE-Buffer over the cooled down gel until it is completely covered in liquid.</div>
 +
</li>
 +
</ol>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_14'> </div>
 +
<h3 class="sectionedit15" id="gel_run_of_test_digests">Gel run of test digests</h3>
 +
<div class="level3">
 +
<ol>
 +
<li class="level1"><div class="li"> Put 5µl (small gel) or 8 µl (big gel) DNA ladder (1kb GeneRuler plus) into slot for use as reference.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Mix DNA Sample with Loading Dye for desired Dilution (6x Purple or Orange Loading Dye)</div>
 +
</li>
 +
<li class="level1"><div class="li"> Load Gel Slot with Dna Sample</div>
 +
</li>
 +
<li class="level1"><div class="li"> Run the Gel with following settings: 120 Volt, 3 Watte, 15 Ampere for 45 Minutes.</div>
 +
</li>
 +
<li class="level1"><div class="li"> Visualize in the Gelbox with Exposure Time of 64 seconds and UV-Light.</div>
 +
</li>
 +
</ol>
 +
 +
<p>
 +
<strong>Gel-Image</strong>
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=xba1_and_kpn1_lower_band.png" class="media" title="xba1_and_kpn1_lower_band.png"><img src="/igem2017/lib/exe/fetch.php?w=600&amp;tok=3f7460&amp;media=xba1_and_kpn1_lower_band.png" class="media" alt="" width="600" /></a>
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_15'> </div>
 +
<h2 class="sectionedit16" id="section15082017">15.08.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_16'> </div>
 +
<h3 class="sectionedit17" id="test_digest_with_nde1_and_pvuii_in_cf_and_fast_digest">Test digest with Nde1 and PvuII in CF and Fast digest</h3>
 +
<div class="level3">
 +
 +
<p>
 +
First four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): NdeI with Suicide Gene 1 &amp; 2 with Controls in between.
 +
</p>
 +
 +
<p>
 +
Last four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): PvuII with Suicide Gene 3 &amp; 4 with Controls in between.
 +
</p>
 +
 +
<p>
 +
<strong>NdeI with SG 1 &amp; 2 Expected fragements: 7071 bp &amp; 2753 bp</strong>
 +
</p>
 +
<div class="table sectionedit18"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Volumes [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">15,25 (CS) or 14,5 (FD)</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">CS (Top) or FD (Lower)</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">NdeI</td><td class="col1"> 0,75 (CS) or (1,5 FD)</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_18'> </div>
 +
<p>
 +
<strong>PvuII with SG 3 &amp; 4. Expected Fragements:  7311 bp &amp; 2513 bp</strong>
 +
</p>
 +
<div class="table sectionedit19"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Volumes [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">15,25 (CS) or 14,5 (FD)</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">CS (Top) or FD (Lower)</td><td class="col1">2</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">NdeI</td><td class="col1"> 0,75 (CS) or (1,5 FD)</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_19'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_17'> </div>
 +
<h3 class="sectionedit20" id="gel_run_of_test_digest">Gel Run of Test Digest</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Ladder: 5µl 1KB GeneRuler PLus
 +
</p>
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=gel_14.08._test_digest_sg_1-2_nde1_pvuii_3-4_cs_fd.png" class="media" title="gel_14.08._test_digest_sg_1-2_nde1_pvuii_3-4_cs_fd.png"><img src="/igem2017/lib/exe/fetch.php?w=600&amp;tok=48bb03&amp;media=gel_14.08._test_digest_sg_1-2_nde1_pvuii_3-4_cs_fd.png" class="media" alt="" width="600" /></a>
 +
</p>
 +
 +
<p>
 +
Samples 3 &amp; and 4 have been confirmed as correct fragments.
 +
</p>
 +
 +
<p>
 +
A glycerolstock of Sample 3 has been made and put into the -80° Freezer
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_20'> </div>
 +
<h2 class="sectionedit21" id="section21082017">21.08.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_21'> </div>
 +
<h3 class="sectionedit22" id="occulation_of_four_overnight_cultures_with_pig17_82_p526_lentivirales_transfer_plasmid">Occulation of four overnight cultures with pIG17_82 (p526) lentivirales transfer plasmid</h3>
 +
<div class="level3">
 +
 +
<p>
 +
4 Colonies have been picked from an LB-Plate.
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_22'> </div>
 +
<h2 class="sectionedit23" id="section22082017">22.08.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_23'> </div>
 +
<h3 class="sectionedit24" id="miniprep_of_four_o_n_cultures_with_p526_with_promega_miniprep_kit">Miniprep of four O/N Cultures with p526 with Promega Miniprep Kit</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Elution in 30 µl  prewarmed (50°) Elution Buffer
 +
</p>
 +
<div class="table sectionedit25"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Sample</th><th class="col1">Concentration</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">1</td><td class="col1">625</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">2</td><td class="col1">494</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">3</td><td class="col1">607</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">4</td><td class="col1">731</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_25'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_24'> </div>
 +
<h3 class="sectionedit26" id="digest_of_p526">Digest of p526</h3>
 +
<div class="level3">
 +
<div class="table sectionedit27"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Component</th><th class="col1">Concentration</th><th class="col2">Volume (µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">-</td><td class="col2">18</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">125 [ng/µl]</td><td class="col2">16</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">Cutsmart</td><td class="col1">10x</td><td class="col2">4</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">SpeI-HF</td><td class="col1">20 U/µg</td><td class="col2">1</td>
 +
</tr>
 +
<tr class="row5">
 +
<td class="col0">SalI-HF</td><td class="col1">20 U/µg]</td><td class="col2">1</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_27'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_26'> </div>
 +
<h3 class="sectionedit28" id="gel_run">Gel Run</h3>
 +
<div class="level3">
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png" class="media" title="pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png"><img src="/igem2017/lib/exe/fetch.php?w=400&amp;tok=eadfbf&amp;media=pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png" class="media" alt="" width="400" /></a>
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_28'> </div>
 +
<h3 class="sectionedit29" id="gelextraction_of_lentiviral_backbone_p526_5839_bp">Gelextraction of lentiviral Backbone p526 (5839 bp)</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Elution in 12 µl milliq Water
 +
Yield: 15 ng/µl
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_29'> </div>
 +
<h2 class="sectionedit30" id="section210917">21.09.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_30'> </div>
 +
<h3 class="sectionedit31" id="extension_pcr_with_cmv_of_pig17_37_and_primers_oig17_280_and_oig17_281">Extension PCR with CMV of pIG17_37 and Primers oIG17_280 &amp; and oIG17_281</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Forward Extension  binds into Lentiviral Backbone (pIG17_83) upstream of restriction site with SpeI.
 +
</p>
 +
 +
<p>
 +
Reverse Extention binds downstream into e-GFP Sequence of Suicide Gene (pIG17_83).
 +
</p>
 +
 +
<p>
 +
Sequence:
 +
</p>
 +
 +
<p>
 +
oIG17_280: Extension: 5`-ATTCAAAATTTTATCGATACTAGCGT-3` Binding Site: 5&#039;- TAGTTATTAATAGTAATCAATTACGGGG - 3&#039;
 +
</p>
 +
 +
<p>
 +
oIG17_281: Extension: 5`-GCTCCTCGCCCTTGCTCACCAT-3` Binding Site: 5&#039;- TGATACACTTGATGTACTGCCAAG - 3&#039;
 +
</p>
 +
 +
<p>
 +
Annealing Temperature of 60°  was calculated by NEB-Tm-Calculator using Q5-Polymerase.
 +
</p>
 +
 +
<p>
 +
<strong>PCR-Components</strong>
 +
</p>
 +
<div class="table sectionedit32"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Concentrations</th><th class="col2">Volumes [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">H2O</td><td class="col1">-</td><td class="col2">29</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">Template (plG17_34)</td><td class="col1">20 ng/µl</td><td class="col2">5</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">10 mM FW primer</td><td class="col1"> - </td><td class="col2">2.5</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">10 mM RW primer</td><td class="col1">-</td><td class="col2">2.5</td>
 +
</tr>
 +
<tr class="row5">
 +
<td class="col0">10mM dNTPs</td><td class="col1"> - </td><td class="col2">0,5</td>
 +
</tr>
 +
<tr class="row6">
 +
<td class="col0">5x Q5 Buffer</td><td class="col1">-</td><td class="col2">10</td>
 +
</tr>
 +
<tr class="row7">
 +
<td class="col0">Q5 Polymerase</td><td class="col1 rightalign"> -</td><td class="col2">0.5</td>
 +
</tr>
 +
<tr class="row8">
 +
<td class="col0">Total</td><td class="col1">-</td><td class="col2">50</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_32'> </div>
 +
<p>
 +
<strong>PCR-Cycles</strong>
 +
Expected Fragmens Size: 282 bp
 +
</p>
 +
<div class="table sectionedit33"><table class="inline">
 +
<tr class="row0">
 +
<th class="col0" colspan="2">Step</th><td class="col2">Denaturation</td><td class="col3">Annealing</td><td class="col4">Extension</td><td class="col5">Final Elongation</td><td class="col6"> Chill</td>
 +
</tr>
 +
<tr class="row1">
 +
<th class="col0" colspan="2">Temperature [°]</th><td class="col2">98</td><td class="col3">60</td><td class="col4">72</td><td class="col5">72</td><td class="col6">4</td>
 +
</tr>
 +
<tr class="row2">
 +
<th class="col0" colspan="2">Length</th><td class="col2">30 s</td><td class="col3"> 20 s</td><td class="col4">30s</td><td class="col5">2 Minutes</td><td class="col6">Pause</td>
 +
</tr>
 +
<tr class="row3">
 +
<th class="col0" colspan="2">Cycles</th><td class="col2" colspan="3"> 30 x </td><td class="col5">1</td><td class="col6">Pause</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_33'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_31'> </div>
 +
<h3 class="sectionedit34" id="extension_pcr_with_e-gfp-hygromycin-thimidinekinase_cassette">Extension PCR with e-GFP-Hygromycin-Thimidinekinase Cassette</h3>
 +
<div class="level3">
 +
 +
<p>
 +
oIG17_282 binds to eGFP Sequence of Suicide Gene.
 +
</p>
 +
 +
<p>
 +
oIG237 binds to 3&#039;End of Thimidine Kinase, Extension binds downstream of SalI - Restriction site into WPRE-enhancer element of transfer-Plasmid p526 (pIG17_82).
 +
</p>
 +
 +
<p>
 +
oIG17_282: Binding: 5&#039; - ATGGTGAGCAAGGGCGAGGAGCTGTTC - 3&#039;
 +
</p>
 +
 +
<p>
 +
oIG17_237: Extension: 5&#039;- GTAATCCAGAGGTTGATTGTCGA - 3&#039; Binding Site: 5&#039;- TCAGTTAGCCTCCCCCATC -3&#039;
 +
</p>
 +
 +
<p>
 +
Annealing Temperature of 67° was calculated by NEB-Tm-Calculator using Q5-Polymerase
 +
</p>
 +
 +
<p>
 +
<strong>PCR</strong>
 +
</p>
 +
<div class="table sectionedit35"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Concentrations</th><th class="col2">Volumes [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">H2O</td><td class="col1">-</td><td class="col2">28.5</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">Template (plG17_34)</td><td class="col1">20 ng/µl</td><td class="col2">5</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">10 mM FW primer</td><td class="col1"> - </td><td class="col2">2.5</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">10 mM RW primer</td><td class="col1">-</td><td class="col2">2.5</td>
 +
</tr>
 +
<tr class="row5">
 +
<td class="col0">10mM dNTPs</td><td class="col1"> - </td><td class="col2">1</td>
 +
</tr>
 +
<tr class="row6">
 +
<td class="col0">5x Q5 Buffer</td><td class="col1">-</td><td class="col2">10</td>
 +
</tr>
 +
<tr class="row7">
 +
<td class="col0">Q5 Polymerase</td><td class="col1 rightalign"> -</td><td class="col2">0.5</td>
 +
</tr>
 +
<tr class="row8">
 +
<td class="col0">Total</td><td class="col1">-</td><td class="col2">50</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_35'> </div>
 +
<p>
 +
<strong>PCR-Cycles</strong>
 +
Expected Fragment Size: 2906 bp
 +
</p>
 +
<div class="table sectionedit36"><table class="inline">
 +
<tr class="row0">
 +
<th class="col0" colspan="2">Step</th><td class="col2">Denaturation</td><td class="col3">Annealing</td><td class="col4">Extension</td><td class="col5">Final Elongation</td><td class="col6"> Chill</td>
 +
</tr>
 +
<tr class="row1">
 +
<th class="col0" colspan="2">Temperature [°]</th><td class="col2">98</td><td class="col3">67</td><td class="col4">72</td><td class="col5">72</td><td class="col6">4</td>
 +
</tr>
 +
<tr class="row2">
 +
<th class="col0" colspan="2">Length</th><td class="col2">30 s</td><td class="col3"> 20 s</td><td class="col4">4 Minutes</td><td class="col5">5 Minutes</td><td class="col6">Pause</td>
 +
</tr>
 +
<tr class="row3">
 +
<th class="col0" colspan="2">Cycles</th><td class="col2" colspan="3"> 30 x </td><td class="col5">1</td><td class="col6">Pause</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_36'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_34'> </div>
 +
<h2 class="sectionedit37" id="section22092017">22.09.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_37'> </div>
 +
<h3 class="sectionedit38" id="gel_run_with_extension_pcr_cmv_egfp-hygromycin-tk_fragments">Gel Run with Extension PCR CMV &amp; eGFP-Hygromycin-TK Fragments</h3>
 +
<div class="level3">
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=extension_pcr_cmv_egfp-hygro-tk.png" class="media" title="extension_pcr_cmv_egfp-hygro-tk.png"><img src="/igem2017/lib/exe/fetch.php?w=400&amp;tok=93bb2a&amp;media=extension_pcr_cmv_egfp-hygro-tk.png" class="media" alt="" width="400" /></a>
 +
</p>
 +
 +
<p>
 +
Fragments with 282 bp (extension CMV) &amp; 2906 bp (SG-Cassette) were cut out.
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_38'> </div>
 +
<h2 class="sectionedit39" id="section23092017">23.09.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_39'> </div>
 +
<h3 class="sectionedit40" id="gelextraction_of_extension_pcrs_with_qiaquick_gel_extraction_kit">Gelextraction of extension PCRs with QiaQuick Gel extraction kit</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Procedure according provided protocol
 +
Elution in 10 µl prewarmed (50°) Milliq H20
 +
</p>
 +
<div class="table sectionedit41"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Sample</th><td class="col1"></td>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">ex.CMV</td><td class="col1">6</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">ext.SG</td><td class="col1">130</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_41'> </div>
 +
</div>
 +
<div class='secedit editbutton_section editbutton_40'> </div>
 +
<h2 class="sectionedit42" id="section261017">26.10.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_42'> </div>
 +
<h3 class="sectionedit43" id="repetion_of_extension_pcr_with_cmv">Repetion of extension PCR with CMV</h3>
 +
<div class="level3">
 +
 +
<p>
 +
CMV from the Gel-Extraction (23.09.2017) was again used as template.
 +
</p>
 +
 +
<p>
 +
<strong>PCR-Cycles</strong>
 +
Expected Fragmens Size: 282 bp
 +
</p>
 +
<div class="table sectionedit44"><table class="inline">
 +
<tr class="row0">
 +
<th class="col0" colspan="2">Step</th><td class="col2">Denaturation</td><td class="col3">Annealing</td><td class="col4">Extension</td><td class="col5">Final Elongation</td><td class="col6"> Chill</td>
 +
</tr>
 +
<tr class="row1">
 +
<th class="col0" colspan="2">Temperature [°]</th><td class="col2">98</td><td class="col3">70</td><td class="col4">72</td><td class="col5">72</td><td class="col6">4</td>
 +
</tr>
 +
<tr class="row2">
 +
<th class="col0" colspan="2">Length</th><td class="col2">30 s</td><td class="col3"> 20 s</td><td class="col4">30s</td><td class="col5">2 Minutes</td><td class="col6">Pause</td>
 +
</tr>
 +
<tr class="row3">
 +
<th class="col0" colspan="2">Cycles</th><td class="col2" colspan="3"> 40 x </td><td class="col5">1</td><td class="col6">Pause</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_44'> </div>
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png" class="media" title="pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png"><img src="/igem2017/lib/exe/fetch.php?w=400&amp;tok=eadfbf&amp;media=pcr_cmv_and_digest_526_with_speihf_and_sal_hf.png" class="media" alt="" width="400" /></a>
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_43'> </div>
 +
<h2 class="sectionedit45" id="section270917">27.09.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_45'> </div>
 +
<h3 class="sectionedit46" id="gibson_assembly_with_cmv-fragment_suicide-gene-fragment_and_lentiviral_backbone_p526_pig17_82">Gibson Assembly with CMV-fragment, Suicide-Gene-fragment and lentiviral Backbone p526 pIG17_82</h3>
 +
<div class="level3">
 +
<div class="table sectionedit47"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Components</th><th class="col1">Concentration</th><th class="col2">Amount</th><th class="col3">Weight [pmol]</th><th class="col4">Volume [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1" colspan="2">-</td><td class="col3">1</td><td class="col4"></td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">p526 Backbone</td><td class="col1">-</td><td class="col2">0,013</td><td class="col3">50ng</td><td class="col4">2</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">CMV</td><td class="col1">-</td><td class="col2">0,055</td><td class="col3">0,5</td><td class="col4"></td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">SG-Cassette</td><td class="col1">-</td><td class="col2">0,039</td><td class="col3">0,5</td><td class="col4"></td>
 +
</tr>
 +
<tr class="row5">
 +
<td class="col0">Gibson Master Mix</td><td class="col1" colspan="2">2x</td><td class="col3">5</td><td class="col4"></td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_47'> </div>
 +
<p>
 +
Final Construct: pIG17_161
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_46'> </div>
 +
<h3 class="sectionedit48" id="transformation_of_pig17_161_with_xl10_gold">Transformation of pIG17_161 with XL10 Gold</h3>
 +
<div class="level3">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_48'> </div>
 +
<h2 class="sectionedit49" id="section28917">28.9.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_49'> </div>
 +
<h3 class="sectionedit50" id="colony_pick_and_o_n_of_the_colony">1 Colony pick and O/N of the colony</h3>
 +
<div class="level3">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_50'> </div>
 +
<h2 class="sectionedit51" id="section29917">29.9.17</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_51'> </div>
 +
<h3 class="sectionedit52" id="miniprep_of_o_n">Miniprep of O/N</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Elution in 30 µl prewarmed (50°) Elution Buffer
 +
</p>
 +
 +
<p>
 +
Yield: 1 µg/µl
 +
Second Eluate: 140 µg/µl
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_52'> </div>
 +
<h3 class="sectionedit53" id="test_digest_of_pig17_161">Test Digest of pIG17_161</h3>
 +
<div class="level3">
 +
<div class="table sectionedit54"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0" colspan="2">Components</th><th class="col2">Concentration</th><th class="col3">Volumes [µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">Water</td><td class="col1">-</td><td class="col2">13,5</td><td class="col3"></td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">DNA</td><td class="col1">140 ng/µl</td><td class="col2">3,5</td><td class="col3"></td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">FAstDigest</td><td class="col1">5x</td><td class="col2">2</td><td class="col3"></td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">NdeI</td><td class="col1">-</td><td class="col2">1µl</td><td class="col3"></td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_54'> </div>
 +
<p>
 +
Incubate for 30 Minutes on 37 degress.
 +
</p>
 +
 +
<p>
 +
Expected fragments: 5314 bp &amp; 3647 bp
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_53'> </div>
 +
<h3 class="sectionedit55" id="gel_run1">Gel run</h3>
 +
<div class="level3">
 +
 +
<p>
 +
<a href="/igem2017/lib/exe/detail.php?id=suicide_gene&amp;media=suicide_gene_transfer_plasmid_confirmation.png" class="media" title="suicide_gene_transfer_plasmid_confirmation.png"><img src="/igem2017/lib/exe/fetch.php?w=400&amp;tok=4f3ba5&amp;media=suicide_gene_transfer_plasmid_confirmation.png" class="media" alt="" width="400" /></a>
 +
</p>
 +
 +
<p>
 +
Left, uncomplete Digest, right: 1 µ Control
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_55'> </div>
 +
<h2 class="sectionedit56" id="section04102017">04.10.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_56'> </div>
 +
<h3 class="sectionedit57" id="sequencing_of_pig17_161">Sequencing of pIG17_161</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Sample with 1 µg DNA per µl was divided into 6 Samples and sent in for sequencing for with Oligos oIG17_19, oIG17_246, oIG17_247, oIG17_248, oIG17_221 and an eGFP-Custom Primer offered by GATC
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_57'> </div>
 +
<h2 class="sectionedit58" id="section3092017">30.9.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_58'> </div>
 +
<h3 class="sectionedit59" id="sequencing_results">Sequencing results</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Sequencing confirmed positive sequence, pIG17_161 was handed over to cell culture for lentiviral transduction
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_59'> </div>
 +
<h3 class="sectionedit60" id="retransformation_of_pig17_161">Retransformation of pIG17_161</h3>
 +
<div class="level3">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_60'> </div>
 +
<h2 class="sectionedit61" id="section01102017">01.10.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_61'> </div>
 +
<h3 class="sectionedit62" id="colony_pick_occulation_of_4_overnight_cultures">Colony Pick &amp; Occulation of 4 Overnight cultures</h3>
 +
<div class="level3">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_62'> </div>
 +
<h2 class="sectionedit63" id="section02102017">02.10.2017</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_63'> </div>
 +
<h3 class="sectionedit64" id="miniprep_of_4_o_n">Miniprep of 4 O/N</h3>
 +
<div class="level3">
 +
<div class="table sectionedit65"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Sample</th><th class="col1">Concentration [ng/µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">1</td><td class="col1">398</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">2</td><td class="col1">685</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">3</td><td class="col1">787</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">4</td><td class="col1">1157</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_65'> </div>
 +
<p>
 +
An Glyerolstock of Sample 4 has been made with the Number 161 and Notation CMC_eGFP_Hygromycin_Thimidine_Kinase-transfer.
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_64'> </div>
 +
<h2 class="sectionedit66" id="o_n_of_glycerolstock_pig17_83">16.09.17 O/N of Glycerolstock pIG17_83</h2>
 +
<div class="level2">
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_66'> </div>
 +
<h3 class="sectionedit67" id="miniprep_of_10_o_n_cultures_pig17_83">Miniprep of 10 O/N Cultures pIG17_83</h3>
 +
<div class="level3">
 +
 +
<p>
 +
Elution on 37° for 15 Minutes with ddH2O
 +
</p>
 +
<div class="table sectionedit68"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">Sample</th><th class="col1">Concentration [ng/µl]</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">1</td><td class="col1">262</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">2</td><td class="col1">294</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">3</td><td class="col1">389</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">4</td><td class="col1">375</td>
 +
</tr>
 +
<tr class="row5">
 +
<td class="col0">5</td><td class="col1">278</td>
 +
</tr>
 +
<tr class="row6">
 +
<td class="col0">6</td><td class="col1">305</td>
 +
</tr>
 +
<tr class="row7">
 +
<td class="col0">7</td><td class="col1">261</td>
 +
</tr>
 +
<tr class="row8">
 +
<td class="col0">8</td><td class="col1">205</td>
 +
</tr>
 +
<tr class="row9">
 +
<td class="col0">9</td><td class="col1">321</td>
 +
</tr>
 +
<tr class="row10">
 +
<td class="col0">10</td><td class="col1">401</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_68'> </div>
 +
<p>
 +
PEI-Transfection with pIG17_83 (SG) and and CMV-GFP
 +
</p>
 +
 +
<p>
 +
Experimental Design
 +
</p>
 +
 +
<p>
 +
Facs Analysis for 3 Days
 +
</p>
 +
 +
<p>
 +
Triplicates of SG-transfected heks Heks with 5 treatments (0; 100ng; 1µ; 10 µg; 100µg/ml) → 15
 +
</p>
 +
 +
<p>
 +
Triplicates og pIG17_009 CMV-GFP with 5 Treatments (0; 100ng; 1µ; 10 µg; 100µg/ml) → 15
 +
</p>
 +
 +
<p>
 +
Untransfected with 5 Treatments
 +
</p>
 +
 +
<p>
 +
→ 35 Samples per Day for 3 Days → 105 Samples in total
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_67'> </div>
 +
<h2 class="sectionedit69" id="growth_curve_with_ganciclovir">Growth Curve with Ganciclovir</h2>
 +
<div class="level2">
 +
 +
<p>
 +
Killing Curve with Ganciclovir and stable cell lines
 +
</p>
 +
 +
<p>
 +
Tested Range: 0, 100 ng, 1 µg, 10 µg, 100 µg per ml
 +
</p>
 +
 +
<p>
 +
Triplicates with transfected cell lines und untransfected controls.
 +
</p>
 +
 +
<p>
 +
Test in a 24-well plate with seeding density of 100.000 cells per ml.
 +
→ 50.000 cells per well with 0,5 ml Media.
 +
</p>
 +
 +
<p>
 +
Plate occupation for triplicates with Suicide Gene and untransfected controls:
 +
</p>
 +
<div class="table sectionedit70"><table class="inline">
 +
<thead>
 +
<tr class="row0">
 +
<th class="col0">0</th><th class="col1">1</th><th class="col2">2</th><th class="col3">3</th><th class="col4">4</th><th class="col5">5</th><th class="col6">6</th>
 +
</tr>
 +
</thead>
 +
<tr class="row1">
 +
<td class="col0">A</td><td class="col1">0</td><td class="col2">100ng/ml</td><td class="col3">1 µg/ml</td><td class="col4">10 µg/ml</td><td class="col5">100 µg/ml</td><td class="col6">-</td>
 +
</tr>
 +
<tr class="row2">
 +
<td class="col0">B</td><td class="col1">0</td><td class="col2">100ng/ml</td><td class="col3">1 µg/ml</td><td class="col4">10 µg/ml</td><td class="col5">100 µg/ml</td><td class="col6">-</td>
 +
</tr>
 +
<tr class="row3">
 +
<td class="col0">C</td><td class="col1">0</td><td class="col2">100ng/ml</td><td class="col3">1 µg/ml</td><td class="col4">10 µg/ml</td><td class="col5">100 µg/ml</td><td class="col6">-</td>
 +
</tr>
 +
<tr class="row4">
 +
<td class="col0">D</td><td class="col1">-</td><td class="col2">-</td><td class="col3">-</td><td class="col4">-</td><td class="col5">-</td><td class="col6">-</td>
 +
</tr>
 +
</table></div>
 +
<div class='secedit editbutton_table editbutton_70'> </div>
 +
<p>
 +
Ganciclovir Stock: 10 mg/ml
 +
</p>
 +
 +
<p>
 +
Set up 50 µl Ganciclovir Stock in 450 µl RPMI in a 1,5 ml Eppi to get a 1:10 dilution (1 mg/ml).
 +
</p>
 +
 +
<p>
 +
50 µl (1mg/ml GCV) into  450 µl RPMI for 100 µg/ml.
 +
</p>
 +
 +
<p>
 +
50 µl (100µg/ml into 450 µl RPMI  for 10µg/ml.
 +
</p>
 +
 +
<p>
 +
50 µl (10µg/ml) into 450 µl RPMI for 1µg/ml.
 +
</p>
 +
 +
<p>
 +
From each tube take 55,5 µl (x µg/ ml) GCV-Medium and pipette into well for a X/10 µg/ml working range.
 +
</p>
 +
 +
<p>
 +
After induction of cells with GCV, throw the dilutions away, since it is unsure whether it is stable for a longer time in RPMI.
 +
</p>
 +
 +
<p>
 +
Change media every second day.
 +
</p>
 +
 +
<p>
 +
Split all the cells once they reach a concentration of 1 Mio cells per ml.
 +
</p>
 +
 +
</div>
 +
<div class='secedit editbutton_section editbutton_69'> </div>
 +
    <!-- end rendered wiki content -->
 +
    <div class="clearer"></div>
 +
  </div>
 +
  <!-- end div id bodyContent -->
 +
 +
 
 +
 +
 +
</div>
 +
</div>
 +
</div>
 +
</div>
 +
</div>
 +
 +
 +
 +
 +
<script>
 +
        var acc = document.getElementsByClassName("accordion");
 +
        var i;
 +
 +
        for (i = 0; i < acc.length; i++) {
 +
          acc[i].onclick = function() {
 +
            this.classList.toggle("active");
 +
            var panel = this.nextElementSibling;
 +
            if (panel.style.maxHeight){
 +
              panel.style.maxHeight = null;
 +
            } else {
 +
              panel.style.maxHeight = panel.scrollHeight + "px";
 +
            }
 +
          }
 +
        }
 +
        </script>
 +
<script>
 +
$('secedit').html('whatever');
 +
</sscript>
 +
 +
</div>
 +
</div>
 +
</div>
 +
</div>
 +
</div>
 +
<!-- end footer -->
 +
<img src="/igem2017/lib/exe/indexer.php?id=labor%3Acell_culture&amp;1508332270" width="2" height="1" alt="" />
 +
</body>
 +
</html>
 +
{{Freiburg/Footer}}

Revision as of 11:40, 22 October 2017

Logo
Overview Motivation CAR T Cells Tumor Microenvironment AND Gate Outlook Achievements References
Members Attributions Partners Contact
Main Project Modeling Applied Design Proof of Concept BioBricks Basic Part BioBrick Improvement Interlab Study
Safety Cloning HIF1A Knockdown Cell Culture Lab Book
Human Practice Integrated Human Practice Collaborations

labor:cell_culture - iGEM 2017

Lab Notebook Suicide Gene

Papers:

herpes_simplex_virus_thymidine_kinase_gene_transfer_for_controlled.pdf

suicide_gene_therapy_by_herpes_simplex_virus-1_thymidine_kinase_hsv-tk_.pdf

nihms-514623.pdf

increased_susceptibility_of_cells_to_inducible_apo.pdf

immunologic_potential_of_donor_lymphocytes.pdf

hygromycin-protocol.pdf

Properties of GCV

https://pubchem.ncbi.nlm.nih.gov/compound/ganciclovir#section=Melting-Point

Cloning with CMV and -EGFP-Hygromycin-TK Cassette

10.08.17

Transformation of pIG17_83 (Suicide Gene) with Xl 10 Gold

  1. Thaw Xl10 competent cells from -80 ° Freezer on 30 Minutes on Ice.
  2. Add Plasmid DNA [2 µl, dependent on concentration] and let stand on Ice for 30 Minutes.
  3. Heat shock on 42 ° for 45 Seconds and let stand for 2 minutes on Ice.
  4. Add LB-Medium [450 µl] without antibiotics and incubate for 37 ° for 60 minutes and 300 rounds per minute.
  5. Plate Culture with antiobiotic resistence on LB-plate with corresponding antibiotics.
  6. (If overgrown, dilute streak bacteria colonies on another plate.)

11.08.2017

Occulation of Overnight cultures

Pick four single colonies and oculate four overnight cultures with LB-AMP [6 ml each] in glas reaction tubes.

12.08.17

Plasmid Isolation of four Overnight Cultures of pIG17_83 (Suicide Gene) with Promega Miniprep Kit

  1. Elution in pre-warmed (50°) Elution Buffer [30 µl].
SampleConcentration [ng/µl]
Suicide Gene 1521
Suicide Gene 3549
Suicide Gene 3804
Suicide Gene 4600

14.08.2017

Test Digest of pIG17_83 with XbaI and KpnI

All Controls were performed with autoclaved water [18 µl] and of Plasmid-Solution [2 µl].

Top Band XbaI with Suicide Gene 1-4 with Controls in between

ComponentsVolumes [ng/µl]
Water14,5 (15,5 for SG3)
DNA2 (1 for SG3)
Cutsmart2
XbaI1,5

Expected Fragments: 4617 bp, 3495 bp & 1712 bp

Lower Band KpnI with Suicide Gene 1-4 with Controls in between

ComponentsVolumes [ng/µl]
Water14,5 (15,5 for SG3)
DNA2 (1 for SG3)
Cutsmart2
KpnI1,5

Expected Fragments: 4926 bp, 3867 bp & 1031 bp

Incubate for 60 minutes at 37 °. 4 µl 6X Orange Dye was added to each Sample. DNA-Ladder: 5 µl 1kb GeneRuler plus

Gel Preparation

  1. Heat up 85 ml (small) or 120 ml (big) 1 x TAE-Buffer with 1 mass percent Agarose in the microwave until the Agarose has dissolved completely.
  2. Add 5 µl (small) or 7 µl (big) Midori-Green DNA Stain to the heated TAE-Agarose mix and pour into respective gel-chamber with desired comb.
  3. Let it cool for >45 minutes until it has complete solidificated.
  4. Remove comb carefully to reveal the gel slots.
  5. Pour 1 x TAE-Buffer over the cooled down gel until it is completely covered in liquid.

Gel run of test digests

  1. Put 5µl (small gel) or 8 µl (big gel) DNA ladder (1kb GeneRuler plus) into slot for use as reference.
  2. Mix DNA Sample with Loading Dye for desired Dilution (6x Purple or Orange Loading Dye)
  3. Load Gel Slot with Dna Sample
  4. Run the Gel with following settings: 120 Volt, 3 Watte, 15 Ampere for 45 Minutes.
  5. Visualize in the Gelbox with Exposure Time of 64 seconds and UV-Light.

Gel-Image

15.08.2017

Test digest with Nde1 and PvuII in CF and Fast digest

First four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): NdeI with Suicide Gene 1 & 2 with Controls in between.

Last four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): PvuII with Suicide Gene 3 & 4 with Controls in between.

NdeI with SG 1 & 2 Expected fragements: 7071 bp & 2753 bp

ComponentsVolumes [µl]
Water15,25 (CS) or 14,5 (FD)
DNA2
CS (Top) or FD (Lower)2
NdeI 0,75 (CS) or (1,5 FD)

PvuII with SG 3 & 4. Expected Fragements: 7311 bp & 2513 bp

ComponentsVolumes [µl]
Water15,25 (CS) or 14,5 (FD)
DNA2
CS (Top) or FD (Lower)2
NdeI 0,75 (CS) or (1,5 FD)

Gel Run of Test Digest

Ladder: 5µl 1KB GeneRuler PLus

Samples 3 & and 4 have been confirmed as correct fragments.

A glycerolstock of Sample 3 has been made and put into the -80° Freezer

21.08.2017

Occulation of four overnight cultures with pIG17_82 (p526) lentivirales transfer plasmid

4 Colonies have been picked from an LB-Plate.

22.08.2017

Miniprep of four O/N Cultures with p526 with Promega Miniprep Kit

Elution in 30 µl prewarmed (50°) Elution Buffer

SampleConcentration
1625
2494
3607
4731

Digest of p526

ComponentConcentrationVolume (µl]
Water-18
DNA125 [ng/µl]16
Cutsmart10x4
SpeI-HF20 U/µg1
SalI-HF20 U/µg]1

Gel Run

Gelextraction of lentiviral Backbone p526 (5839 bp)

Elution in 12 µl milliq Water Yield: 15 ng/µl

21.09.17

Extension PCR with CMV of pIG17_37 and Primers oIG17_280 & and oIG17_281

Forward Extension binds into Lentiviral Backbone (pIG17_83) upstream of restriction site with SpeI.

Reverse Extention binds downstream into e-GFP Sequence of Suicide Gene (pIG17_83).

Sequence:

oIG17_280: Extension: 5`-ATTCAAAATTTTATCGATACTAGCGT-3` Binding Site: 5'- TAGTTATTAATAGTAATCAATTACGGGG - 3'

oIG17_281: Extension: 5`-GCTCCTCGCCCTTGCTCACCAT-3` Binding Site: 5'- TGATACACTTGATGTACTGCCAAG - 3'

Annealing Temperature of 60° was calculated by NEB-Tm-Calculator using Q5-Polymerase.

PCR-Components

ComponentsConcentrationsVolumes [µl]
H2O-29
Template (plG17_34)20 ng/µl5
10 mM FW primer - 2.5
10 mM RW primer-2.5
10mM dNTPs - 0,5
5x Q5 Buffer-10
Q5 Polymerase -0.5
Total-50

PCR-Cycles Expected Fragmens Size: 282 bp

StepDenaturationAnnealingExtensionFinal Elongation Chill
Temperature [°]986072724
Length30 s 20 s30s2 MinutesPause
Cycles 30 x 1Pause

Extension PCR with e-GFP-Hygromycin-Thimidinekinase Cassette

oIG17_282 binds to eGFP Sequence of Suicide Gene.

oIG237 binds to 3'End of Thimidine Kinase, Extension binds downstream of SalI - Restriction site into WPRE-enhancer element of transfer-Plasmid p526 (pIG17_82).

oIG17_282: Binding: 5' - ATGGTGAGCAAGGGCGAGGAGCTGTTC - 3'

oIG17_237: Extension: 5'- GTAATCCAGAGGTTGATTGTCGA - 3' Binding Site: 5'- TCAGTTAGCCTCCCCCATC -3'

Annealing Temperature of 67° was calculated by NEB-Tm-Calculator using Q5-Polymerase

PCR

ComponentsConcentrationsVolumes [µl]
H2O-28.5
Template (plG17_34)20 ng/µl5
10 mM FW primer - 2.5
10 mM RW primer-2.5
10mM dNTPs - 1
5x Q5 Buffer-10
Q5 Polymerase -0.5
Total-50

PCR-Cycles Expected Fragment Size: 2906 bp

StepDenaturationAnnealingExtensionFinal Elongation Chill
Temperature [°]986772724
Length30 s 20 s4 Minutes5 MinutesPause
Cycles 30 x 1Pause

22.09.2017

Gel Run with Extension PCR CMV & eGFP-Hygromycin-TK Fragments

Fragments with 282 bp (extension CMV) & 2906 bp (SG-Cassette) were cut out.

23.09.2017

Gelextraction of extension PCRs with QiaQuick Gel extraction kit

Procedure according provided protocol Elution in 10 µl prewarmed (50°) Milliq H20

Sample
ex.CMV6
ext.SG130

26.10.17

Repetion of extension PCR with CMV

CMV from the Gel-Extraction (23.09.2017) was again used as template.

PCR-Cycles Expected Fragmens Size: 282 bp

StepDenaturationAnnealingExtensionFinal Elongation Chill
Temperature [°]987072724
Length30 s 20 s30s2 MinutesPause
Cycles 40 x 1Pause

27.09.17

Gibson Assembly with CMV-fragment, Suicide-Gene-fragment and lentiviral Backbone p526 pIG17_82

ComponentsConcentrationAmountWeight [pmol]Volume [µl]
Water-1
p526 Backbone-0,01350ng2
CMV-0,0550,5
SG-Cassette-0,0390,5
Gibson Master Mix2x5

Final Construct: pIG17_161

Transformation of pIG17_161 with XL10 Gold

28.9.17

1 Colony pick and O/N of the colony

29.9.17

Miniprep of O/N

Elution in 30 µl prewarmed (50°) Elution Buffer

Yield: 1 µg/µl Second Eluate: 140 µg/µl

Test Digest of pIG17_161

ComponentsConcentrationVolumes [µl]
Water-13,5
DNA140 ng/µl3,5
FAstDigest5x2
NdeI-1µl

Incubate for 30 Minutes on 37 degress.

Expected fragments: 5314 bp & 3647 bp

Gel run

Left, uncomplete Digest, right: 1 µ Control

04.10.2017

Sequencing of pIG17_161

Sample with 1 µg DNA per µl was divided into 6 Samples and sent in for sequencing for with Oligos oIG17_19, oIG17_246, oIG17_247, oIG17_248, oIG17_221 and an eGFP-Custom Primer offered by GATC

30.9.2017

Sequencing results

Sequencing confirmed positive sequence, pIG17_161 was handed over to cell culture for lentiviral transduction

Retransformation of pIG17_161

01.10.2017

Colony Pick & Occulation of 4 Overnight cultures

02.10.2017

Miniprep of 4 O/N

SampleConcentration [ng/µl]
1398
2685
3787
41157

An Glyerolstock of Sample 4 has been made with the Number 161 and Notation CMC_eGFP_Hygromycin_Thimidine_Kinase-transfer.

16.09.17 O/N of Glycerolstock pIG17_83

Miniprep of 10 O/N Cultures pIG17_83

Elution on 37° for 15 Minutes with ddH2O

SampleConcentration [ng/µl]
1262
2294
3389
4375
5278
6305
7261
8205
9321
10401

PEI-Transfection with pIG17_83 (SG) and and CMV-GFP

Experimental Design

Facs Analysis for 3 Days

Triplicates of SG-transfected heks Heks with 5 treatments (0; 100ng; 1µ; 10 µg; 100µg/ml) → 15

Triplicates og pIG17_009 CMV-GFP with 5 Treatments (0; 100ng; 1µ; 10 µg; 100µg/ml) → 15

Untransfected with 5 Treatments

→ 35 Samples per Day for 3 Days → 105 Samples in total

Growth Curve with Ganciclovir

Killing Curve with Ganciclovir and stable cell lines

Tested Range: 0, 100 ng, 1 µg, 10 µg, 100 µg per ml

Triplicates with transfected cell lines und untransfected controls.

Test in a 24-well plate with seeding density of 100.000 cells per ml. → 50.000 cells per well with 0,5 ml Media.

Plate occupation for triplicates with Suicide Gene and untransfected controls:

0123456
A0100ng/ml1 µg/ml10 µg/ml100 µg/ml-
B0100ng/ml1 µg/ml10 µg/ml100 µg/ml-
C0100ng/ml1 µg/ml10 µg/ml100 µg/ml-
D------

Ganciclovir Stock: 10 mg/ml

Set up 50 µl Ganciclovir Stock in 450 µl RPMI in a 1,5 ml Eppi to get a 1:10 dilution (1 mg/ml).

50 µl (1mg/ml GCV) into 450 µl RPMI for 100 µg/ml.

50 µl (100µg/ml into 450 µl RPMI for 10µg/ml.

50 µl (10µg/ml) into 450 µl RPMI for 1µg/ml.

From each tube take 55,5 µl (x µg/ ml) GCV-Medium and pipette into well for a X/10 µg/ml working range.

After induction of cells with GCV, throw the dilutions away, since it is unsure whether it is stable for a longer time in RPMI.

Change media every second day.

Split all the cells once they reach a concentration of 1 Mio cells per ml.