Line 385: | Line 385: | ||
<p><b>Day 1</b></p> | <p><b>Day 1</b></p> | ||
<ul> | <ul> | ||
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">Start a 5 ml pre-culture of TOP10 pCas in LB-Kanamycin. Incubate it overnight at 30°C without shaking.</li> |
</ul> | </ul> | ||
<BR> | <BR> |
Revision as of 03:21, 31 October 2017
Introduction
Materials
- Agarose Powder
- TAE buffer
- Gel mould
- Gel Tank
- DNA ladder
- DNA loading dye
Procedure
- Prepare 0.8% agarose (w/v) solution in TAE buffer.
- Heat until the agarose dissolve.
- Pour into the gel mould and set a comb.
- Wait for the gel to solidify.
- Remove the comb and transfer into the gel tank. Fill with TAE buffer.
- Fill the wells with DNA ladder and your samples mixed with corresponding amount of loading dye.
- Run for 20-30 minutes at 120 V.
T4 Ligation
Materials
- PCR tubes
- T4 DNA Ligase (NEB)
- T4 DNA Ligase buffer 10x
- ddH20
- Insert DNA
Procedure
- Calculate insert to vector ratio with NEB calculator. Most common is 3:1.
- Add the vector plasmid, the insert DNA, 2 µL of buffer, 1 µL of T4 ligase and enough ddH20 to reach 20 µL.
- Gently mix by pipeting up and down.
- For cohesive (sticky) ends, incubate at 16°C overnight or room temperature for 10 minutes. For blunt ends or single base overhangs, incubate at 16°C overnight or room temperature for 2 hours.
- Heat inactivate at 65°C for 10 minutes.
Selection of the sgRNA and modification of pTarget
Introduction
This protocol cover the identification of a suitable N20 sequence and the modification of the pTarget plasmid. Protocol from S. Worms.
Procedure
1) Selection of the N20 sequence
- Use Benchling's CRISPR tool, click on "Design and analyse guide"
- Using the default settings (note: Doench et al.'s optimized scoring algorithm doesn't work for circular sequences such as bacterial chromosomes)
- Select the target region and press (+)
- Select the N20 with the higher On-target score.
2) Modification of pTarget
pTarget is currently available in two version, pTargetF with spectinomycin resistance and pTargetTet_pyrF and its derivatives with a tetracyclin resistance. They should behave identically.
1. Design a forward oligo to use for a QuickChange-like insertion of the N20 sequence. The sequence of the primer should be the following:
agctagctcagtcctaggtataatactagtNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaagttaaaa
where the Ns stands for your N20 sequence.
2. Amplify the pTarget backbone of your choice using the designed forward primer and the appropriate reverse primer (actagtattatacctaggactgagctagctg) using Q5 polymerase and the following conditions:
Temperature (°C) | Time | |
---|---|---|
98 | 30 s | |
98 | 15 s | 35 x |
65 | 30 s | |
72 | 75 s | |
72 | 120 s | |
4 | inf. |
Media
Materials
- NaCl
- Tryptone
- Yeast Extract
- Na2HPO4
- KH2PO4
- NH4Cl
- Glucose
- Tyrosine
- ddH20
- CaSO5
- MgSO4
- Agar
- Heat-resistant glass bottles
Procedure M9 medium
- Make 10xM9 salts.
- Mix the following in 500 mL H20 and sterilize by autoclave.
- Make 1M CaCl2 stock solution The CaCl2 is sterilized separately to avoid formation of CaSO4 precipitate. Dissolve 5.592 g CaC2 to 50 mL H2O and sterilize by filtration or autoclaving.
- Make 1M MgSO4 stock solution.
- Make 20% glucose solution. Dissolve 10g of glucose in 50 mL H2O and sterilize by filtration. Do not autoclave. Dissolve 6.018 g of MgSO4 in 50 mL H2O and sterilize by filtration or autoclaving.
- Make 5x tyrosine solution. Dissolve 0.25 g of tyrosine in 1L H2O and sterilize by filtration.
- Sterilize water by autoclaving.
- For 500 mL.
Mass (g) | |
---|---|
Na2HPO4 | 64 (Na2HPO4.7H2O) |
KH2PO4 | 15 |
NaCl | 2.5 |
NH4Cl | 5 |
M9 | M9 + Tyr | M9 Agar | M9 Agar + Tyr | |
---|---|---|---|---|
10x M9 salts | 50 | 50 | 50 | 50 |
Agar (g) | 0 | 0 | 7.5 | 7.5 |
H2O | 445 | 345 | 445 | 345 |
Autoclave | No | No | Yes | Yes |
M1 MgSO4 | 1 | 1 | 1 | 1 |
M1 CaSO4 | 0,1 | 0,01 | 0,01 | 0,1 |
20% glucose | 5 | 5 | 5 | 5 |
Tyrosine | 0 | 100 | 0 | 100 |
Procedure LB medium
- Mix the following.
- Add ddH2O to the desired volume.
- Sterilize by autoclaving.
Volume (1L) | ||
---|---|---|
LB | LB agar | |
Yeast Extract (g) | 8 | 8 |
Tryptone (g) | 5 | 5 |
NaCl (g) | 5 | 5 |
Agar (g) | 0 | 14 |
Introduction
This protocol is adapted from Jiang et al., 2015. It assumes a version of pTargetTet targeting the correct locus of the E. coli genome has already been created, as well as a donor DNA that include overlap regions and the gene to be inserted. For information on the design and creation of the sgRNA-producing pTarget, see Selection of the sgRNA and modification of pTarget.
Materials
- E. coli strain containing the pCas plasmid.
- pTargetTet targeting the locus to be modified.
- Donor DNA: gene of interest flanked by two 500-bp overlaps, or an ssDNA for deletion.
- LB, Kanamycin, Tetracyclin.
- Arabinose 10%.
- Chilled sterile ddH2O.
- Sterile PEP tube.
- IPTG 0,1 M.
class="montserrat-text uppercase">Procedure
pCas has a thermo-sensitive origin of replication. All steps until pCas curing should be incubated at 30°C
Day 1
- Start a 5 ml pre-culture of TOP10 pCas in LB-Kanamycin. Incubate it overnight at 30°C without shaking.
Day 2
Competent cells
- Start a culture for transformation by inoculating 40 ml of LB-Kan with 400 µl of pre-culture. Incubate in a 250 ml flask at 30°C until an OD600 between 0,4 and 0,6 is attained.
- Add 600 µl of 10% arabinose to the culture to cause the induction of the λ-Red genes. Incubate for 15 minutes at 30°C.
- Chill the culture in a water-ice bath. Transfer to a 50 ml centrifuge tube and centrifuge at 4600 x g for 7 minutes in a centrifuge cooled to 4°C.
- Add 30 ml of ice-cold water to the pellet. Swirl gently to resuspend the cells. Centrifuge again as described in step 5.
- Resuspend the pellet in 1 ml of cold ddH2O. Transfer it using a 1000 µl tip to a pre-chilled sterile EP tube. Centrifuge down at 10.000 x g for 4 seconds in a chilled tabletop centrifuge. (Note, due to speed-up time, doing a quickspin up to 10.000 x g and then letting it slow down is usually good enough) Carefully pipette out the supernatant.
- Repeat step 7.
- Resuspend cells in 200 µl of chilled ddH2O. Keep on ice until ready to transform.
Transformation
- Using a 1-mm transformation culture, electroporate 100 ng of pTargetTet plasmid and 400 ng of linear donor DNA in 50 µl of competent cells (Note: when using an ssDNA oligo instead of dsDNA linear donor DNA, transform 100 ng of the plasmid with 100 ng of oligo). Recover the cells at 30°C for 1 hour in SOC medium then plate on LB-Tet-Kan plates. Incubate the plate at 30°C overnight. (Note: it often takes up to 48 hours for colony to show up).
- Screen transformant by colony PCR to identify correct clones.
Plasmid curing
- To cure the plasmids, resuspend a colony in 2 ml of LB-Kan to which 10 µl of IPTG 0,1 M are added (Final concentration: 0,5 mM) and the culture is grown overnight at 30 °C. In the morning, the colonies are plated on LB plates and incubated at 37°C O/N to cure them of the pCas plasmid.
Materials
- 400 W LEO / S-400-94-CR light
- Five 12-wells plates
- M9, LB
- Tyrosine, ortho-nitrobenzyl tyrosine, L-arabinose
Precultures procedure
- Inoculate 10 mL of liquid LB and incubate at 37°C overnight with appropriate antibiotic
- Bl21(DE3), TyrA- (not transformed), TyrA- + RFP
Fluorescence test procedure
- Pellet precultures at 3000 xg for 10 minutes at 4°C
- Wash 3x with 5 mL liquid M9 to remove tyrosine present in medium
- When OD600 ~ 0.6, concentrate 10X
- Add the following in each well of a 12-wells plate (final volume 3 mL, completed with liquid M9). Make three replicas.
Tyr + Ara (BL21) | Tyr (BL21) | ONB-Tyr + Ara (BL21) | ONB-Tyr (BL21) |
Tyr + Ara (TyrA-) | Tyr (TyrA-) | ONB-Tyr + Ara (TyrA-) | ONB-Tyr (TyrA-) |
Tyr + Ara (TyrA-/RFP) | Tyr (TyrA-/RFP) | ONB-Tyr + Ara (TyrA-/RFP) | ONB-Tyr (TyrA-/RFP) |
Concentrations
- Tyrosine: 0.05 mg/mL
- ONB-Tyr: 0.084 mg/mL
- L-arabinose: 0.1% (w/v)
- KAN30, CM34