Difference between revisions of "Team:IISc-Bangalore/Assembly"

Line 30: Line 30:
 
<table>
 
<table>
 
<tr>
 
<tr>
<th colspan="3">PCR 1 — T7 Expression Backbone (Piece 1)</th>
+
<th colspan="2">PCR 1 — T7 Expression Backbone (Piece 1)</th>
 
<tr>
 
<tr>
<th colspan="2">Template</th>
+
<th>Template</th>
 
<td><a href="http://parts.igem.org/Part:BBa_K525998">BBa_K525998</a> (T7 promoter+RBS)</td>
 
<td><a href="http://parts.igem.org/Part:BBa_K525998">BBa_K525998</a> (T7 promoter+RBS)</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<th rowspan="2">Forward primer</th>
 
<th rowspan="2">Forward primer</th>
<th>Sequence</th>
 
 
<td>gactacc<u>acggcatgatgaacctgaatcgc</u></td>
 
<td>gactacc<u>acggcatgatgaacctgaatcgc</u></td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<th>Features</th>
 
 
<td>Splits the CmR gene, includes NcoI site</td>
 
<td>Splits the CmR gene, includes NcoI site</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<th rowspan="2">Reverse primer</th>
 
<th rowspan="2">Reverse primer</th>
<th>Sequence</th>
 
 
<td>gaattcAAGCTT<u>tttctcctctttccctatagtgagtcg</u></td>
 
<td>gaattcAAGCTT<u>tttctcctctttccctatagtgagtcg</u></td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<th>Features</th>
 
 
<td>Adds HindIII site after T7 promoter+RBS</td>
 
<td>Adds HindIII site after T7 promoter+RBS</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<th colspan="2">Amplicon size</th>
+
<th>Amplicon size</th>
 
<td>886 bp</td>
 
<td>886 bp</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<th colspan="2">Polymerase</th>
+
<th>Polymerase</th>
 
<td>Q5 polymerase</td>
 
<td>Q5 polymerase</td>
 
</tr>
 
</tr>

Revision as of 10:33, 31 October 2017

  1. BioBrick Transformations
  2. Plasmid Isolation
  3. PCRs
  4. Restriction digests
  5. Ligations
  6. Screening

BioBrick Transformations

The five BioBricks we are using are transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

INSERT IMAGES OF PLATES

Plasmid Isolation

Minipreps are performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants is used to make a glycerol stock.

INSERT GEL IMAGES

PCRs: Adding Restriction Sites and Linkers

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCR 1: Piece 1 of the T7 Expression Backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template BBa_K525998 (T7 promoter+RBS)
Forward primer gactaccacggcatgatgaacctgaatcgc
Splits the CmR gene, includes NcoI site
Reverse primer gaattcAAGCTTtttctcctctttccctatagtgagtcg
Adds HindIII site after T7 promoter+RBS
Amplicon size 886 bp
Polymerase Q5 polymerase

Restriction Digests

Restriction enzymes used in our assembly
Restriction Enzyme Sequence Activity in NEBuffers (%) Incubation temperature Heat inactivation
1.1 2.1 3.1 CutSmart
AgeI A\CCGGT 100 75 25 75 37°C 65°C
AgeI-HF A\CCGGT 100 50 10 100 37°C 65°C
BamHI G\GATCC 75* 100* 100 100* 37°C
BamHI-HF G\GATCC 100 50 10 100 37°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
NcoI C\CATGG 100 100 100 100 37°C 80°C
NcoI-HF C\CATGG 50 100 10 100 37°C 80°C
NheI G\CTAGC 100 100 10 100 37°C 65°C
NheI-HF G\CTAGC 100 25 10 100 37°C 80°C
* denotes star activity| NOTE ADD NdeI TOO

Multi-Ligation: Coming Full Circle

Screening Transformants: Colony PCR with VF2/VR