BioBrick Transformations

The five BioBricks we are using are transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

INSERT IMAGES OF PLATES

Plasmid Isolation

Minipreps are performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants is used to make a glycerol stock.

INSERT GEL IMAGES

PCRs: Adding Restriction Sites and Linkers

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCR 1: Piece 1 of the T7 Expression Backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template	BBa_K525998 (T7 promoter+RBS)
Forward primer	gactaccacggcatgatgaacctgaatcgc
	Splits the CmR gene, includes NcoI site
Reverse primer	gaattcAAGCTTtttctcctctttccctatagtgagtcg
	Adds HindIII site after T7 promoter+RBS
Amplicon size	886 bp
Polymerase	Q5 polymerase

Restriction Digests

Restriction enzymes used in our assembly
Restriction Enzyme	Sequence	Activity in NEBuffers (%)				Incubation temperature	Heat inactivation
		1.1	2.1	3.1	CutSmart
AgeI	A\CCGGT	100	75	25	75	37°C	65°C
AgeI-HF	A\CCGGT	100	50	10	100	37°C	65°C
BamHI	G\GATCC	75*	100*	100	100*	37°C	—
BamHI-HF	G\GATCC	100	50	10	100	37°C	—
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
NcoI	C\CATGG	100	100	100	100	37°C	80°C
NcoI-HF	C\CATGG	50	100	10	100	37°C	80°C
NheI	G\CTAGC	100	100	10	100	37°C	65°C
NheI-HF	G\CTAGC	100	25	10	100	37°C	80°C
* denotes star activity| NOTE ADD NdeI TOO

Multi-Ligation: Coming Full Circle

Screening Transformants: Colony PCR with VF2/VR