Difference between revisions of "Team:UCopenhagen/Parts"

Line 26: Line 26:
 
             <div>
 
             <div>
 
                     <div class="clearfix"></div>
 
                     <div class="clearfix"></div>
−
                     <h2 class="section-heading">Cell measurements </h2>
+
                     <h2 class="section-heading">Guide RNA (gRNA) </h2>
−
                     <p class="lead">Two colonies from each transformation were picked, and grown in foil-covered 50 ml falcon tubes over night (18 hours). </p>
+
                     <p class="lead">
−
<p class="lead"><strong>Preparation</strong> OD was measured, and a dilution was calculated to achieve an OD of 0.02. Dilution calculations can be found in the table next to this. Here we used the calculated correction factor from our initial abs/OD calibration. From the absorption measurements taken at 0 hours, we see indications of pipetting errors, as the OD<sub>600</sub> (average) ranges from 0.015 to 0.6 (table 1). </p>
+
<ul style="text-align:left; color:white;">
 +
<li>1. gRNA 1  GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)</li>
 +
<li>2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)</li>
 +
<li>3. gRNA 3·    GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016) </li>
 +
</ul>
 +
</p>    </p>
  
 
<div class="container">
 
<div class="container">

Revision as of 11:16, 31 October 2017

P A R T S

Guide RNA (gRNA)

  • 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
  • 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
  • 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)

Table 1 Starting OD.
Abs600 OD600 before Volume (ml) added to 12 ml media OD600 after dilution (0 hours)
Negative Control (Colony 1) 0,461 1,435 0,167 0,06483974
Negative Control (Colony 2) 0,463 1,439 0,167 0,02584249
Positive Control (Colony 1) 0,450 1,400 0,171 0,04467949
Positive Control (Colony 2) 0,474 1,475 0,163 0,01689103
Test Device 1: J23101+I13504 (Colony 1) 0,462 1,437 0,167 0,03043498
Test Device 1: J23101+I13504 (Colony 2) 0,472 1,469 0,163 0,01977106
Test Device 2: J23106+I13504 (Colony 1) 0,477 1,483 0,162 0,03175824
Test Device 2: J23106+I13504 (Colony 2) 0,454 1,410 0,170 0,018837
Test Device 3: J23117+I13504 (Colony 1) 0,507 1,577 0,152 0,03261447
Test Device 3: J23117+I13504 (Colony 2) 0,492 1,529 0,157 0,01471154
Test Device 4: J23101.BCD2.E0040.B0015 (Colony 1) 0,420 1,307 0,184 0,03759615
Test Device 4: J23101.BCD2.E0040.B0015 (Colony 2) 0,472 1,468 0,163 0,01860348
Test Device 5: J23106.BCD2.E0040.B0015 (Colony 1) 0,513 1,595 0,150 0,04234432
Test Device 5: J23106.BCD2.E0040.B0015 (Colony 2) 0,467 1,451 0,165 0,01494505
Test Device 6: J23117.BCD2.E0040.B0015 (Colony 1) 0,482 1,498 0,160 0,04452381
Test Device 6: J23117.BCD2.E0040.B0015 (Colony 2) 0,455 1,416 0,170 0,02008242

Find Incell here: