1. Thaw Xl10 competent cells from -80 ° Freezer on 30 Minutes on Ice.
2. Add Plasmid DNA [2 µl, dependent on concentration] and let stand on Ice for 30 Minutes.
3. Heat shock on 42 ° for 45 Seconds and let stand for 2 minutes on Ice.
4. Add LB-Medium [450 µl] without antibiotics and incubate for 37 ° for 60 minutes and 300 rounds per minute.
5. Plate Culture with antiobiotic resistence on LB-plate with corresponding antibiotics.
6. (If overgrown, dilute streak bacteria colonies on another plate.)

Pick four single colonies and oculate four overnight cultures with LB-AMP [6 ml each] in glas reaction tubes.

1. Elution in pre-warmed (50°) Elution Buffer [30 µl].

All Controls were performed with autoclaved water [18 µl] and of Plasmid-Solution [2 µl].

Top Band XbaI with Suicide Gene 1-4 with Controls in between

Expected Fragments: 4617 bp, 3495 bp & 1712 bp

Lower Band KpnI with Suicide Gene 1-4 with Controls in between

Expected Fragments: 4926 bp, 3867 bp & 1031 bp

Incubate for 60 minutes at 37 °. 4 µl 6X Orange Dye was added to each Sample. DNA-Ladder: 5 µl 1kb GeneRuler plus

1. Heat up 85 ml (small) or 120 ml (big) 1 x TAE-Buffer with 1 mass percent Agarose in the microwave until the Agarose has dissolved completely.
2. Add 5 µl (small) or 7 µl (big) Midori-Green DNA Stain to the heated TAE-Agarose mix and pour into respective gel-chamber with desired comb.
3. Let it cool for >45 minutes until it has complete solidificated.
4. Remove comb carefully to reveal the gel slots.
5. Pour 1 x TAE-Buffer over the cooled down gel until it is completely covered in liquid.

1. Put 5µl (small gel) or 8 µl (big gel) DNA ladder (1kb GeneRuler plus) into slot for use as reference.
2. Mix DNA Sample with Loading Dye for desired Dilution (6x Purple or Orange Loading Dye)
3. Load Gel Slot with Dna Sample
4. Run the Gel with following settings: 120 Volt, 3 Watte, 15 Ampere for 45 Minutes.
5. Visualize in the Gelbox with Exposure Time of 64 seconds and UV-Light.

Gel-Image

First four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): NdeI with Suicide Gene 1 & 2 with Controls in between.

Last four Slots of Top Band (Cutsmart) and Lower Band (Fast Digest): PvuII with Suicide Gene 3 & 4 with Controls in between.

NdeI with SG 1 & 2 Expected fragements: 7071 bp & 2753 bp

PvuII with SG 3 & 4. Expected Fragements: 7311 bp & 2513 bp

Ladder: 5µl 1KB GeneRuler PLus

Samples 3 & and 4 have been confirmed as correct fragments.

A glycerolstock of Sample 3 has been made and put into the -80° Freezer

4 Colonies have been picked from an LB-Plate.

Elution in 30 µl prewarmed (50°) Elution Buffer

Third slot: Digest of p526, Top fragment (Backbone)

Elution in 12 µl milliq Water Yield: 15 ng/µl

Forward Extension binds into Lentiviral Backbone (pIG17_83) upstream of restriction site with SpeI.

Reverse Extention binds downstream into e-GFP Sequence of Suicide Gene (pIG17_83).

Sequence:

oIG17_280: Extension: 5`-ATTCAAAATTTTATCGATACTAGCGT-3` Binding Site: 5'- TAGTTATTAATAGTAATCAATTACGGGG - 3'

oIG17_281: Extension: 5`-GCTCCTCGCCCTTGCTCACCAT-3` Binding Site: 5'- TGATACACTTGATGTACTGCCAAG - 3'

Annealing Temperature of 60° was calculated by NEB-Tm-Calculator using Q5-Polymerase.

PCR-Components

PCR-Cycles Expected Fragmens Size: 282 bp

oIG17_282 binds to eGFP Sequence of Suicide Gene.

oIG237 binds to 3'End of Thimidine Kinase, Extension binds downstream of SalI - Restriction site into WPRE-enhancer element of transfer-Plasmid p526 (pIG17_82).

oIG17_282: Binding: 5' - ATGGTGAGCAAGGGCGAGGAGCTGTTC - 3'

oIG17_237: Extension: 5'- GTAATCCAGAGGTTGATTGTCGA - 3' Binding Site: 5'- TCAGTTAGCCTCCCCCATC -3'

Annealing Temperature of 67° was calculated by NEB-Tm-Calculator using Q5-Polymerase

PCR

PCR-Cycles Expected Fragment Size: 2906 bp

First Slot: 1 kb GeneRuler PLus Ladder

Second Slot: CMV (282 bp)

Third slot: Suicide Gene Cassette (2906 bp)

Fragments with 282 bp (extension CMV) & 2906 bp (SG-Cassette) were cut out.

Procedure according provided protocol Elution in 10 µl prewarmed (50°) Milliq H20

CMV from the Gel-Extraction (23.09.2017) was again used as template.

PCR-Cycles Expected Fragmens Size: 282 bp

No gel run.

Final Construct: pIG17_161

Elution in 30 µl prewarmed (50°) Elution Buffer

Yield: 1 µg/µl Second Eluate: 140 µg/µl

Incubate for 30 Minutes on 37 degress.

Expected fragments: 5314 bp & 3647 bp

First Slot: 1 Kb GeneRuler PLus Ladder

Second Slot: Digest with fragments of 8961 bp (uncomplete digest) 5314 bp & 3647 bp.

Third Slot: Undigested Control

Sample with 1 µg DNA per µl (30 µl) was divided into 6 Samples and sent in for sequencing for with Oligos oIG17_19, oIG17_246, oIG17_247, oIG17_248, oIG17_221 and an eGFP-Custom Primer offered by GATC.

Sequencing confirmed positive sequence, pIG17_161 was handed over to cell culture for lentiviral transduction

An Glyerolstock of Sample 4 has been made with the Number 161 and Notation CMC_eGFP_Hygromycin_Thimidine_Kinase-transfer.

Elution on 37° for 15 Minutes with ddH2O

Survival Rates