Line 152: | Line 152: | ||
</table> | </table> | ||
</div> | </div> | ||
+ | |||
+ | <div id="bodyContent"> | ||
+ | <div id="mw-content-text" lang="en" dir="ltr" class="mw-content-ltr"><p><br> | ||
+ | <span style="font-size: 150%; font-weight: bold;">7alpha-HSDH</span> | ||
+ | </p><p>7alpha-HSDH (7alpha-hydroxysteroid dehydrogenase) catalyzes the oxidation of hydroxysteroids at C-7 position and back, as it converts NAD+ to NADH and back. It catalyzes the oxidation of CDCA into intermediate product 7-oxo-LAC (7-ketolithocholic acid), where the hydroxyl at C-7 position becomes carbonyl.[1] | ||
+ | </p><p><br> | ||
+ | <span class="h3bb">Sequence and Features</span> | ||
+ | </p> | ||
+ | <script src="http://parts.igem.org/cgi/partsdb/seq_edit/all.js"></script> <div id="sequencePaneDiv" style="clear: both; display: block; top: 0px; left: 0px; z-index: 20; background-color: white; border: 1px solid gray;"> <input type="hidden" id="new_dna_format" name="new_dna_format" value="_ruler_"> <input type="hidden" id="selection_start" name="selection_start" value="1"> <input type="hidden" id="selection_end" name="selection_end" value="0"><form id="saveForm" action="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2239011" method="POST" style="display: none;"><input type="hidden" id="primaryPartId" name="primaryPartId" value="43571"><input type="hidden" id="seqHidden" name="seqHidden" value="catcatcatcatcatcactttaattctgacaacctgagactcgacggaaaatgcgccatcatcacaggtgcgggtgcaggtattggtaaagaaatcgcca | ||
+ | ttacattcgcgacagctggcgcatctgtggtggtcagtgatattaacgccgacgcagctaaccatgttgtagacgaaattcaacaactgggtggtcaggc | ||
+ | atttgcctgccgttgtgatattacttccgaacaggaactctctgcactggcagactttgccgtcagtaagctgggtaaagttgatatcctggttaacaac | ||
+ | gccggtggcggtggtcctaaaccgtttgatatgccaatggcagattttcgccgtgcttatgaactgaatgtgttttcttttttccatctgtcacaacttg | ||
+ | ttgcgccagaaatggaaaaaaatggcggtggcgttattctgaccatcacttctatggcggcagaaaataaaaatataaacatgacttcctatgcatcatc | ||
+ | taaagctgcggccagtcatctggtcagaaatatggcatttgacctgggtgaaaaaaatattcgggtgaatggcattgcgccgggggcaatattaaccgat | ||
+ | gccctgaaatccgttattacaccagaaattgaacaaaaaatgttacagcacacgccgatcatacgtctgggccaaccgcaagatattgctaacgcggcgc | ||
+ | tgttcctttgctcgcctgctgccagctgggtaagcggacaaattctcaccgtctccggtggtggggtacaggagctcaat | ||
+ | "><input type="hidden" id="firstHidden" name="firstHidden" value=""><input type="hidden" id="lastHidden" name="lastHidden" value=""></form><div style="position: relative; top: 0px; left: 0px; height: 16px; background-color: rgb(221, 221, 221); padding: 5px; border-bottom: 1px solid gray; font-family: arial, sans-serif;"><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; cursor: pointer; color: rgb(102, 102, 102); text-decoration: none;">Subparts</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif;">|</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: bold; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; cursor: pointer; color: black; text-decoration: none;">Ruler</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif;">|</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; cursor: pointer; color: blue; text-decoration: underline;">SS</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif;">|</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; cursor: pointer; color: blue; text-decoration: underline;">DS</span><span style="display: inline; line-height: 15px; padding-left: 50px; font-style: normal; font-variant: normal; font-weight: bold; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif;">Length: 780 bp</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; float: right; padding-right: 10px; color: blue; cursor: pointer;">Get part sequence.</span><span style="display: inline; line-height: 15px; padding-left: 5px; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 13px; font-family: arial, sans-serif; float: right; padding-right: 10px; color: blue; cursor: pointer;">View plasmid<img src="http://parts.igem.org/images/labgenius_p_icon.png" style="width: 15px; height: 15px; position: relative; top: -2px; padding-left: 5px;"></span></div><span class="Size_Pane" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; color: white;">. .</span><span class="Ruler_Pane" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; color: black; left: 40px; display: none;">1 11 21 31 41 51 61 71 81 91</span><div style="position: relative; display: block;"><span class="Ruler_Pane" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; display: block;">1 100 200 300 400 500 600 700 800</span><div style="position: relative; left: 40px; height: 9px; width: 764px;"><div style="position: absolute; top: 4px; left: 0px; height: 1px; width: 763px; border-top: 1px solid black;"></div><div style="position: absolute; top: 0px; left: 0px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 19px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 38px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 57px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 76px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 95px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 114px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 134px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 153px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 172px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 191px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 210px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 229px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 248px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 267px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 286px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 305px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 324px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 343px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 362px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 382px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 401px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 420px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 439px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 458px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 477px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 496px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 515px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 534px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 553px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 572px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 591px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 610px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 629px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 649px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 668px; height: 9px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 687px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 706px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 725px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 2px; left: 744px; height: 5px; width: 1px; background-color: black;"></div><div style="position: absolute; top: 0px; left: 763px; height: 9px; width: 1px; background-color: black;"></div></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: block;"><div style="position: relative; height: 10px; background-color: white;"></div><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 53px;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 18px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 25px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 32px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 39px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 46px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 53px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 60px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 67px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 74px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 81px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 88px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 95px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 102px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 109px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 116px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 123px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 130px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 137px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 144px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 151px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 158px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 165px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 172px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 179px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 186px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 193px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 200px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 207px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 214px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 221px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 228px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 235px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 242px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 249px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 256px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 263px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 270px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 277px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 284px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 291px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 298px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 305px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 312px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 319px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 326px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 333px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 340px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 347px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 354px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 361px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 368px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 375px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 382px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 389px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 396px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 403px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 410px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 417px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 424px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 431px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 438px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 445px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 452px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 459px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 466px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 473px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 480px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 487px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 494px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 501px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 508px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 515px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 522px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 529px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 536px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 543px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 550px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 557px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 564px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 571px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 578px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 585px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 592px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 599px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 606px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 613px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 620px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 627px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 634px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 641px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 648px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 655px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 662px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 669px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 676px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 683px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 690px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 697px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 704px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 711px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 718px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 725px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 732px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 739px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 353.55px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div><img src="http://parts.igem.org/images/f_icons/tag_l.png" style="top: 24px; left: 1px; height: 7px; width: 1px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_r.png" style="top: 24px; left: 15px; height: 7px; width: 1px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 24px; left: 2px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 24px; left: 9px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 31px; left: 0px; height: 11px; position: absolute; z-index: 60;">his-tag</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 63px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 63px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">catcatcatc atcatcactt taattctgac aacctgagac tcgacggaaa atgcgccatc atcacaggtg cgggtgcagg tattggtaaa gaaatcgcca<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">1</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">gtagtagtag tagtagtgaa attaagactg ttggactctg agctgccttt tacgcggtag tagtgtccac gcccacgtcc ataaccattt ctttagcggt</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 421.55px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div><img src="http://parts.igem.org/images/f_icons/tag_l.png" style="top: 0px; left: 1px; height: 7px; width: 1px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_r.png" style="top: 0px; left: 132px; height: 7px; width: 1px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 2px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 9px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 16px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 23px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 30px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 37px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 44px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 51px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 58px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 65px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 72px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 79px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 86px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 93px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 100px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 107px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 114px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 121px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/tag_m.png" style="top: 0px; left: 128px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 49.85px; height: 11px; position: absolute; z-index: 60;">his-tag</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">ttacattcgc gacagctggc gcatctgtgg tggtcagtga tattaacgcc gacgcagcta accatgttgt agacgaaatt caacaactgg gtggtcaggc<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">101</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">aatgtaagcg ctgtcgaccg cgtagacacc accagtcact ataattgcgg ctgcgtcgat tggtacaaca tctgctttaa gttgttgacc caccagtccg</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">atttgcctgc cgttgtgata ttacttccga acaggaactc tctgcactgg cagactttgc cgtcagtaag ctgggtaaag ttgatatcct ggttaacaac<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">201</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">taaacggacg gcaacactat aatgaaggct tgtccttgag agacgtgacc gtctgaaacg gcagtcattc gacccatttc aactatagga ccaattgttg</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">gccggtggcg gtggtcctaa accgtttgat atgccaatgg cagattttcg ccgtgcttat gaactgaatg tgttttcttt tttccatctg tcacaacttg<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">301</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">cggccaccgc caccaggatt tggcaaacta tacggttacc gtctaaaagc ggcacgaata cttgacttac acaaaagaaa aaaggtagac agtgttgaac</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">ttgcgccaga aatggaaaaa aatggcggtg gcgttattct gaccatcact tctatggcgg cagaaaataa aaatataaac atgacttcct atgcatcatc<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">401</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">aacgcggtct ttaccttttt ttaccgccac cgcaataaga ctggtagtga agataccgcc gtcttttatt tttatatttg tactgaagga tacgtagtag</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">taaagctgcg gccagtcatc tggtcagaaa tatggcattt gacctgggtg aaaaaaatat tcgggtgaat ggcattgcgc cgggggcaat attaaccgat<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">501</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">atttcgacgc cggtcagtag accagtcttt ataccgtaaa ctggacccac tttttttata agcccactta ccgtaacgcg gcccccgtta taattggcta</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">gccctgaaat ccgttattac accagaaatt gaacaaaaaa tgttacagca cacgccgatc atacgtctgg gccaaccgca agatattgct aacgcggcgc<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">601</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">cgggacttta ggcaataatg tggtctttaa cttgtttttt acaatgtcgt gtgcggctag tatgcagacc cggttggcgt tctataacga ttgcgccgcg</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: 765px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 610px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 617px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 624px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 631px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 638px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 645px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 652px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 659px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 666px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 673px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 680px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 687px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 694px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 701px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 708px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 715px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 722px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 729px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 736px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 743px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 750px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 757px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 355.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div class="Row_Pane" style="position: relative; top: 0px; left: 0px; z-index: 40; background-color: white; display: none;"><div style="position: relative; height: 10px; background-color: white;"></div><span class="BP_seqDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">tgttcctttg ctcgcctgct gccagctggg taagcggaca aattctcacc gtctccggtg gtggggtaca ggagctcaat<div class="BP_indexDiv" style="position: absolute; top: 0px; left: -40px; z-index: 60; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; display: none;">701</div></span><span class="BP_compDiv" style="position: relative; white-space: pre; font-style: normal; font-variant: normal; font-weight: normal; font-stretch: normal; font-size: 12px; line-height: 12px; font-family: monospace; left: 40px; z-index: 60; display: none;">acaaggaaac gagcggacga cggtcgaccc attcgcctgt ttaagagtgg cagaggccac caccccatgt cctcgagtta</span><div class="featureDiv" style="position: relative; top: 1px; left: 40px; width: 100px; z-index: 60; height: 29px;"><img src="http://parts.igem.org/images/f_icons/arrow_r.png" style="top: 0px; left: -8px; height: 5px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 1px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 8px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 15px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 22px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 29px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 36px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 43px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 50px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 57px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 64px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 71px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 78px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 85px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 92px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 99px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 106px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 113px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 120px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 127px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 134px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 141px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 148px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 155px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 162px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 169px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 176px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 183px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 190px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 197px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 204px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 211px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 218px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 225px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 232px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 239px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 246px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 253px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 260px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 267px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 274px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 281px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 288px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 295px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 302px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 309px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 316px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 323px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 330px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 337px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 344px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 351px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 358px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 365px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 372px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 379px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 386px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 393px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 400px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 407px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 414px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 421px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 428px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 435px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 442px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 449px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 456px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 463px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 470px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 477px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 484px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 491px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 498px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 505px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 512px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 519px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 526px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 533px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 540px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 547px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 554px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 561px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 568px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 575px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 582px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 589px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 596px; height: 7px; width: 7px; position: absolute; z-index: 60;"><img src="http://parts.igem.org/images/f_icons/protein_m.png" style="top: 0px; left: 603px; height: 7px; width: 7px; position: absolute; z-index: 60;"><div style="font-size: 85%; white-space: nowrap; top: 7px; left: 278.05px; height: 11px; position: absolute; z-index: 60;">7alpha-HSDH</div></div><div class="Hilite" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 2px; z-index: 50; background-color: rgb(170, 170, 238); visibility: hidden;"></div><div class="Cover_Div" style="position: absolute; top: 0px; left: 0px; height: 39px; width: 943px; z-index: 70;"></div></div><div style="position: relative; height: 60px; display: none;"></div></div> <script> var sequence = new String('catcatcatcatcatcactttaattctgacaacctgagactcgacggaaaatgcgccatcatcacaggtgcgggtgcaggtattggtaaagaaatcgccattacattcgcgacagctggcgcatctgtggtggtcagtgatattaacgccgacgcagctaaccatgttgtagacgaaattcaacaactgggtggtcaggcatttgcctgccgttgtgatattacttccgaacaggaactctctgcactggcagactttgccgtcagtaagctgggtaaagttgatatcctggttaacaacgccggtggcggtggtcctaaaccgtttgatatgccaatggcagattttcgccgtgcttatgaactgaatgtgttttcttttttccatctgtcacaacttgttgcgccagaaatggaaaaaaatggcggtggcgttattctgaccatcacttctatggcggcagaaaataaaaatataaacatgacttcctatgcatcatctaaagctgcggccagtcatctggtcagaaatatggcatttgacctgggtgaaaaaaatattcgggtgaatggcattgcgccgggggcaatattaaccgatgccctgaaatccgttattacaccagaaattgaacaaaaaatgttacagcacacgccgatcatacgtctgggccaaccgcaagatattgctaacgcggcgctgttcctttgctcgcctgctgccagctgggtaagcggacaaattctcaccgtctccggtggtggggtacaggagctcaat'); var seqFeatures = new Array( ['protein',19,780,'7alpha-HSDH', 0], ['tag',1,18,'his-tag', 0]); var subParts = null; var Format = '_ruler_'; var PrimaryPartName = 'BBa_K2239011'; var PrimaryPartID = '43571'; var Selection_Start = 0; var Selection_End = 0; showSeqFeatures(false); </script><div style="position:relative;clear:both;width:100%"><div style=""> | ||
+ | <p><style type="text/css"> | ||
+ | .compatibility_div ul, | ||
+ | .compatibility_div li { | ||
+ | display: inline; | ||
+ | } | ||
+ | .compatibility_div li { | ||
+ | position: relative; | ||
+ | padding-top: 2px; | ||
+ | padding-left:4px; | ||
+ | padding-right:3px; | ||
+ | margin-right:2px; | ||
+ | margin-bottom: 5px; | ||
+ | } | ||
+ | .compatibility_div .box { | ||
+ | top: 35px; | ||
+ | width: 200px; | ||
+ | left: 0px; | ||
+ | } | ||
+ | .compatibility_div .box_white { | ||
+ | border: 1px solid gray; | ||
+ | background-color: white; | ||
+ | } | ||
+ | .compatibility_div .box_red { | ||
+ | border: 1px solid #dd6666; | ||
+ | background-color: #ffcccc; | ||
+ | background-image: url('http://parts.igem.org/images/red_not/red_box.png'); | ||
+ | background-repeat: none; | ||
+ | } | ||
+ | .compatibility_div .box_green { | ||
+ | border: 1px solid #44ee44; | ||
+ | background-color: #aaffaa; | ||
+ | } | ||
+ | </p><p><br /> | ||
+ | </p> | ||
+ | </style></p><div class="compatibility_div" style="display:inline"> | ||
+ | Assembly Compatibility:<ul> | ||
+ | |||
+ | <li class="boxctrl box_green">10<div class="box"><div>COMPATIBLE WITH RFC[10]</div></div></li> | ||
+ | <li class="boxctrl box_green">12<div class="box"><div>COMPATIBLE WITH RFC[12]</div></div></li> | ||
+ | <li class="boxctrl box_green">21<div class="box"><div>COMPATIBLE WITH RFC[21]</div></div></li> | ||
+ | <li class="boxctrl box_green">23<div class="box"><div>COMPATIBLE WITH RFC[23]</div></div></li> | ||
+ | <li class="boxctrl box_green">25<div class="box"><div>COMPATIBLE WITH RFC[25]</div></div></li> | ||
+ | <li class="boxctrl box_green">1000<div class="box"><div>COMPATIBLE WITH RFC[1000]</div></div></li> | ||
+ | </ul> | ||
+ | </div></div></div> | ||
+ | <p><br> | ||
+ | </p> | ||
+ | <!-- | ||
+ | NewPP limit report | ||
+ | CPU time usage: 0.009 seconds | ||
+ | Real time usage: 0.426 seconds | ||
+ | Preprocessor visited node count: 8/1000000 | ||
+ | Preprocessor generated node count: 54/1000000 | ||
+ | Post‐expand include size: 0/2097152 bytes | ||
+ | Template argument size: 0/2097152 bytes | ||
+ | Highest expansion depth: 2/40 | ||
+ | Expensive parser function count: 0/100 | ||
+ | --> | ||
+ | </div> <div class="visualClear"></div> | ||
+ | |||
+ | |||
+ | <!-- Contributions --> | ||
+ | <div id="contributionWrapper"></div> | ||
+ | <script>jQuery('#contributionWrapper').load('http://parts.igem.org/cgi/contributions/wrapper_reply.cgi', | ||
+ | { part: 'BBa K2239011'}); | ||
+ | </script> | ||
+ | <!-- end contributions --> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
<br> | <br> |
Revision as of 02:22, 2 November 2017
Name | Type | Description | Designer | Length |
---|---|---|---|---|
BBa_K2239001 | Generator | ChBD-7alphaHSDH | Ruohong Wang | 1089 |
BBa_K2239002 | Generator | ChBD-7betaHSDH | Ruohong Wang | 1179 |
BBa_K2239003 | Generator | ChBD-LDH | Ruohong Wang | 1323 |
BBa_K2239004 | Generator | ChBD-GDH | Ruohong Wang | 1107 |
BBa_K2239005 | Generator | ChBD-GFP | Ruohong Wang | 1047 |
BBa_K2239006 | Generator | CBD-7alphaHSDH | Ruohong Wang | 1080 |
BBa_K2239007 | Generator | CBD-7betaHSDH | Ruohong Wang | 1170 |
BBa_K2239008 | Generator | CBD-LDH | Ruohong Wang | 1314 |
BBa_K2239009 | Generator | CBD-GDH | Ruohong Wang | 1098 |
BBa_K2239010 | Generator | CBD-GFP | Ruohong Wang | 1038 |
BBa_K2239011 | Coding | 7alpha-HSDH | Ruohong Wang | 780 |
BBa_K2239012 | Coding | 7beta-HSDH | Ruohong Wang | 870 |
BBa_K2239013 | Coding | GFP | Ruohong Wang | 738 |
BBa_K2239014 | Coding | GDH (glucose dehydrogenas) | Ruohong Wang | 798 |
BBa_K2239015 | Coding | LDH ( lactate dehydrogenase) | Ruohong Wang | 1014 |
7alpha-HSDH
7alpha-HSDH (7alpha-hydroxysteroid dehydrogenase) catalyzes the oxidation of hydroxysteroids at C-7 position and back, as it converts NAD+ to NADH and back. It catalyzes the oxidation of CDCA into intermediate product 7-oxo-LAC (7-ketolithocholic acid), where the hydroxyl at C-7 position becomes carbonyl.[1]
Sequence and Features
Subparts|Ruler|SS|DSLength: 780 bpGet part sequence.View plasmid
. .1 100 200 300 400 500 600 700 800
7alpha-HSDH
his-tag
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]