Difference between revisions of "Team:IISc-Bangalore/Assembly"

 
(10 intermediate revisions by 2 users not shown)
Line 11: Line 11:
  
 
<div id="contentMain">
 
<div id="contentMain">
 +
 +
<img src="https://static.igem.org/mediawiki/2017/9/96/T--IISc-Bangalore--Header--assemb.svg" id="headerImg" />
  
 
<h1 id="biobrick-transformations">BioBrick Transformations</h1>
 
<h1 id="biobrick-transformations">BioBrick Transformations</h1>
Line 20: Line 22:
 
<figure>
 
<figure>
 
<IMG SRC="https://static.igem.org/mediawiki/2017/3/38/T--IISc-Bangalore--t7-plates.png" width="70%">
 
<IMG SRC="https://static.igem.org/mediawiki/2017/3/38/T--IISc-Bangalore--t7-plates.png" width="70%">
 +
<br>
 
<figurecaption>
 
<figurecaption>
BBa_K525998 and BBa_K731721
+
<b>Figure 1</b>: BBa_K525998 and BBa_K731721
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 29: Line 32:
 
<figure>
 
<figure>
 
<IMG SRC="https://static.igem.org/mediawiki/2017/2/21/T--IISc-Bangalore--sfGFP-SpyCatcher-plates.png" width="70%">
 
<IMG SRC="https://static.igem.org/mediawiki/2017/2/21/T--IISc-Bangalore--sfGFP-SpyCatcher-plates.png" width="70%">
 +
<br>
 
<figurecaption>
 
<figurecaption>
BBa_K1650037 and BBa_K1321337
+
<b>Figure 2</b>: BBa_K1650037 and BBa_K1321337
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 38: Line 42:
 
<figure>
 
<figure>
 
<IMG SRC="https://static.igem.org/mediawiki/2017/9/9d/T--IISc-Bangalore--BBa_J18932.png" width="35%">
 
<IMG SRC="https://static.igem.org/mediawiki/2017/9/9d/T--IISc-Bangalore--BBa_J18932.png" width="35%">
 +
<br>
 
<figurecaption>
 
<figurecaption>
BBa_J18932
+
<b>Figure 3 </b>: BBa_J18932
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 45: Line 50:
 
<h1 id="plasmid-isolation">Plasmid Isolation</h1>
 
<h1 id="plasmid-isolation">Plasmid Isolation</h1>
  
<p>Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.</p>
+
<p>Minipreps were performed using three colonies on each transformation plate to confirm the presence of the plasmid. One positive transformant for each BioBrick was used to make a glycerol stock.</p>
 
+
<h2>INSERT GEL IMAGES</h2>
+
  
 
<h1 id="pcrs">PCRs</h1>
 
<h1 id="pcrs">PCRs</h1>
Line 83: Line 86:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/7/72/T--IISc-Bangalore--PCR1.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/7/72/T--IISc-Bangalore--PCR1.png" width="100%">
 +
<figurecaption> PCR1 product</figurecaption>
 
</figure>
 
</figure>
  
Line 114: Line 118:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR2.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR2.png" width="100%">
 +
<figurecaption>PCR2 product</figurecaption>
 
</figure>
 
</figure>
  
Line 147: Line 152:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/c/cf/T--IISc-Bangalore--PCR3.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/c/cf/T--IISc-Bangalore--PCR3.png" width="100%">
 +
<figurecaption>PCR3 product</figurecaption>
 
</figure>
 
</figure>
  
Line 178: Line 184:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/5/52/T--IISc-Bangalore--PCR4.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/5/52/T--IISc-Bangalore--PCR4.png" width="100%">
 +
<figurecaption>PCR4 product</figurecaption>
 
</figure>
 
</figure>
  
Line 211: Line 218:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR5.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR5.png" width="100%">
 +
<figurecaption>PCR5 product</figurecaption>
 
</figure>
 
</figure>
  
Line 242: Line 250:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/6/6e/T--IISc-Bangalore--PCR6.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/6/6e/T--IISc-Bangalore--PCR6.png" width="100%">
 +
<figurecaption>PCR6 product</figurecaption>
 
</figure>
 
</figure>
  
Line 273: Line 282:
  
 
</table>
 
</table>
 +
 +
<figure>
 +
<img src="https://static.igem.org/mediawiki/2017/f/fb/T--IISc-Bangalore--assembly-PCR7.png" width="100%">
 +
<figurecaption>
 +
PCR7 product
 +
</figurecaption>
 +
</figure>
  
 
<h1 id="restriction-digests">Restriction Digests</h1>
 
<h1 id="restriction-digests">Restriction Digests</h1>
Line 341: Line 357:
 
</figure>
 
</figure>
  
 
+
<h2>Gel-purification of our digested products</h2>
 
+
<figure>
 +
<img src="https://static.igem.org/mediawiki/2017/c/c9/T--IISc-Bangalore--gel-purification.png" width="100%">
 +
<br>
 +
<figurecaption>
 +
<b>Figure 4</b>: Digested PCR products (D1, D2, D3, D4, D6, DO1, DO2)
 +
</figurecaption>
 +
</figure>
  
 
<table width="100%">
 
<table width="100%">
Line 503: Line 525:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/b/b5/T--IISc-Bangalore--C1234.png" width="80%">
 
<img src="https://static.igem.org/mediawiki/2017/b/b5/T--IISc-Bangalore--C1234.png" width="80%">
 +
<br>
 
<figurecaption>
 
<figurecaption>
PLACEHOLDER
+
Plasmid map of BBa_K2319000 (sfGFP-SpyCatcher)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 513: Line 536:
 
<img src="https://static.igem.org/mediawiki/2017/a/a4/T--IISc-Bangalore--assembly-C126-linear.png" width="80%">
 
<img src="https://static.igem.org/mediawiki/2017/a/a4/T--IISc-Bangalore--assembly-C126-linear.png" width="80%">
 
<figurecaption>
 
<figurecaption>
PLACEHOLDER
+
Plasmid map of BBa_K2319009 (6xHis-mCherry)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
 
<h2>INSERT PLATE PICTURES</h2>
 
  
 
<h1 id="screening">Screening Transformants</h1>
 
<h1 id="screening">Screening Transformants</h1>
Line 524: Line 545:
 
<figure>
 
<figure>
 
<img src="https://static.igem.org/mediawiki/2017/1/19/T--IISc-Bangalore--colony-PCR.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/1/19/T--IISc-Bangalore--colony-PCR.png" width="100%">
 +
<br>
 
<figurecaption>
 
<figurecaption>
PLACEHOLDER caption
+
<b>Figure 6 </b>: Colony PCR of sfGFP-SpyCatcher colonies (B1-B21) and 6xHis-mCherry colonies (D1-D21)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
  
 +
<p>We obtained the expected band (~1.5 kb) for one of the thirty sfGFP-SpyCatcher colonies tested while none of the thirty 6xHis-mCherry colonies tested gave the expected band (> 1.1 kb). After plasmid isolation from this positive clone, we transformed BL21 (DE3) to continue with our protein experiments.</p>
 +
 +
<h2>Other parts</h2>
 +
<p>Due to the failure of our assemblies for the other BioBricks, we were not able to submit these parts on time, but we have submitted the designs for future teams to use.</p>
 
</div>
 
</div>
  
Line 535: Line 561:
 
   changeHash: true     
 
   changeHash: true     
 
});
 
});
 +
 +
var height = $('#headerImg').height();
 +
    window.onscroll = function() {myFunction()};
 +
 +
    function myFunction() {
 +
        if (document.body.scrollTop > height || document.documentElement.scrollTop > height) {
 +
            $("#inPageNav").fadeIn(200);
 +
        } else {
 +
            $("#inPageNav").fadeOut(200);
 +
        }
 +
    }
 
</script>
 
</script>
  
 
</html>
 
</html>

Latest revision as of 02:23, 2 November 2017

  1. Transformations
  2. Plasmid Isolation
  3. PCRs
  4. Restriction digests
  5. Ligations
  6. Screening

BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

Transformations for T7 expression system


Figure 1: BBa_K525998 and BBa_K731721

Transformations for sfGFP-SpyCatcher


Figure 2: BBa_K1650037 and BBa_K1321337

Transformations for mCherry


Figure 3 : BBa_J18932

Plasmid Isolation

Minipreps were performed using three colonies on each transformation plate to confirm the presence of the plasmid. One positive transformant for each BioBrick was used to make a glycerol stock.

PCRs

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template BBa_K525998 (T7 promoter+RBS)
Forward primer gactaccacggcatgatgaacctgaatcgc
Amplifies the CmR gene, includes NcoI site
Reverse primer gaattcAAGCTTtttctcctctttccctatagtgagtcg
Adds HindIII site downstream
Amplicon size 886 bp
PCR1 product
PCR 2 — T7 Expression Backbone (Piece 2)
Template BBa_K731721 (T7 terminator)
Forward primer gtatcacgaggcagaatttcag
Keeps the NheI site
Reverse primer gagaatatgtttttcgtctcagcc
Splits the CmR gene, includes NcoI site
Amplicon size 1533 bp
PCR2 product

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template BBa_K1321337 (sfGFP in Freiburg format)
Forward primer gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size 753 bp
PCR3 product
PCR 4 — SpyCatcher
Template BBa_K1650037 (SpyCatcher)
Forward primer GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
Adds BamHI and Gly-Ser-Ser upstream
Reverse primer gacgtcGCTAGCTTAaatatgagcatcgcccttgg
Adds stop codon (TAA) and NheI site downstream
Amplicon size 450 bp
PCR4 product

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
Adds stop codon (TAA) and NheI site downstream
Amplicon size 735 bp
PCR5 product
PCR 6 — mCherry
Template Product of PCR5
Forward primer aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
Adds HindIII, a start codon (ATG) and His upstream
Reverse primer cgtatgGCTAGCTTATTTATACAG
Keeps stop codon (TAA) and NheI site downstream
Amplicon size 753 bp
PCR6 product

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer accgatGGATCCtttatacagttcatccatgccg
Adds BamHI site downstream
Amplicon size 732 bp
PCR7 product

Restriction Digests

Restriction digests for T7 expression backbone

Double-digest PCR1 product with NcoI and HindIII (D1)
Double-digest PCR2 product with NheI and NcoI (D2)

Restriction digests for sfGFP-SpyCatcher

Double-digest PCR3 product with HindIII and BamHI (D3)
Double-digest PCR4 product with BamHI and NheI (D4)

Restriction digest for 6xHis-mCherry

Double-digest PCR6 product with HindIII and NheI (D6)

Restriction digests for mCherry-SpyTag

Double-digest Oligo 1 with HindIII and NdeI (DO1)
Double-digest PCR7 product with NdeI and BamHI (D7)
Double-digest Oligo 2 with BamHI and NheI (DO2)

Gel-purification of our digested products


Figure 4: Digested PCR products (D1, D2, D3, D4, D6, DO1, DO2)
Restriction enzymes used in our assembly
Restriction Enzyme Sequence Activity in NEBuffers (%) Incubation temperature Heat inactivation
1.1 2.1 3.1 CutSmart
AgeI A\CCGGT 100 75 25 75 37°C 65°C
AgeI-HF A\CCGGT 100 50 10 100 37°C 65°C
BamHI G\GATCC 75* 100* 100 100* 37°C
BamHI-HF G\GATCC 100 50 10 100 37°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
NcoI C\CATGG 100 100 100 100 37°C 80°C
NcoI-HF C\CATGG 50 100 10 100 37°C 80°C
NdeI CA\TATG 75 100 100 100 37°C 65°C
NheI G\CTAGC 100 100 10 100 37°C 65°C
NheI-HF G\CTAGC 100 25 10 100 37°C 80°C
* denotes star activity

Multi-Ligation

Ligating sfGFP-SpyCatcher


Plasmid map of BBa_K2319000 (sfGFP-SpyCatcher)

Ligating 6xHis-mCherry

Plasmid map of BBa_K2319009 (6xHis-mCherry)

Screening Transformants

We screened 30 transformants from each plate using colony PCR with primers VF2 and VR, which we standardized using Taq polymerase (annealing temperature of 56°C).


Figure 6 : Colony PCR of sfGFP-SpyCatcher colonies (B1-B21) and 6xHis-mCherry colonies (D1-D21)

We obtained the expected band (~1.5 kb) for one of the thirty sfGFP-SpyCatcher colonies tested while none of the thirty 6xHis-mCherry colonies tested gave the expected band (> 1.1 kb). After plasmid isolation from this positive clone, we transformed BL21 (DE3) to continue with our protein experiments.

Other parts

Due to the failure of our assemblies for the other BioBricks, we were not able to submit these parts on time, but we have submitted the designs for future teams to use.