Difference between revisions of "Team:UCopenhagen/Number-Control"

 
(10 intermediate revisions by 2 users not shown)
Line 6: Line 6:
  
 
<!-- Header -->
 
<!-- Header -->
     <a name="project-page"></a>
+
     <a name="project"></a>
 
     <div class="intro-header4">
 
     <div class="intro-header4">
 
         <div class="container">
 
         <div class="container">
Line 14: Line 14:
 
                     <div class="intro-message2">
 
                     <div class="intro-message2">
 
<h3></h3>
 
<h3></h3>
<h3></h3>
+
                         <h1>N U M B E R &ensp;  C O N T R O L</h1>
<h3></h3>
+
<h3></h3>
+
<h3></h3>
+
                         <h1>N U M B E R             C O N T R O L</h1>
+
                        <h3></h3>
+
           
+
 
                     </div>
 
                     </div>
 
                 </div>
 
                 </div>
Line 27: Line 21:
 
         </div>
 
         </div>
 
         <!-- /.container -->
 
         <!-- /.container -->
 
    </div>
 
    <!-- /.intro-header -->
 
  
  
 
<div class="content-section-a">
 
<div class="content-section-a">
 
<div class="container">
 
<div class="container">
             <div class="row">
+
             <div>
                <div class="col-lg-5 col-sm-6">
+
 
                     <hr class="section-heading-spacer">
 
                     <hr class="section-heading-spacer">
 
                     <div class="clearfix"></div>
 
                     <div class="clearfix"></div>
 
                     <h2 class="section-heading">Introduction </h2>
 
                     <h2 class="section-heading">Introduction </h2>
                     <p class="lead">Our team believes that establishing a stable platform for scientists to create naïve orthogonal living compartments, would allow for an unpredictable advancement in the field of synthetic biology. Our project will not attempt to create an endosymbiont, but instead investigate the mechanisms in free-living cells in a bottom-up approach to endosymbiosis. 
+
                     <p class="lead">
The endosymbiotic theory, formulated in the early years of the previous century, outlines that the organelles of the eukaryotic cell, such as the mitochondria, have their origin in free-living prokaryotes engulfed by bigger cells. These incorporated cells then co-evolved with their host conferring to it novel emergent properties which ultimately helped fuel the development of more complex multicellular biological systems such as plants and animals (Archibald, 2015). </p>
+
  
<br>
+
The second mechanism we considered is <i>number control</i>. This is the intertwinement of the symbiont and host replication cycles. We believe this to be an imperative function of a healthy relationship between host and symbiont. In fact, the host cell is limited in size and it will be able to contain only a defined number of cells. Moreover, the exchange of nutrients also require a tightly regulated balance. For example, the mechanism of <i>interdependency</i> is based upon the providing of enough tryptophan to the host cell. This would not only depend on the production of amino acid per cell but also on the number of symbionts. Similarly, the symbionts won’t be able to directly access any resource not
 +
provided by the host cell. Hence, as in the financial market, a correct balance of consumer and producer must be kept to avoid our symbiotic relationship turning into a parasitic relationship. Number control can be seen as the <i>New Deal</i> of endosymbiosis.</p> <br>
  
<p>We have identified three mechanisms we believe to be mandatory for the development of a stable endosymbiotic relationship, which we will be trying to replicate in free-living cells. First of all, in order for the relationship to be stable, the two organisms must  be mutually dependent on each other; there must be a mutually beneficial interaction between host and symbiont. Secondly, there has to be some sort of control and synchronization of symbiont replication. If the symbiont were to be replicating freely we could end up with way too many or not enough symbionts in the host. Finally, a common feature of the endosymbiotic organelles we have looked at, is the transfer of genes from the symbiont to the host. Because of this transfer, the gene and protein expression is taking place in the nucleus and the proteins and metabolites are transported to the organelle. This import of proteins is interesting not just for understanding endosymbiosis, but also for the potential applications in synthetic biology.</p>
+
<p class="lead">Our vision is to use a modular system based on <b>C</b>lustered <b>R</b>egularly <b>I</b>nverted <b>S</b>hort <b>P</b>alindromic <b>R</b>epeats interference (CRISPRi) technology to efficiently connect the symbiont cell replication cycle to the status of the endosymbiosis relationship. As a first step towards an automated number control system, we will investigate the control of cell replication through DNA replication inhibition and model the incorporation of a cell density based system - that is, a quorum sensing circuit - regulating the replication control mechanism.</p>
  
<br>
 
  
<p>Based on these considerations, we decided to work on three distinct, but intertwined, projects pertaining to endosymbiosis, namely Interdependence, Number Control, and Protein import. We believe that by combining these three projects, a key step towards the understanding of endosymbiosis and its employment in synthetic biology will be obtained. </p>
+
</p>  
                </div>
+
             
                <div class="col-lg-5 col-lg-offset-2 col-sm-6">
+
    </div>
                    <img class="img-responsive" src="img/national-logo.jpg" alt="">
+
</div>
                </div>
+
</div>
            </div>
+
 
 +
<div class="content-section-b">
 +
<div class="container">
 +
            <div>
 +
                    <div class="clearfix"></div>
 +
                    <h2 class="section-heading">Final Design </h2>
 +
                                        <p class="lead">
 +
<b>Background:</b> Prior to cell replication a bacteria need to double all cell components, including the genomic DNA. The DNA replication begins with the opening of the double strand DNA (dsDNA) carried out by the protein <i>helicase</i>. Preventing the attachment of helicase to the dsDNA will prevent double strand separation, genome replication, and ultimately, cell division.</p><br>
 +
<p class="lead">To disrupt the helicase-DNA interaction, we designed a genetic regulation tool based on CRISPR interference (CRISPRi). This technology was first developed by Qi <i>et al</i> (2013) and is constituted by two basic blocks, i.e. a guide RNA (sgRNA) complementary to a target sequence and a catalytically dead Cas9 endonuclease (dCas9). dCas9 differentiate from Cas9 by its lack of nuclease activity. Hence, dCas9 will bind to the sgRNA and sit on the target DNA sequence, without altering permanently its structure. The presence of dCas9 on the target site sterically blocks the binding of other proteins, such as helicase.</p><br>
 +
 
 +
<p class="lead"><b>Our goal</b> is to inhibit attachment of helicase to the origin of replication (ORI), using CRISPRi system targeting the ORI, thus disrupting the cell replication of <i>E.coli</i>.</p><br>
 +
 
 +
<p class="lead"><b>Circuits and biobricks:</b> Our CRISPRi system is composed by a catalytically dead Cas9 (dCas9) and three guide RNAs (sgRNAs) complementary to three distinct sites of <i>E.coli</i> origin of replication (OriC), i.e. on the DnaA helicase binding box (sgRNA1), before the DnaA binding box (sgRNA2) and after it (sgRNA3)(Wiktor et al., 2016). dCas9 is expressed from an anhydrotetracycline (aTc) inducible promoter and the sgRNAs are expressed separately from a minimal constitutive promoter (J23119). The choice of expressing the sgRNA constitutively arise from the higher efficiency of dCas9 to assemble with the sgRNA if the latter is already present in the cytosol (ref). The assembled protein-sgRNA will then bind to the complementary region on the bacterial chromosome and occupy that area. Detachment of dCas9-sgRNA complex from the target sequence can be achieved by incubating the cells at 42 °C (Wiktor et al., 2016) </p><br>
 +
 
 +
<p class="lead">The <b>quorum sensing (QS) model</b> is based on the Rhl genetic circuit found in <i>Pseudomona aeruginosa</i>.</p>
  
 +
</p> 
 
         </div>
 
         </div>
        <!-- /.container -->
 
  
 
     </div>
 
     </div>
 +
    <!-- /.container -->
 
</div>
 
</div>
       
+
 
    <div class="content-section-b">
+
<div class="content-section-a">
        <div class="container">
+
<div class="container">
             <div class="row">
+
             <div>
                <div class="col-lg-5 col-lg-offset-1 col-sm-push-6  col-sm-6">
+
 
                     <hr class="section-heading-spacer">
 
                     <hr class="section-heading-spacer">
 
                     <div class="clearfix"></div>
 
                     <div class="clearfix"></div>
                     <h2 class="section-heading">Applications and Implications</h2>
+
                     <h2 class="section-heading">Experiments</h2>
                     <<p>By understanding the basic principles behind the creation of stable endosymbiotic events we hope that in the future it will be possible to use artificial endosymbiosis as a new technology in synthetic biology, and we believe that value can be created in the foundational track of the iGEM competition. History has shown that great scientific advances has followed the implementation of new revolutionary technologies (Gershon 2003). </p>
+
                     <p class="lead">
 +
<h4>Overview</h4>
 +
<ul style="text-align:left; color:white;">
 +
<li>General procedure</li>
 +
<li>Creation of working <i>E. coli</i> DH5-α strains:</li>
 +
<li>OD600 growth curve</li>
 +
</ul>
 +
</p>
 +
<p class="lead">
 +
<h4>General procedure</h4>
 +
<p class="lead">To obtain large quantities of our plasmids 3xFLAG-pdCas9 and pgRNA-bacteria we transformed them into <i>E. coli</i> mach1 using Mix&Go (Zymo Research). To verify each transformation we purified the plasmid with column purification, linearized with proper restriction enzyme (RE) digestion to avoid supercoiling, and ran the linearized product in 1% agarose gel electrophoresis. <br><br>
 +
Moreover, all the purified plasmids were sent for sequencing (Macrogen EZ-seq commercial service).</p></p>
 +
<p class="lead">
 +
<h4>Creation of working <i>E. coli</i> DH5-α strains</h4>
 +
<p class="lead">
 +
The following commercially available plasmids from AddGene were selected for our experiment:
 +
<ul style="text-align:left; color:white;">
 +
<li>3xFLAG-dCas9/p-bacteria (Addgene #64325)</li>
 +
<li>pgRNA-bacteria (Addgene #44251)</li></ul></p>
 
<br>
 
<br>
<p>We envision that artificial endosymbiosis could be applied in a broad range of fields, including agriculture, medicine and production of valuable compounds. A deeper understanding of the relationships intertwining endosymbionts and their hosts could unravel new knowledge applicable for the treatment of mitochondrial diseases, while a living compartment able to fixate nitrogen from the air could decrease the fertilizer use in agricultural production. </p>
+
 
 +
<figure>
 
<br>
 
<br>
<p>However, the applications are only limited by the imagination of future users. Indeed, the game-changing role of endosymbiosis has not gone unseen to the eyes of the modern bioengineers, who predict that the establishment of a novel interaction has the potential to radically alter the host cell physiology without directly affecting the host genome (Scientific America Vol 105 pp. 36-45).</p>
+
                    <img class="img-responsive" src="https://static.igem.org/mediawiki/2017/7/76/Noctrl_dCas9_plasmid.png" alt="" width="250" height="200">
 
<br>
 
<br>
<p>Before the potential application of artificial endosymbiosis, there are many things to consider. While the current regulations regarding GMO limits what is possible to apply in agriculture and medicine, regulations regarding synthetically modified organisms (SMOs) have not yet been systematically put into place. How will a new field of SMO be regulated, and how will it influence possible applications of artificial endosymbiosis?</p>
+
<figcaption><b>Figure 1 </b>Plasmid: 3xFLAG-dCas9/p-bacteria (Addgene #64325)
 +
</figcaption>
 +
</figure>
 +
 
 +
<figure>
 
<br>
 
<br>
<p>In addition to our scientific investigation we are enthused to trigger debate about synthetic biology. We intend to podcast intriguing conversations with experts, thereby hoping to reach the general public and impel the discussion about the ethics and future prospects in combining biology and engineering.</p>
+
                    <img class="img-responsive" src="https://static.igem.org/mediawiki/2017/5/5e/Noctrl_pgRNA_plasmid.png" alt="" width="250" height="200">
                     
+
<br>
                    </div>
+
<figcaption><b>Figure 2 </b>Plasmid: pgRNA-bacteria (Addgene #44251) which was used for insertion of seed sequence
                    <div class="col-lg-6 col-sm-pull-6  col-sm-6">
+
</figcaption>
                   
+
</figure>
                        <img class="img-responsive2" src="img/Lacrosse2.jpg" alt="">
+
 
                     </div>
+
<br>
 +
<p class="lead">
 +
 
 +
The three seed sequences designed were inserted using PCR. Thus creating the new plasmids pgRNA1, pgRNA2, and pgRNA3.<br><br>
 +
We used the following primers for insertion of the seed sequences, where the underlined sequence is SpeI restriction site and the bold text is the seed sequence complementary to the E. coli DH5-α OriC.
 +
 
 +
<ul style="text-align:left; color:white;">
 +
<li>fw.sgRNA1 CCACTAGTGCACTGCCCTGTGGATAACAGTTTTAGAGCTAGAAATAGCAAG</li>
 +
<li>fw.sgRNA2 CCACTAGTTTGAGAAAGACCTGGGATCCGTTTTAGAGCTAGAAATAGCAAG</li>
 +
<li>fw.sgRNA3 CCACTAGTGATCATTAACTGTGAATGATGTTTTAGAGCTAGAAATAGCAAG</li>
 +
<li>rv.sgRNA GGACTAGTATTATACCTAGGACTGAG</li></ol></p>
 +
 
 +
<p class="lead">After purification of the modified pgRNA plasmids, transformation of <i>E. coli</i> DH5-α was carried out using heat-shock protocol. And the following strains were obtained:<ul style="text-align:left; color:white;">
 +
<li><i>E. coli</i> DH5-α pdCas9;</li>
 +
<li><i>E. coli</i> DH5-α pgRNA1;</li>
 +
<li><i>E. coli</i> DH5-α pgRNA2;</li>
 +
<li><i>E. coli</i> DH5-α pgRNA3;</li>
 +
<li><i>E. coli</i> DH5-α pdCas9 pgRNA1;</li>
 +
<li><i>E. coli</i> DH5-α pdCas9 pgRNA2;</li>
 +
<li><i>E. coli</i> DH5-α pdCas9 pgRNA3.</li></ul></p>
 +
 
 +
<h4>Growth curve (OD<sub>600</sub>)</h4>
 +
<p class="lead">The growth rate of the obtained strains was investigated in absence and presence of the dCas9 inductor tetracycline (tet) using absorbance measurements (protocol).<br><br>
 +
The strains <i>E. coli</i> DH5-α pdCas9, <i>E. coli</i> DH5-α pgRNA1, <i>E. coli</i> DH5-α pgRNA2, and <i>E. coli</i> DH5-α pgRNA3 cannot be considered proper negative control since they are cultivated with different antibiotics. Hence, three new negative control strain were designed and created:
 +
 
 +
<ul style="text-align:left; color:white;">
 +
<li><i>E. coli</i> DH5-α empty pdCas9 (EpdCas9). That is, the pdCas9 plasmid with truncated dCas9 CDS using EcoRI restriction);</li>
 +
<li><i>E. coli</i> DH5-α pdCas9 + pgRNA-bacteria (that is, the sgRNA scaffold without seed sequence);</li>
 +
<li><i>E. coli</i> DH5-α EpdCas9 pgRNA-bacteria (we did manage to obtain this strain).</li></ul>
 +
</p>
 +
<p class="lead">Moreover, considering that the stop of DNA replication is expected to cause cell enlargement (Wiktor <i>et al</i>., 2016) the OD600­ measurement results might altered by the cell size. To overcome this and other issues a new protocol was design.<br><br>
 +
However, the difference in growth observed was never significant. Hence, we decided to focus on the numerical model describing the <i>Number Control</i> project, where we also explored the integration of a quorum sensing circuit.</p>
 +
 
 +
</div>
 +
    </div>
 +
</div>
 +
       
 +
<div class="content-section-b">
 +
<div class="container">
 +
            <div>
 +
                     <div class="clearfix"></div>
 +
                    <h2 class="section-heading">Design process/future</h2>
 +
<p class="lead">After the design of the growth rate experiment, we started exploring other possible layers of complexity. Namely, Wiktor <i>et al</i>. (2016) has shown that upon successful genome replication arrest, the cell stays metabolically active, accumulating biomass. For this reason, we suggest the inhibition of lipid biosynthesis to limit cell membrane growth, hence cell enlargement. This could be obtained with a similar sgRNA-dCas9 circuit targeting the gene fabI, CDS for the native enoyl-acyl carrier protein (enoyl-ACP) reductase (ENR). This protein is in fact essential for the type II fatty acid biosynthesis and is commonly target of bacteriostatic drugs (Escaich, ‎2011).<br><br>
 +
Besides the autoinhibitory control of cell cycle, we are deeply interested in connecting the number control circuit to the host life cycle to further stabilize the relationship between host and symbiont. To do so, we propose to place the pgRNA-dCas9 system under control of three host-symbiont signals, i.e. symbiont abundance (that is, a quorum sensing sub system), host cell starvation, and host cell replication. Namely, a high symbiont abundance and/or a starvation status of the host cell would activate the dCas9 expression lowering or stopping symbiont replication. While the host cell initiation of replication would inactivate the dCas9 expression, so to allow an easy propagation of the symbiont.</p>
 +
 
 +
                  </div>
 
                 </div>
 
                 </div>
 
                 </div>
 
                 </div>
             </div>
+
 
 +
 
 +
<div class="content-section-a">
 +
<div class="container">
 +
             <div>
 +
                    <hr class="section-heading-spacer">
 +
                    <div class="clearfix"></div>
 +
                    <h2 class="section-heading">References</h2>
 +
                    <p class="lead">
 +
 
 +
</p>
 +
             
 +
</div>
 +
</div>
 
</div>
 
</div>
 
 
<a  name="socialmeida"></a>
 
    <div class="banner">
 
  
 +
<a  name="socialmedia"></a>
 
         <div class="container">
 
         <div class="container">
 
+
          <div class="row">
            <div class="row">
+
                 <div class="col-lg-5">
                 <div class="col-lg-6">
+
                     <h2>Find Incell here:</h2>
                     <h2>Find inCell here:</h2>
+
 
                 </div>
 
                 </div>
                 <div class="col-lg-6">
+
                 <div class="col-lg-7">
 +
<br>
 
                     <ul class="list-inline banner-social-buttons">
 
                     <ul class="list-inline banner-social-buttons">
 
                         <li>
 
                         <li>
Line 114: Line 196:
 
         </div>
 
         </div>
 
         <!-- /.container -->
 
         <!-- /.container -->
 +
    </div>
 +
    <!-- /.intro-header -->
  
 
     </div>
 
     </div>
                   
 
 
     <!-- /.banner -->
 
     <!-- /.banner -->
 
     <!-- Interactive bar -->
 
     <!-- Interactive bar -->
Line 127: Line 210:
 
                     <!-- Hidden li included to remove active class from about link when scrolled up past about section -->
 
                     <!-- Hidden li included to remove active class from about link when scrolled up past about section -->
 
                     <li>
 
                     <li>
                 <a class="page-scroll" href="#">Top</a>
+
                 <a class="page-scroll" href="#Top">Introduction</a>
</li>
+
                    </li>
 +
                    <li>
 +
                <a class="page-scroll" href="#Design">Final design</a>
 +
                    </li>
 +
                    <li>
 +
                <a class="page-scroll" href="#experiment">Experiments</a>
 +
                    </li>
 +
                    <li>
 +
                <a class="page-scroll" href="#process">Design Process</a>
 +
                    </li>
 +
 
 
                 </ul>
 
                 </ul>
 
             </div>
 
             </div>
Line 137: Line 230:
 
                     <!-- Hidden li included to remove active class from about link when scrolled up past about section -->
 
                     <!-- Hidden li included to remove active class from about link when scrolled up past about section -->
 
                     <li>
 
                     <li>
                         <a class="page-scroll" href="https://2017.igem.org/Team:UCopenhagen/Interdependency">Previous</a>
+
                         <a class="page-scroll" href="https://2017.igem.org/Team:UCopenhagen/Project">Previous</a>
 
                     </li>
 
                     </li>
 
                     <li>
 
                     <li>
                         <a class="page-scroll" href="https://2017.igem.org/Team:UCopenhagen/Protein-Import">Next</a>
+
                         <a class="page-scroll" href="https://2017.igem.org/Team:UCopenhagen/Number-Control">Next</a>
 
                     </li>
 
                     </li>
 
                 </ul>
 
                 </ul>

Latest revision as of 02:47, 2 November 2017

N U M B E R   C O N T R O L


Introduction

The second mechanism we considered is number control. This is the intertwinement of the symbiont and host replication cycles. We believe this to be an imperative function of a healthy relationship between host and symbiont. In fact, the host cell is limited in size and it will be able to contain only a defined number of cells. Moreover, the exchange of nutrients also require a tightly regulated balance. For example, the mechanism of interdependency is based upon the providing of enough tryptophan to the host cell. This would not only depend on the production of amino acid per cell but also on the number of symbionts. Similarly, the symbionts won’t be able to directly access any resource not provided by the host cell. Hence, as in the financial market, a correct balance of consumer and producer must be kept to avoid our symbiotic relationship turning into a parasitic relationship. Number control can be seen as the New Deal of endosymbiosis.


Our vision is to use a modular system based on Clustered Regularly Inverted Short Palindromic Repeats interference (CRISPRi) technology to efficiently connect the symbiont cell replication cycle to the status of the endosymbiosis relationship. As a first step towards an automated number control system, we will investigate the control of cell replication through DNA replication inhibition and model the incorporation of a cell density based system - that is, a quorum sensing circuit - regulating the replication control mechanism.

Final Design

Background: Prior to cell replication a bacteria need to double all cell components, including the genomic DNA. The DNA replication begins with the opening of the double strand DNA (dsDNA) carried out by the protein helicase. Preventing the attachment of helicase to the dsDNA will prevent double strand separation, genome replication, and ultimately, cell division.


To disrupt the helicase-DNA interaction, we designed a genetic regulation tool based on CRISPR interference (CRISPRi). This technology was first developed by Qi et al (2013) and is constituted by two basic blocks, i.e. a guide RNA (sgRNA) complementary to a target sequence and a catalytically dead Cas9 endonuclease (dCas9). dCas9 differentiate from Cas9 by its lack of nuclease activity. Hence, dCas9 will bind to the sgRNA and sit on the target DNA sequence, without altering permanently its structure. The presence of dCas9 on the target site sterically blocks the binding of other proteins, such as helicase.


Our goal is to inhibit attachment of helicase to the origin of replication (ORI), using CRISPRi system targeting the ORI, thus disrupting the cell replication of E.coli.


Circuits and biobricks: Our CRISPRi system is composed by a catalytically dead Cas9 (dCas9) and three guide RNAs (sgRNAs) complementary to three distinct sites of E.coli origin of replication (OriC), i.e. on the DnaA helicase binding box (sgRNA1), before the DnaA binding box (sgRNA2) and after it (sgRNA3)(Wiktor et al., 2016). dCas9 is expressed from an anhydrotetracycline (aTc) inducible promoter and the sgRNAs are expressed separately from a minimal constitutive promoter (J23119). The choice of expressing the sgRNA constitutively arise from the higher efficiency of dCas9 to assemble with the sgRNA if the latter is already present in the cytosol (ref). The assembled protein-sgRNA will then bind to the complementary region on the bacterial chromosome and occupy that area. Detachment of dCas9-sgRNA complex from the target sequence can be achieved by incubating the cells at 42 °C (Wiktor et al., 2016)


The quorum sensing (QS) model is based on the Rhl genetic circuit found in Pseudomona aeruginosa.


Experiments

Overview

  • General procedure
  • Creation of working E. coli DH5-α strains:
  • OD600 growth curve

General procedure

To obtain large quantities of our plasmids 3xFLAG-pdCas9 and pgRNA-bacteria we transformed them into E. coli mach1 using Mix&Go (Zymo Research). To verify each transformation we purified the plasmid with column purification, linearized with proper restriction enzyme (RE) digestion to avoid supercoiling, and ran the linearized product in 1% agarose gel electrophoresis.

Moreover, all the purified plasmids were sent for sequencing (Macrogen EZ-seq commercial service).

Creation of working E. coli DH5-α strains

The following commercially available plasmids from AddGene were selected for our experiment:

  • 3xFLAG-dCas9/p-bacteria (Addgene #64325)
  • pgRNA-bacteria (Addgene #44251)




Figure 1 Plasmid: 3xFLAG-dCas9/p-bacteria (Addgene #64325)


Figure 2 Plasmid: pgRNA-bacteria (Addgene #44251) which was used for insertion of seed sequence

The three seed sequences designed were inserted using PCR. Thus creating the new plasmids pgRNA1, pgRNA2, and pgRNA3.

We used the following primers for insertion of the seed sequences, where the underlined sequence is SpeI restriction site and the bold text is the seed sequence complementary to the E. coli DH5-α OriC.

  • fw.sgRNA1 CCACTAGTGCACTGCCCTGTGGATAACAGTTTTAGAGCTAGAAATAGCAAG
  • fw.sgRNA2 CCACTAGTTTGAGAAAGACCTGGGATCCGTTTTAGAGCTAGAAATAGCAAG
  • fw.sgRNA3 CCACTAGTGATCATTAACTGTGAATGATGTTTTAGAGCTAGAAATAGCAAG
  • rv.sgRNA GGACTAGTATTATACCTAGGACTGAG
  • After purification of the modified pgRNA plasmids, transformation of E. coli DH5-α was carried out using heat-shock protocol. And the following strains were obtained:

    • E. coli DH5-α pdCas9;
    • E. coli DH5-α pgRNA1;
    • E. coli DH5-α pgRNA2;
    • E. coli DH5-α pgRNA3;
    • E. coli DH5-α pdCas9 pgRNA1;
    • E. coli DH5-α pdCas9 pgRNA2;
    • E. coli DH5-α pdCas9 pgRNA3.

    Growth curve (OD600)

    The growth rate of the obtained strains was investigated in absence and presence of the dCas9 inductor tetracycline (tet) using absorbance measurements (protocol).

    The strains E. coli DH5-α pdCas9, E. coli DH5-α pgRNA1, E. coli DH5-α pgRNA2, and E. coli DH5-α pgRNA3 cannot be considered proper negative control since they are cultivated with different antibiotics. Hence, three new negative control strain were designed and created:

    • E. coli DH5-α empty pdCas9 (EpdCas9). That is, the pdCas9 plasmid with truncated dCas9 CDS using EcoRI restriction);
    • E. coli DH5-α pdCas9 + pgRNA-bacteria (that is, the sgRNA scaffold without seed sequence);
    • E. coli DH5-α EpdCas9 pgRNA-bacteria (we did manage to obtain this strain).

    Moreover, considering that the stop of DNA replication is expected to cause cell enlargement (Wiktor et al., 2016) the OD600­ measurement results might altered by the cell size. To overcome this and other issues a new protocol was design.

    However, the difference in growth observed was never significant. Hence, we decided to focus on the numerical model describing the Number Control project, where we also explored the integration of a quorum sensing circuit.

Design process/future

After the design of the growth rate experiment, we started exploring other possible layers of complexity. Namely, Wiktor et al. (2016) has shown that upon successful genome replication arrest, the cell stays metabolically active, accumulating biomass. For this reason, we suggest the inhibition of lipid biosynthesis to limit cell membrane growth, hence cell enlargement. This could be obtained with a similar sgRNA-dCas9 circuit targeting the gene fabI, CDS for the native enoyl-acyl carrier protein (enoyl-ACP) reductase (ENR). This protein is in fact essential for the type II fatty acid biosynthesis and is commonly target of bacteriostatic drugs (Escaich, ‎2011).

Besides the autoinhibitory control of cell cycle, we are deeply interested in connecting the number control circuit to the host life cycle to further stabilize the relationship between host and symbiont. To do so, we propose to place the pgRNA-dCas9 system under control of three host-symbiont signals, i.e. symbiont abundance (that is, a quorum sensing sub system), host cell starvation, and host cell replication. Namely, a high symbiont abundance and/or a starvation status of the host cell would activate the dCas9 expression lowering or stopping symbiont replication. While the host cell initiation of replication would inactivate the dCas9 expression, so to allow an easy propagation of the symbiont.


References

Find Incell here: