Difference between revisions of "Team:UCopenhagen/Parts"

Line 28: Line 28:
 
                     <h2 class="section-heading">Guide RNA (gRNA) </h2>
 
                     <h2 class="section-heading">Guide RNA (gRNA) </h2>
 
                     <p class="lead">
 
                     <p class="lead">
<ul style="text-align:left; color:white;">
+
All our submitted Biobricks are listed on this page. Special attention should be directed to our two favorite parts: 
<li>1. gRNA 1  GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)</li>
+
<li>
<li>2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)</li>
+
                <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455002">BBa_K2455002</a>, an improved version of the super yellow fluorescent protein <a href="http://parts.igem.org/Part:BBa_K864100">BBa_K864100</a> that we believe fulfills the gold medal criteria to improve a previous part or project.  
<li>3. gRNA 3·    GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016) </li>
+
</li>
</ul>
+
<li>
 +
                <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455003">BBa_K2455003</a>, Cell-Penetrating USER Cassette, which is completely novel in iGEM. We believe can this brick benefit many iGEM teams in the years to come, as we have made it easy to insert any protein of interest in the USER casette.
 +
</li>
 
</p>    </p>
 
</p>    </p>
  

Revision as of 03:19, 2 November 2017

P A R T S

Guide RNA (gRNA)

All our submitted Biobricks are listed on this page. Special attention should be directed to our two favorite parts:

  • BBa_K2455002, an improved version of the super yellow fluorescent protein BBa_K864100 that we believe fulfills the gold medal criteria to improve a previous part or project.
  • BBa_K2455003, Cell-Penetrating USER Cassette, which is completely novel in iGEM. We believe can this brick benefit many iGEM teams in the years to come, as we have made it easy to insert any protein of interest in the USER casette.
  • Name Type Type Designer Length
    BBa_K2455000 Basic Part His-tagged AroG gene from E. coli MG1655 1092
    BBa_K2455001 Basic Part His-tagged TrpE gene from E. coli MG1655 1602
    BBa_K2455002 Basic Part (Improvement of old) R9-SYFP2-6His 804
    BBa_K2455003 Basic Part Nona-Arginine with his-tag 81
    BBa_K2455004 Basic Part YddG E. coli Tyr, Trp, Phe exporter 885
    BBa_K2455005 Basic Part (Improvement of old - Illegal) R9-mTag BFP-6His 786
    BBa_K2455007 Basic Part (Composite) YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001) 2513
    BBa_K2455008 Basic Part (Composite) YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) 2005

    Find Incell here: