Difference between revisions of "Team:UCopenhagen/Parts"

 
(3 intermediate revisions by the same user not shown)
Line 26: Line 26:
 
             <div>
 
             <div>
 
                     <div class="clearfix"></div>
 
                     <div class="clearfix"></div>
                     <h2 class="section-heading">Guide RNA (gRNA) </h2>
+
                     <h2 class="section-heading">Overview of our Biobricks </h2>
 
                     <p class="lead">
 
                     <p class="lead">
<ul style="text-align:left; color:white;">
+
All our submitted Biobricks are listed on this page. Special attention should be directed to our two favorite parts: 
<li>1. gRNA 1  GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)</li>
+
<li>
<li>2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)</li>
+
                <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455003">BBa_K2455003</a>, a Cell-Penetrating USER Cassette, which is completely novel in iGEM. We believe this brick can benefit many iGEM teams in the years to come, as we have made it easy to insert any protein of interest in the USER casette. We have already used it ourselves, to create our second favorite part.
<li>3. gRNA 3·    GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016) </li>
+
</li>
</ul>
+
<li>
 +
                <a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455002">BBa_K2455002</a>, an improved version of the super yellow fluorescent protein <a href="http://parts.igem.org/Part:BBa_K864100">BBa_K864100</a> that we believe fulfills the gold medal criteria to improve a previous part or project.
 +
</li>
 +
 
 
</p>    </p>
 
</p>    </p>
  
Line 53: Line 56:
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Description">His-tagged AroG gene from E. coli MG1655</td>
 
         <td data-title="Description">His-tagged AroG gene from E. coli MG1655</td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">1092</td>
 
         <td data-title="Length" data-type="currency">1092</td>
 
       </tr>
 
       </tr>
Line 60: Line 63:
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Description">His-tagged TrpE gene from E. coli MG1655</td>
 
         <td data-title="Description">His-tagged TrpE gene from E. coli MG1655</td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">1602</td>
 
         <td data-title="Length" data-type="currency">1602</td>
 
       </tr>
 
       </tr>
Line 67: Line 70:
 
         <td data-title="Type">Basic Part (Improvement of old)</td>
 
         <td data-title="Type">Basic Part (Improvement of old)</td>
 
         <td data-title="Description">R9-SYFP2-6His</td>
 
         <td data-title="Description">R9-SYFP2-6His</td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">804</td>
 
         <td data-title="Length" data-type="currency">804</td>
 
       </tr>
 
       </tr>
Line 74: Line 77:
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Description">Nona-Arginine with his-tag</td>
 
         <td data-title="Description">Nona-Arginine with his-tag</td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">81</td>
 
         <td data-title="Length" data-type="currency">81</td>
 
       </tr>
 
       </tr>
Line 81: Line 84:
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Description">YddG E. coli Tyr, Trp, Phe exporter </td>
 
         <td data-title="Description">YddG E. coli Tyr, Trp, Phe exporter </td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">885</td>
 
         <td data-title="Length" data-type="currency">885</td>
 
       </tr>
 
       </tr>
Line 88: Line 91:
 
         <td data-title="Type">Basic Part (Improvement of old - Illegal)</td>
 
         <td data-title="Type">Basic Part (Improvement of old - Illegal)</td>
 
         <td data-title="Description">R9-mTag BFP-6His </td>
 
         <td data-title="Description">R9-mTag BFP-6His </td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">786</td>
 
         <td data-title="Length" data-type="currency">786</td>
 
       </tr>
 
       </tr>
Line 95: Line 98:
 
         <td data-title="Type">Basic Part (Composite)</td>
 
         <td data-title="Type">Basic Part (Composite)</td>
 
         <td data-title="Description">YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001)</td>
 
         <td data-title="Description">YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001)</td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">2513</td>
 
         <td data-title="Length" data-type="currency">2513</td>
 
       </tr>
 
       </tr>
Line 102: Line 105:
 
         <td data-title="Type">Basic Part (Composite)</td>
 
         <td data-title="Type">Basic Part (Composite)</td>
 
         <td data-title="Description">YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) </td>
 
         <td data-title="Description">YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) </td>
         <td data-title="Designer" data-type="currency"></td>
+
         <td data-title="Designer" data-type="currency">Jon Fugl</td>
 
         <td data-title="Length" data-type="currency">2005</td>
 
         <td data-title="Length" data-type="currency">2005</td>
 
       </tr>
 
       </tr>

Latest revision as of 03:25, 2 November 2017

P A R T S

Overview of our Biobricks

All our submitted Biobricks are listed on this page. Special attention should be directed to our two favorite parts:

  • BBa_K2455003, a Cell-Penetrating USER Cassette, which is completely novel in iGEM. We believe this brick can benefit many iGEM teams in the years to come, as we have made it easy to insert any protein of interest in the USER casette. We have already used it ourselves, to create our second favorite part.
  • BBa_K2455002, an improved version of the super yellow fluorescent protein BBa_K864100 that we believe fulfills the gold medal criteria to improve a previous part or project.
  • Name Type Type Designer Length
    BBa_K2455000 Basic Part His-tagged AroG gene from E. coli MG1655 Jon Fugl 1092
    BBa_K2455001 Basic Part His-tagged TrpE gene from E. coli MG1655 Jon Fugl 1602
    BBa_K2455002 Basic Part (Improvement of old) R9-SYFP2-6His Jon Fugl 804
    BBa_K2455003 Basic Part Nona-Arginine with his-tag Jon Fugl 81
    BBa_K2455004 Basic Part YddG E. coli Tyr, Trp, Phe exporter Jon Fugl 885
    BBa_K2455005 Basic Part (Improvement of old - Illegal) R9-mTag BFP-6His Jon Fugl 786
    BBa_K2455007 Basic Part (Composite) YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001) Jon Fugl 2513
    BBa_K2455008 Basic Part (Composite) YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) Jon Fugl 2005

    Find Incell here: