Difference between revisions of "Team:UCopenhagen/Parts"

Line 37: Line 37:
 
<div class="container">
 
<div class="container">
 
   <table class="responsive-table">
 
   <table class="responsive-table">
    <caption><b>Table 1</b> Starting OD.</caption>
 
 
     <thead>
 
     <thead>
 
       <tr>
 
       <tr>
 
<th scope="col"></th>
 
<th scope="col"></th>
         <th scope="col">Abs<sub>600</sub></th>
+
         <th scope="col">Name</th>
         <th scope="col">OD<sub>600</sub> before</th>
+
        <th scope="col">Type</th>
         <th scope="col">Volume (ml) added to 12 ml media</th>
+
         <th scope="col">Description</th>
        <th scope="col">OD<sub>600</sub> after dilution (0 hours)</th>
+
         <th scope="col">Designer</th>
 +
<th scope="col">Length</th>
 +
<th scope="col">Link</th>
 
       </tr>
 
       </tr>
 
     </thead>
 
     </thead>

Revision as of 11:18, 31 October 2017

P A R T S

Guide RNA (gRNA)

  • 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
  • 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
  • 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)

Name Type Description Designer Length Link
Negative Control (Colony 1) 0,461 1,435 0,167 0,06483974
Negative Control (Colony 2) 0,463 1,439 0,167 0,02584249
Positive Control (Colony 1) 0,450 1,400 0,171 0,04467949
Positive Control (Colony 2) 0,474 1,475 0,163 0,01689103
Test Device 1: J23101+I13504 (Colony 1) 0,462 1,437 0,167 0,03043498
Test Device 1: J23101+I13504 (Colony 2) 0,472 1,469 0,163 0,01977106
Test Device 2: J23106+I13504 (Colony 1) 0,477 1,483 0,162 0,03175824
Test Device 2: J23106+I13504 (Colony 2) 0,454 1,410 0,170 0,018837
Test Device 3: J23117+I13504 (Colony 1) 0,507 1,577 0,152 0,03261447
Test Device 3: J23117+I13504 (Colony 2) 0,492 1,529 0,157 0,01471154
Test Device 4: J23101.BCD2.E0040.B0015 (Colony 1) 0,420 1,307 0,184 0,03759615
Test Device 4: J23101.BCD2.E0040.B0015 (Colony 2) 0,472 1,468 0,163 0,01860348
Test Device 5: J23106.BCD2.E0040.B0015 (Colony 1) 0,513 1,595 0,150 0,04234432
Test Device 5: J23106.BCD2.E0040.B0015 (Colony 2) 0,467 1,451 0,165 0,01494505
Test Device 6: J23117.BCD2.E0040.B0015 (Colony 1) 0,482 1,498 0,160 0,04452381
Test Device 6: J23117.BCD2.E0040.B0015 (Colony 2) 0,455 1,416 0,170 0,02008242

Find Incell here: