Difference between revisions of "Team:IISc-Bangalore/Assembly"

Line 281: Line 281:
 
<img src="https://static.igem.org/mediawiki/2017/7/72/T--IISc-Bangalore--PCR1.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/7/72/T--IISc-Bangalore--PCR1.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR1 product with NcoI and HindIII
+
Double-digest PCR1 product with NcoI and HindIII (D1)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 289: Line 289:
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR2.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/b/b7/T--IISc-Bangalore--PCR2.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR2 product with NheI and NcoI
+
Double-digest PCR2 product with NheI and NcoI (D2)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 298: Line 298:
 
<img src="https://static.igem.org/mediawiki/2017/c/cf/T--IISc-Bangalore--PCR3.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/c/cf/T--IISc-Bangalore--PCR3.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR3 product with HindIII and BamHI
+
Double-digest PCR3 product with HindIII and BamHI (D3)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 305: Line 305:
 
<img src="https://static.igem.org/mediawiki/2017/5/52/T--IISc-Bangalore--PCR4.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/5/52/T--IISc-Bangalore--PCR4.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR4 product with BamHI and NheI
+
Double-digest PCR4 product with BamHI and NheI (D4)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 314: Line 314:
 
<img src="https://static.igem.org/mediawiki/2017/6/6e/T--IISc-Bangalore--PCR6.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/6/6e/T--IISc-Bangalore--PCR6.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR6 product with HindIII and NheI
+
Double-digest PCR6 product with HindIII and NheI (D6)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 323: Line 323:
 
<img src="https://static.igem.org/mediawiki/2017/0/0a/T--IISc-Bangalore--assembly-oligo-1.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/0/0a/T--IISc-Bangalore--assembly-oligo-1.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest Oligo 1 with HindIII and NdeI
+
Double-digest Oligo 1 with HindIII and NdeI (DO1)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 330: Line 330:
 
<img src="https://static.igem.org/mediawiki/2017/f/fb/T--IISc-Bangalore--assembly-PCR7.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/f/fb/T--IISc-Bangalore--assembly-PCR7.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest PCR7 product with NdeI and BamHI
+
Double-digest PCR7 product with NdeI and BamHI (D7)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
Line 337: Line 337:
 
<img src="https://static.igem.org/mediawiki/2017/a/a0/T--IISc-Bangalore--assembly-oligo-2.png" width="100%">
 
<img src="https://static.igem.org/mediawiki/2017/a/a0/T--IISc-Bangalore--assembly-oligo-2.png" width="100%">
 
<figurecaption>
 
<figurecaption>
Double-digest Oligo 2 with BamHI and NheI
+
Double-digest Oligo 2 with BamHI and NheI (DO2)
 
</figurecaption>
 
</figurecaption>
 
</figure>
 
</figure>
 +
 +
  
  

Revision as of 14:07, 1 November 2017

  1. Transformations
  2. Plasmid Isolation
  3. PCRs
  4. Restriction digests
  5. Ligations
  6. Screening

BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

Transformations for T7 expression system

BBa_K525998 and BBa_K731721

Transformations for sfGFP-SpyCatcher

BBa_K1650037 and BBa_K1321337

Transformations for mCherry

BBa_J18932

Plasmid Isolation

Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.

INSERT GEL IMAGES

PCRs

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template BBa_K525998 (T7 promoter+RBS)
Forward primer gactaccacggcatgatgaacctgaatcgc
Amplifies the CmR gene, includes NcoI site
Reverse primer gaattcAAGCTTtttctcctctttccctatagtgagtcg
Adds HindIII site downstream
Amplicon size 886 bp
PCR 2 — T7 Expression Backbone (Piece 2)
Template BBa_K731721 (T7 terminator)
Forward primer gtatcacgaggcagaatttcag
Keeps the NheI site
Reverse primer gagaatatgtttttcgtctcagcc
Splits the CmR gene, includes NcoI site
Amplicon size 1533 bp

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template BBa_K1321337 (sfGFP in Freiburg format)
Forward primer gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size 753 bp
PCR 4 — SpyCatcher
Template BBa_K1650037 (SpyCatcher)
Forward primer GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
Adds BamHI and Gly-Ser-Ser upstream
Reverse primer gacgtcGCTAGCTTAaatatgagcatcgcccttgg
Adds stop codon (TAA) and NheI site downstream
Amplicon size 450 bp

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
Adds stop codon (TAA) and NheI site downstream
Amplicon size 735 bp
PCR 6 — mCherry
Template Product of PCR5
Forward primer aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
Adds HindIII, a start codon (ATG) and His upstream
Reverse primer cgtatgGCTAGCTTATTTATACAG
Keeps stop codon (TAA) and NheI site downstream
Amplicon size 753 bp

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer accgatGGATCCtttatacagttcatccatgccg
Adds BamHI site downstream
Amplicon size 732 bp

Restriction Digests

Restriction digests for T7 expression backbone

Double-digest PCR1 product with NcoI and HindIII (D1)
Double-digest PCR2 product with NheI and NcoI (D2)

Restriction digests for sfGFP-SpyCatcher

Double-digest PCR3 product with HindIII and BamHI (D3)
Double-digest PCR4 product with BamHI and NheI (D4)

Restriction digest for 6xHis-mCherry

Double-digest PCR6 product with HindIII and NheI (D6)

Restriction digests for mCherry-SpyTag

Double-digest Oligo 1 with HindIII and NdeI (DO1)
Double-digest PCR7 product with NdeI and BamHI (D7)
Double-digest Oligo 2 with BamHI and NheI (DO2)
Restriction enzymes used in our assembly
Restriction Enzyme Sequence Activity in NEBuffers (%) Incubation temperature Heat inactivation
1.1 2.1 3.1 CutSmart
AgeI A\CCGGT 100 75 25 75 37°C 65°C
AgeI-HF A\CCGGT 100 50 10 100 37°C 65°C
BamHI G\GATCC 75* 100* 100 100* 37°C
BamHI-HF G\GATCC 100 50 10 100 37°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
NcoI C\CATGG 100 100 100 100 37°C 80°C
NcoI-HF C\CATGG 50 100 10 100 37°C 80°C
NdeI CA\TATG 75 100 100 100 37°C 65°C
NheI G\CTAGC 100 100 10 100 37°C 65°C
NheI-HF G\CTAGC 100 25 10 100 37°C 80°C
* denotes star activity

Multi-Ligation

Ligating sfGFP-SpyCatcher

PLACEHOLDER

Ligating 6xHis-mCherry

PLACEHOLDER

INSERT PLATE PICTURES

Screening Transformants

We screened 30 transformants from each plate using colony PCR with primers VF2 and VR, which we standardized using Taq polymerase (annealing temperature of 56°C).

PLACEHOLDER caption