Line 361: | Line 361: | ||
<ul> | <ul> | ||
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">E. coli strain containing the pCas plasmid.</li> |
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">pTargetTet targeting the locus to be modified.</li> |
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">Donor DNA: gene of interest flanked by two 500-bp overlaps, or an ssDNA for deletion.</li> |
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">LB, Kanamycin, Tetracyclin.</li> |
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">Arabinose 10%.</li> |
− | <li style="color:#999999;margin-left:20px;"> | + | <li style="color:#999999;margin-left:20px;">Chilled sterile ddH2O.</li> |
+ | <li style="color:#999999;margin-left:20px;">Sterile PEP tube.</li> | ||
+ | <li style="color:#999999;margin-left:20px;">IPTG 0,1 M.</li> | ||
</ul> | </ul> | ||
+ | |||
<div class="section-title" style="text-align:left;float:left;width:100%;margin-bottom:0"> | <div class="section-title" style="text-align:left;float:left;width:100%;margin-bottom:0"> |
Revision as of 02:37, 31 October 2017
Introduction
Materials
- Agarose Powder
- TAE buffer
- Gel mould
- Gel Tank
- DNA ladder
- DNA loading dye
Procedure
- Prepare 0.8% agarose (w/v) solution in TAE buffer.
- Heat until the agarose dissolve.
- Pour into the gel mould and set a comb.
- Wait for the gel to solidify.
- Remove the comb and transfer into the gel tank. Fill with TAE buffer.
- Fill the wells with DNA ladder and your samples mixed with corresponding amount of loading dye.
- Run for 20-30 minutes at 120 V.
T4 Ligation
Materials
- PCR tubes
- T4 DNA Ligase (NEB)
- T4 DNA Ligase buffer 10x
- ddH20
- Insert DNA
Procedure
- Calculate insert to vector ratio with NEB calculator. Most common is 3:1.
- Add the vector plasmid, the insert DNA, 2 µL of buffer, 1 µL of T4 ligase and enough ddH20 to reach 20 µL.
- Gently mix by pipeting up and down.
- For cohesive (sticky) ends, incubate at 16°C overnight or room temperature for 10 minutes. For blunt ends or single base overhangs, incubate at 16°C overnight or room temperature for 2 hours.
- Heat inactivate at 65°C for 10 minutes.
Selection of the sgRNA and modification of pTarget
Introduction
This protocol cover the identification of a suitable N20 sequence and the modification of the pTarget plasmid. Protocol from S. Worms.
Procedure
1) Selection of the N20 sequence
- Use Benchling's CRISPR tool, click on "Design and analyse guide"
- Using the default settings (note: Doench et al.'s optimized scoring algorithm doesn't work for circular sequences such as bacterial chromosomes)
- Select the target region and press (+)
- Select the N20 with the higher On-target score.
2) Modification of pTarget
pTarget is currently available in two version, pTargetF with spectinomycin resistance and pTargetTet_pyrF and its derivatives with a tetracyclin resistance. They should behave identically.
1. Design a forward oligo to use for a QuickChange-like insertion of the N20 sequence. The sequence of the primer should be the following:
agctagctcagtcctaggtataatactagtNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaagttaaaa
where the Ns stands for your N20 sequence.
2. Amplify the pTarget backbone of your choice using the designed forward primer and the appropriate reverse primer (actagtattatacctaggactgagctagctg) using Q5 polymerase and the following conditions:
Temperature (°C) | Time | |
---|---|---|
98 | 30 s | |
98 | 15 s | 35 x |
65 | 30 s | |
72 | 75 s | |
72 | 120 s | |
4 | inf. |
Media
Materials
- NaCl
- Tryptone
- Yeast Extract
- Na2HPO4
- KH2PO4
- NH4Cl
- Glucose
- Tyrosine
- ddH20
- CaSO5
- MgSO4
- Agar
- Heat-resistant glass bottles
Procedure M9 medium
- Make 10xM9 salts.
- Mix the following in 500 mL H20 and sterilize by autoclave.
- Make 1M CaCl2 stock solution The CaCl2 is sterilized separately to avoid formation of CaSO4 precipitate. Dissolve 5.592 g CaC2 to 50 mL H2O and sterilize by filtration or autoclaving.
- Make 1M MgSO4 stock solution.
- Make 20% glucose solution. Dissolve 10g of glucose in 50 mL H2O and sterilize by filtration. Do not autoclave. Dissolve 6.018 g of MgSO4 in 50 mL H2O and sterilize by filtration or autoclaving.
- Make 5x tyrosine solution. Dissolve 0.25 g of tyrosine in 1L H2O and sterilize by filtration.
- Sterilize water by autoclaving.
- For 500 mL.
Mass (g) | |
---|---|
Na2HPO4 | 64 (Na2HPO4.7H2O) |
KH2PO4 | 15 |
NaCl | 2.5 |
NH4Cl | 5 |
M9 | M9 + Tyr | M9 Agar | M9 Agar + Tyr | |
---|---|---|---|---|
10x M9 salts | 50 | 50 | 50 | 50 |
Agar (g) | 0 | 0 | 7.5 | 7.5 |
H2O | 445 | 345 | 445 | 345 |
Autoclave | No | No | Yes | Yes |
M1 MgSO4 | 1 | 1 | 1 | 1 |
M1 CaSO4 | 0,1 | 0,01 | 0,01 | 0,1 |
20% glucose | 5 | 5 | 5 | 5 |
Tyrosine | 0 | 100 | 0 | 100 |
Procedure LB medium
- Mix the following.
- Add ddH2O to the desired volume.
- Sterilize by autoclaving.
Volume (1L) | ||
---|---|---|
LB | LB agar | |
Yeast Extract (g) | 8 | 8 |
Tryptone (g) | 5 | 5 |
NaCl (g) | 5 | 5 |
Agar (g) | 0 | 14 |
Materials
- E. coli strain containing the pCas plasmid.
- pTargetTet targeting the locus to be modified.
- Donor DNA: gene of interest flanked by two 500-bp overlaps, or an ssDNA for deletion.
- LB, Kanamycin, Tetracyclin.
- Arabinose 10%.
- Chilled sterile ddH2O.
- Sterile PEP tube.
- IPTG 0,1 M.
Procedure
- Prepare 0.8% agarose (w/v) solution in TAE buffer.
- Heat until the agarose dissolve.
- Pour into the gel mould and set a comb.
- Wait for the gel to solidify.
- Remove the comb and transfer into the gel tank. Fill with TAE buffer.
- Fill the wells with DNA ladder and your samples mixed with corresponding amount of loading dye.
- Run for 20-30 minutes at 120 V.