Difference between revisions of "Team:IISc-Bangalore/Assembly"

Line 14: Line 14:
 
<h1 id="biobrick-transformations">BioBrick Transformations</h1>
 
<h1 id="biobrick-transformations">BioBrick Transformations</h1>
  
<p>The five BioBricks we are using are transformed into <i>E. coli</i> strain DH5α — chosen for its <i>recA</i> and <i>endA</i> mutations that allow for high-yield minipreps.</p>
+
<p>The five BioBricks we are using were transformed into <i>E. coli</i> strain DH5α — chosen for its <i>recA</i> and <i>endA</i> mutations that allow for high-yield minipreps.</p>
  
 
<h2>INSERT IMAGES OF PLATES</h2>
 
<h2>INSERT IMAGES OF PLATES</h2>
Line 20: Line 20:
 
<h1 id="plasmid-isolation">Plasmid Isolation</h1>
 
<h1 id="plasmid-isolation">Plasmid Isolation</h1>
  
<p>Minipreps are performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants is used to make a glycerol stock.</p>
+
<p>Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.</p>
  
 
<h2>INSERT GEL IMAGES</h2>
 
<h2>INSERT GEL IMAGES</h2>
Line 29: Line 29:
 
<h2>PCRs for the T7 expression backbone</h2>
 
<h2>PCRs for the T7 expression backbone</h2>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 1 — T7 Expression Backbone (Piece 1)</th>
 
<th colspan="2">PCR 1 — T7 Expression Backbone (Piece 1)</th>
Line 62: Line 62:
  
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 2 — T7 Expression Backbone (Piece 2)</th>
 
<th colspan="2">PCR 2 — T7 Expression Backbone (Piece 2)</th>
Line 95: Line 95:
 
<h2>PCRs for sfGFP-SpyCatcher</h2>
 
<h2>PCRs for sfGFP-SpyCatcher</h2>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 3 — sfGFP</th>
 
<th colspan="2">PCR 3 — sfGFP</th>
Line 128: Line 128:
 
<h2>PCR 4: SpyCatcher</h2>
 
<h2>PCR 4: SpyCatcher</h2>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 4 — SpyCatcher</th>
 
<th colspan="2">PCR 4 — SpyCatcher</th>
Line 161: Line 161:
 
<h2>PCRs for 6xHis-mCherry</h2>
 
<h2>PCRs for 6xHis-mCherry</h2>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 5 — mCherry</th>
 
<th colspan="2">PCR 5 — mCherry</th>
Line 192: Line 192:
 
</table>
 
</table>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 6 — mCherry</th>
 
<th colspan="2">PCR 6 — mCherry</th>
Line 225: Line 225:
 
<h2>PCRs for mCherry-SpyTag</h2>
 
<h2>PCRs for mCherry-SpyTag</h2>
  
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="2">PCR 7 — mCherry-SpyTag</th>
 
<th colspan="2">PCR 7 — mCherry-SpyTag</th>
Line 257: Line 257:
  
 
<h1 id="restriction-digests">Restriction Digests</h1>
 
<h1 id="restriction-digests">Restriction Digests</h1>
<table>
+
<table width="100%">
 
<tr>
 
<tr>
 
<th colspan="8">Restriction enzymes used in our assembly</th>
 
<th colspan="8">Restriction enzymes used in our assembly</th>

Revision as of 11:16, 31 October 2017

  1. BioBrick Transformations
  2. Plasmid Isolation
  3. PCRs
  4. Restriction digests
  5. Ligations
  6. Screening

BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

INSERT IMAGES OF PLATES

Plasmid Isolation

Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.

INSERT GEL IMAGES

PCRs: Adding Restriction Sites and Linkers

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template BBa_K525998 (T7 promoter+RBS)
Forward primer gactaccacggcatgatgaacctgaatcgc
Splits the CmR gene, includes NcoI site
Reverse primer gaattcAAGCTTtttctcctctttccctatagtgagtcg
Adds HindIII site downstream
Amplicon size 886 bp
Polymerase Q5 polymerase
PCR 2 — T7 Expression Backbone (Piece 2)
Template BBa_K731721 (T7 terminator)
Forward primer gtatcacgaggcagaatttcag
Keeps the NheI site
Reverse primer gagaatatgtttttcgtctcagcc
Splits the CmR gene, includes NcoI site
Amplicon size 1533 bp
Polymerase Q5 polymerase

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template BBa_K1321337 (sfGFP in Freiburg format)
Forward primer gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size 753 bp
Polymerase Q5 polymerase

PCR 4: SpyCatcher

PCR 4 — SpyCatcher
Template BBa_K1650037 (SpyCatcher)
Forward primer GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
Adds BamHI and Gly-Ser-Ser upstream
Reverse primer gacgtcGCTAGCTTAaatatgagcatcgcccttgg
Adds stop codon (TAA) and NheI site downstream
Amplicon size 450 bp
Polymerase Q5 polymerase

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
Adds stop codon (TAA) and NheI site downstream
Amplicon size 735 bp
Polymerase Q5 polymerase
PCR 6 — mCherry
Template Product of PCR5
Forward primer aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
Adds HindIII, a start codon (ATG) and His upstream
Reverse primer cgtatgGCTAGCTTATTTATACAG
Keeps stop codon (TAA) and NheI site downstream
Amplicon size 753 bp
Polymerase Q5 polymerase

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer accgatGGATCCtttatacagttcatccatgccg
Adds BamHI site downstream
Amplicon size 732 bp
Polymerase Q5 polymerase

Restriction Digests

Restriction enzymes used in our assembly
Restriction Enzyme Sequence Activity in NEBuffers (%) Incubation temperature Heat inactivation
1.1 2.1 3.1 CutSmart
AgeI A\CCGGT 100 75 25 75 37°C 65°C
AgeI-HF A\CCGGT 100 50 10 100 37°C 65°C
BamHI G\GATCC 75* 100* 100 100* 37°C
BamHI-HF G\GATCC 100 50 10 100 37°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
NcoI C\CATGG 100 100 100 100 37°C 80°C
NcoI-HF C\CATGG 50 100 10 100 37°C 80°C
NheI G\CTAGC 100 100 10 100 37°C 65°C
NheI-HF G\CTAGC 100 25 10 100 37°C 80°C
* denotes star activity| NOTE ADD NdeI TOO

Multi-Ligation: Coming Full Circle

Screening Transformants: Colony PCR with VF2/VR