Raj Magesh (Talk | contribs) |
Raj Magesh (Talk | contribs) |
||
Line 57: | Line 57: | ||
<h2>INSERT GEL IMAGES</h2> | <h2>INSERT GEL IMAGES</h2> | ||
− | <h1 id="pcrs">PCRs | + | <h1 id="pcrs">PCRs</h1> |
− | Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual. | + | <p>Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.</p> |
<h2>PCRs for the T7 expression backbone</h2> | <h2>PCRs for the T7 expression backbone</h2> | ||
Line 286: | Line 286: | ||
<h2>Restriction digests for T7 expression backbone</h2> | <h2>Restriction digests for T7 expression backbone</h2> | ||
+ | <h3>Digest 1: Double-digest PCR1 product with NcoI and HindIII</h3> | ||
+ | <h3>Digest 2: Double-digest PCR2 product with NheI and NcoI</h3> | ||
+ | |||
+ | <h2>Restriction digests for sfGFP-SpyCatcher</h2> | ||
+ | |||
+ | <h3>Digest 3: Double-digest PCR3 product with HindIII and BamHI</h3> | ||
+ | |||
+ | <h3>Digest 3: Double-digest PCR3 product with HindIII and BamHI</h3> | ||
<table width="100%"> | <table width="100%"> |
Revision as of 21:28, 31 October 2017
BioBrick Transformations
The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.
Plasmid Isolation
Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.
INSERT GEL IMAGES
PCRs
Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.
PCRs for the T7 expression backbone
PCR 1 — T7 Expression Backbone (Piece 1) | |
---|---|
Template | BBa_K525998 (T7 promoter+RBS) |
Forward primer | gactaccacggcatgatgaacctgaatcgc |
Amplifies the CmR gene, includes NcoI site | |
Reverse primer | gaattcAAGCTTtttctcctctttccctatagtgagtcg |
Adds HindIII site downstream | |
Amplicon size | 886 bp |
PCR 2 — T7 Expression Backbone (Piece 2) | |
---|---|
Template | BBa_K731721 (T7 terminator) |
Forward primer | gtatcacgaggcagaatttcag |
Keeps the NheI site | |
Reverse primer | gagaatatgtttttcgtctcagcc |
Splits the CmR gene, includes NcoI site | |
Amplicon size | 1533 bp |
PCRs for sfGFP-SpyCatcher
PCR 3 — sfGFP | |
---|---|
Template | BBa_K1321337 (sfGFP in Freiburg format) |
Forward primer | gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc |
Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream | |
Reverse primer | gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg |
Adds Gly-Gly-Ser and BamHI site downstream | |
Amplicon size | 753 bp |
PCR 4 — SpyCatcher | |
---|---|
Template | BBa_K1650037 (SpyCatcher) |
Forward primer | GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc |
Adds BamHI and Gly-Ser-Ser upstream | |
Reverse primer | gacgtcGCTAGCTTAaatatgagcatcgcccttgg |
Adds stop codon (TAA) and NheI site downstream | |
Amplicon size | 450 bp |
PCRs for 6xHis-mCherry
PCR 5 — mCherry | |
---|---|
Template | BBa_J18932 (mCherry RFP) |
Forward primer | CACCATCATCACCATGTGAGCAAAGGCGAGGAAG |
Adds 5xHis upstream | |
Reverse primer | cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG |
Adds stop codon (TAA) and NheI site downstream | |
Amplicon size | 735 bp |
PCR 6 — mCherry | |
---|---|
Template | Product of PCR5 |
Forward primer | aattcgAAGCTTATGCACCACCATCATCACCATGTGAG |
Adds HindIII, a start codon (ATG) and His upstream | |
Reverse primer | cgtatgGCTAGCTTATTTATACAG |
Keeps stop codon (TAA) and NheI site downstream | |
Amplicon size | 753 bp |
PCRs for mCherry-SpyTag
PCR 7 — mCherry-SpyTag | |
---|---|
Template | BBa_J18932 (mCherry RFP) |
Forward primer | CACCATCATCACCATGTGAGCAAAGGCGAGGAAG |
Adds 5xHis upstream | |
Reverse primer | accgatGGATCCtttatacagttcatccatgccg |
Adds BamHI site downstream | |
Amplicon size | 732 bp |
Restriction Digests
Restriction digests for T7 expression backbone
Digest 1: Double-digest PCR1 product with NcoI and HindIII
Digest 2: Double-digest PCR2 product with NheI and NcoI
Restriction digests for sfGFP-SpyCatcher
Digest 3: Double-digest PCR3 product with HindIII and BamHI
Digest 3: Double-digest PCR3 product with HindIII and BamHI
Restriction enzymes used in our assembly | |||||||
---|---|---|---|---|---|---|---|
Restriction Enzyme | Sequence | Activity in NEBuffers (%) | Incubation temperature | Heat inactivation | |||
1.1 | 2.1 | 3.1 | CutSmart | ||||
AgeI | A\CCGGT | 100 | 75 | 25 | 75 | 37°C | 65°C |
AgeI-HF | A\CCGGT | 100 | 50 | 10 | 100 | 37°C | 65°C |
BamHI | G\GATCC | 75* | 100* | 100 | 100* | 37°C | — |
BamHI-HF | G\GATCC | 100 | 50 | 10 | 100 | 37°C | — |
HindIII | A\AGCTT | 25 | 100 | 50 | 50 | 37°C | 80°C |
HindIII-HF | A\AGCTT | 10 | 100 | 10 | 100 | 37°C | 80°C |
HindIII | A\AGCTT | 25 | 100 | 50 | 50 | 37°C | 80°C |
HindIII-HF | A\AGCTT | 10 | 100 | 10 | 100 | 37°C | 80°C |
NcoI | C\CATGG | 100 | 100 | 100 | 100 | 37°C | 80°C |
NcoI-HF | C\CATGG | 50 | 100 | 10 | 100 | 37°C | 80°C |
NdeI | CA\TATG | 75 | 100 | 100 | 100 | 37°C | 65°C |
NheI | G\CTAGC | 100 | 100 | 10 | 100 | 37°C | 65°C |
NheI-HF | G\CTAGC | 100 | 25 | 10 | 100 | 37°C | 80°C |
* denotes star activity| NOTE ADD NdeI TOO |