Difference between revisions of "Team:UCopenhagen/Parts"
| Line 39: | Line 39: | ||
<thead> | <thead> | ||
<tr> | <tr> | ||
| − | |||
<th scope="col">Name</th> | <th scope="col">Name</th> | ||
<th scope="col">Type</th> | <th scope="col">Type</th> | ||
Revision as of 18:57, 1 November 2017
Guide RNA (gRNA)
- 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
- 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
- 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)
| Name | Type | Description | Designer | Length | Link | |
|---|---|---|---|---|---|---|
| BBa_K2455000 | Basic Part | His-tagged AroG gene from E. coli MG1655 | 1092 | ahhttp://parts.igem.org/wiki/index.php?title=Part:BBa_K2455000 | ||
| BBa_K2455001 | Basic Part | His-tagged TrpE gene from E. coli MG1655 | 1602 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455002 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455003 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455004 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455005 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455007 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
| BBa_K2455008 | 0,461 | 1,435 | 0,167 | 0,06483974 | 0,06483974 | 0,06483974 |
