Difference between revisions of "Team:UCopenhagen/Parts"

Line 50: Line 50:
 
     <tbody>
 
     <tbody>
 
       <tr>
 
       <tr>
         <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455000">BBa_K2455000</a></th>
+
         <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455000" style="color:black">BBa_K2455000</a></th>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Type">Basic Part</td>
 
         <td data-title="Description">His-tagged AroG gene from E. coli MG1655</td>
 
         <td data-title="Description">His-tagged AroG gene from E. coli MG1655</td>

Revision as of 19:08, 1 November 2017

P A R T S

Guide RNA (gRNA)

  • 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
  • 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
  • 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)

Name Type Type Designer Length
BBa_K2455000 Basic Part His-tagged AroG gene from E. coli MG1655 1092
BBa_K2455001 Basic Part His-tagged TrpE gene from E. coli MG1655 1602 0,06483974 0,06483974 0,06483974
BBa_K2455002 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974
BBa_K2455003 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974
BBa_K2455004 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974
BBa_K2455005 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974
BBa_K2455007 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974
BBa_K2455008 0,461 1,435 0,167 0,06483974 0,06483974 0,06483974

Find Incell here: