Difference between revisions of "Team:UCopenhagen/Parts"
| Line 57: | Line 57: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row">BBa_K2455001</th> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455001" style="color:black">BBa_K2455001</a></th> |
| − | <td data-title=" | + | <td data-title="Type">Basic Part</td> |
| − | <td data-title=" | + | <td data-title="Description">His-tagged TrpE gene from E. coli MG1655</td> |
| − | <td data-title=" | + | <td data-title="Designer" data-type="currency"></td> |
| − | + | <td data-title="Length" data-type="currency">1602</td> | |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455002" style="color:black">BBa_K2455002</a></th> |
| − | + | <td data-title="Type">Basic Part (Improvement of old)</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">R9-SYFP2-6His</td> |
| − | <td data-title="Description" | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">804</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455003" style="color:black">BBa_K2455003</a></th> |
| − | + | <td data-title="Type">Basic Part</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">Nona-Arginine with his-tag</td> |
| − | <td data-title="Description" | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">81</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455004" style="color:black">BBa_K2455004</a></th> |
| − | + | <td data-title="Type">Basic Part</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">YddG E. coli Tyr, Trp, Phe exporter </td> |
| − | <td data-title="Description | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">885</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455005" style="color:black">BBa_K2455005</a></th> |
| − | + | <td data-title="Type">Basic Part (Improvement of old - Illegal)</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">R9-mTag BFP-6His </td> |
| − | <td data-title="Description" | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">786</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455007" style="color:black">BBa_K2455007</a></th> |
| − | + | <td data-title="Type">Basic Part (Composite)</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001)</td> |
| − | <td data-title="Description" | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">2513</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <th scope="row"> | + | <th scope="row"><a href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2455008" style="color:black">BBa_K2455008</a></th> |
| − | + | <td data-title="Type">Basic Part (Composite)</td> | |
| − | <td data-title="Type"> | + | <td data-title="Description">YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) </td> |
| − | <td data-title="Description" | + | <td data-title="Designer" data-type="currency"></td> |
| − | <td data-title="Designer" data-type="currency"> | + | <td data-title="Length" data-type="currency">2005</td> |
| − | <td data-title="Length" data-type="currency"> | + | |
| − | + | ||
</tr> | </tr> | ||
</tbody> | </tbody> | ||
Revision as of 19:18, 1 November 2017
Guide RNA (gRNA)
- 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
- 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
- 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)
| Name | Type | Type | Designer | Length |
|---|---|---|---|---|
| BBa_K2455000 | Basic Part | His-tagged AroG gene from E. coli MG1655 | 1092 | |
| BBa_K2455001 | Basic Part | His-tagged TrpE gene from E. coli MG1655 | 1602 | |
| BBa_K2455002 | Basic Part (Improvement of old) | R9-SYFP2-6His | 804 | |
| BBa_K2455003 | Basic Part | Nona-Arginine with his-tag | 81 | |
| BBa_K2455004 | Basic Part | YddG E. coli Tyr, Trp, Phe exporter | 885 | |
| BBa_K2455005 | Basic Part (Improvement of old - Illegal) | R9-mTag BFP-6His | 786 | |
| BBa_K2455007 | Basic Part (Composite) | YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001) | 2513 | |
| BBa_K2455008 | Basic Part (Composite) | YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) | 2005 |
